MRNA or mRNA-LNP complex for coding antibody-antigen fusion protein and application of mRNA or mRNA-LNP complex

Abstract

The invention provides an mRNA (messenger Ribonucleic Acid) or mRNA-LNP (Leucine Natriuretic Peptide) compound for coding antibody-antigen fusion protein and application thereof, and belongs to the technical field of cell therapy. Wherein the coding frame sequence of the mRNA comprises an antibody sequence, a cleavage sequence and an antigen peptide sequence; wherein the antibody targets a tumor high-expression surface protein, and the antigen is a high-immunogenicity antigen. According to the mRNA-coded antibody-antigen fusion protein, high-expression protein on the surface of a tumor cell is specifically recognized through an antibody, and a high-immunogenicity antigen is introduced into a recognized tumor target cell to mark the tumor cell. The mRNA can be ingested, processed and presented by antigen presenting cells so as to stimulate and activate antigen-specific TCR-T cells in vivo. Therefore, the widely labeled tumor cells can be specifically recognized and killed by the antigen-specific TCR-T cells in vivo.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell therapy, and in particular relates to an mRNA or mRNA-LNP complex encoding an antibody-antigen fusion protein and an application thereof. Background Art

[0002] Cytotoxic CD8+ T lymphocyte (CTL)-mediated tumor recognition and elimination is an effective cancer immunotherapy that has demonstrated significant anti-cancer effects in multiple clinical studies. However, factors such as the absence of anti-tumor CTLs in the tumor microenvironment (TME), suppressed CTL function, and tumor immune escape (escape from anti-tumor CTL responses) limit the clinical treatment effect of many solid tumor patients.

[0003] Personalized therapeutic cancer vaccines aim to deliver tumor-specific T cell epitopes, so-called neoantigens, in various forms (synthetic long / short peptides, mRNA or DNA) to induce new tumor-specific CTL responses and / or amplify endogenous tumor-specific CTL responses. For example, CN117883558A discloses a personalized tumor vaccine prepared based on high-affinity neoantigen mRNA. The anti-tumor activity of this method has been proven to be safe and effective in clinical trials. The currently disclosed clinical personalized neoantigen vaccine products include GEN-009, RO7198457, etc.

[0004] However, cancer vaccines based on neoantigens also face many challenges: a relatively large proportion of vaccine neoepitopes do not stimulate T cell responses, downregulation or deletion of tumor cell MHC-I alleles, poor homing of neoantigen-specific CTLs, etc. These difficulties hinder the universality of personalized therapeutic cancer vaccines.

[0005] Therefore, a primary challenge in the field of cancer vaccine research is to improve our ability to induce T cell responses, especially maximal activation and expansion of CD8+ T cells. Summary of the invention

[0006] In order to solve the problems existing in the above-mentioned prior art, the present invention provides an mRNA or mRNA-LNP complex encoding an antibody-antigen fusion protein and its application. The mRNA encoding the antibody-antigen fusion protein provided by the present invention introduces a highly immunogenic antigen into the target tumor through an antibody targeting a tumor highly expressed antigen, thereby marking the target tumor. Since the highly immunogenic antigen is an exogenous antigen, on the one hand, after entering the body as an antigen, it will be presented, recognized, and stimulated to produce corresponding specific T cells, thereby causing the activation and amplification of antigen-specific T cells in the body. On the other hand, the antigen introduced into the target tumor by the antibody can mark tumor cells, which can improve the recognition and killing of tumor cells by antigen-specific T cells. The specific contents are as follows:

[0007] In a first aspect, the present invention provides an mRNA encoding an antibody-antigen fusion protein. The coding frame sequence of the mRNA includes: an antibody sequence, a cleavage sequence and an antigen peptide sequence; wherein the antibody targets a highly expressed surface protein of a tumor, and the antigen is a highly immunogenic antigen.

[0008] In some embodiments, the antibody targets FOLR1 or CLAN18.2.

[0009] In some embodiments, the antibody sequence is encoded by the nucleotide sequence shown in SEQ ID NO: 1 or a degenerate sequence thereof; or is encoded by the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof.

[0010] In some embodiments, the cleavage sequence is a sequence recognized by a protease highly expressed in tumor tissue.

[0011] In some embodiments, the cleavage site corresponding to the cleavage sequence specifically comprises the amino acid sequence shown in any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.

[0012] In some embodiments, the antigen is selected from one or more of human cytomegalovirus, Epstein-Barr virus, novel coronavirus, and human antigen.

[0013] In some embodiments, the antigenic peptide sequence comprises one or more of the amino acid sequences shown in SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13.

[0014] In some embodiments, the mRNA encoding the antibody-antigen fusion protein comprises the following structure:

[0015] cap structure, 3'UTR, CDS, 5'UTR and Poly A.

[0016] In some embodiments, the 3'UTR comprises the nucleotide sequence shown in SEQ ID NO:14.

[0017] In some embodiments, the 5'UTRs comprise the nucleotide sequence shown in SEQ ID NO:15.

[0018] In a second aspect, the present invention provides a method for preparing the mRNA encoding the antibody-antigen fusion protein described in the first aspect. The method uses a plasmid as an mRNA transcription template to prepare the mRNA encoding the antibody-antigen fusion protein.

[0019] In a third aspect, the present invention provides an mRNA-LNP complex, wherein the complex comprises the mRNA encoding the antibody-antigen fusion protein described in the first aspect.

[0020] In some embodiments, the LNP contains ionizable cationic lipids, cholesterol, neutral auxiliary phospholipids and PEG lipids; the molar ratio of the ionizable cationic lipids, neutral auxiliary phospholipids, cholesterol and PEG lipids is 38-50:5-14:38-51:1-2.

[0021] In some embodiments, the molar ratio of the ionizable cationic lipid, neutral auxiliary phospholipid, cholesterol and PEG lipid is 40.0:12.0:46.8:1.2 or 40.0:12.6:46.2:1.2 or 40.0:13.6:44.6:1.8 or 40.6:8.0:50.2:1.8 or 40.3:12.0:46.2:1.5 or 38.4:13.6:46.2:1.8 or 50.0:10.0:38.5:1.5.

[0022] In a fourth aspect, the present invention provides an mRNA vaccine comprising the mRNA encoding the antibody-antigen fusion protein described in the first aspect.

[0023] In a fifth aspect, the present invention provides an application of the mRNA encoding the antibody-antigen fusion protein described in the first aspect, the mRNA-LNP complex described in the third aspect, or the exogenous antigen mRNA vaccine described in the fourth aspect. The application includes: application in the preparation of tumor targeted therapeutic drugs, or application in the preparation of tumor targeted therapeutic drugs in combination with a second therapeutic agent.

[0024] In some embodiments, the second therapeutic agent is one or more of anti-PD-1, anti-PD-L1, anti-CTLA-4 and DC tumor vaccine.

[0025] The present invention aims to introduce highly immunogenic antigenic peptides into tumor cells in the form of mRNA based on antibodies targeting highly expressed surface proteins of tumors, and tumor cells marked by antigenic peptide-MHC complexes can be recognized, killed and eliminated by widely existing antigenic peptide-specific CTLs. Among them, specific antibodies can carry at least one antigen to target and mark tumor cells, which are then efficiently recognized and killed by specific TCR-T cells.

[0026] In the embodiments of the present invention, ovarian cancer is used as the target tumor, and the selection of antibodies and cleavage sequences targeting tumor highly expressed proteins is determined based on ovarian cancer. If it is required to be applied to other cancers, tumor-targeting antibodies and specific cleavage sequences can be screened and prepared according to different cancer types. The specific tumor can also be any one of breast cancer, lung cancer, liver cancer, glioma, kidney cancer, and bladder cancer.

[0027] In addition, the antigen is a highly immunogenic antigen, which can be a viral antigen or a highly immunogenic human antigen in specific implementation. In the early stage, the selected antigen can be screened in the population to verify that it has a wide range of immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 A schematic diagram showing a transcription template of mRNA encoding an antibody-antigen fusion protein in an embodiment of the present invention;

[0029] Figure 2 The expression positive rate of GFP mRNA delivered to OVCAR8 cells by LNPs with different composition ratios (Table 2) in Example 3 is shown by FACS (flow cytometry);

[0030] Figure 3 The mean fluorescence intensity of GFP mRNA delivered to OVCAR8 cells by LNPs with different composition ratios (Table 2) in Example 3 is shown by FACS analysis;

[0031] Figure 4 The expression results of different groups corresponding to FSC#0-FSC#12 in this example are shown by FACS analysis;

[0032] Figure 5 The expression results of different groups corresponding to FSC#13-FSC#25 in this example are shown by FACS analysis;

[0033] Figure 6 The FACS analysis shows the ratio of antigen peptides (ATEGALNTPK) generated after the fusion proteins containing different cleavage sites in Example 4 were cleaved by enzymes and presented by HLA-A*1101;

[0034] Figure 7 CD8 in Example 5 + The percentage of T cells killing cells transfected with mRNA encoding antibody (LNP-mRNA(F)) and mRNA encoding antibody-antigen fusion protein (LNP-mRNA(FSC#23));

[0035] Figure 8 A flowchart showing the in vivo efficacy validation in mice of Example 5;

[0036] Fig. 9The tumor growth in tumor-bearing mice after injection of mRNA encoding antibody (LNP-mRNA (F)) and mRNA encoding antibody-antigen fusion protein (LNP-mRNA (FSC#23)) in Example 5 is shown;

[0037] Fig.10 The figure shows the inhibitory effect of LNP-mRNA (FCC#5) on tumors after paratumoral injection in the experimental group;

[0038] Fig.11 The figure shows the inhibitory effect of LNP-mRNA (FEC#13) on tumors after paratumoral injection in the experimental group;

[0039] Fig.12 The figure shows the inhibitory effect of LNP-mRNA (FMC#17) on tumors after paratumoral injection in the experimental group;

[0040] Fig.13 The inhibitory effects of the LNP treatment group, DCs treatment group, LNP-mRNA (FSC#23) treatment group, and LNP-mRNA (FSC#23) and DCs combined treatment group on tumors after injection in Example 10 are shown;

[0041] Fig.14 The killing percentages of the experimental group LNP-mRNA (CSC#19) and the control group LNP-mRNA (C) in Example 11 are shown. DETAILED DESCRIPTION

[0042] In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods. The embodiments of the present invention are described in detail below. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0043] Various aspects of the present invention are described in detail in the following embodiments. The purpose of the embodiments is not to limit the present invention. Each embodiment can be applied to any aspect of the present invention. In this application, unless otherwise stated, the use of "or" means "and / or".

[0044] A variety of CTLs specifically targeting human viruses (previously infected hosts) have been found in human peripheral blood, such as human cytomegalovirus (CMV), Epstein-Barr virus, influenza virus, and SARS-Cov-2 virus. In addition, virus-targeted CTLs have also been found to infiltrate various solid tumors to varying degrees. However, tumor cells do not express virus-derived antigens. Therefore, antiviral CTLs amplified in tumors do not attack tumor cells through specific TCR recognition of antigen-MHC complexes.

[0045] Based on the fact that virus-targeted CTLs exist in large numbers in the population and can efficiently and specifically target common viruses, using these antiviral bystander CTLs caused by common human virus infections to attack tumors has great potential for cancer immunotherapy. In order to use antiviral CTLs in the body to attack tumor cells, tumor cells should first be labeled with virus-derived antigenic peptides (forming a peptide-MHC complex) so that they can be recognized and killed by antiviral CTLs.

[0046] Based on the above analysis, the present invention proposes the idea of ​​introducing highly immunogenic viral antigens into target tumors using targeted antibodies in the form of mRNA. The specific contents are as follows:

[0047] In the first aspect, an embodiment of the present invention provides an mRNA encoding an antibody-antigen fusion protein. The coding frame sequence of the mRNA includes: an antibody sequence, a cleavage sequence, and a viral antigen peptide sequence; wherein the antibody targets a highly expressed antigen of a tumor, and the antigen is a highly immunogenic antigen.

[0048] In this embodiment, the antibody encoded by the antibody sequence targets surface proteins highly expressed in tumor tissues, and based on its specific expression in tumor tissues, highly immunogenic antigens can be accurately introduced into tumor cells.

[0049] In specific implementation, highly immunogenic antigens can be antigens of non-target tumors (such as viral antigens, other tumor antigens, etc.) or antigens of target tumors. When these highly immunogenic antigens are introduced into tumor tissues, they can further stimulate the activation and amplification of antigen peptide-specific CTLs at the baseline level, thereby achieving the purpose of efficiently killing tumor cells.

[0050] The antibody-antigen fusion protein encoded by the mRNA specifically recognizes highly expressed proteins on the surface of tumor cells through antibodies, and introduces highly immunogenic antigens into the recognized tumor target cells to mark tumor cells. The mRNA can be taken up, processed and presented by antigen presenting cells, thereby stimulating and activating antigen-specific TCR-T cells in the body. As a result, widely marked tumor cells can be specifically recognized and killed by antigen-specific TCR-T cells in the body.

[0051] Figure 1 Schematic diagram of the transcription template of the mRNA encoding the antibody-antigen fusion protein in the embodiment of the present invention is shown. In this embodiment, the cleavage sequence connects the antibody sequence and the antigen peptide sequence, and the coding frame is as follows Figure 1 As shown. The cleavage sequence of this embodiment can be screened and determined based on the antibody and the targeted tumor. The antibody sequence is screened and determined based on the highly expressed protein of the targeted tumor.

[0052] In this embodiment, the coding region corresponding to the coding frame is translated into a protein having the following characteristics: a secretory protein guide sequence (the sequence is derived from IL2, specifically comprising the nucleotide sequence shown in SEQ ID NO: 16 or its degenerate sequence), a humanized antibody sequence targeting tumor surface proteins, a cleavage sequence, and an exogenous antigen sequence (i.e., the above-mentioned viral or other source antigen peptide sequence, which has high immunogenicity).

[0053] SEQ ID NO: 16:

[0054] ATGTACCGGATGCAGCTGCTGTCATGCATCGCCCTGTCTCTGGCCCTGGTGACCAACAGC

[0055] The antigen peptide loading method disclosed in the present invention is based on the form of mRNA, which has a fast development speed and can be manufactured in a cell-free manner to achieve rapid, economical and efficient production; it will not be integrated into the genome, avoiding the worry of insertion mutation; the mRNA encoding the tumor antigen peptide complex can not only enter the tumor cell for expression and presentation, but also be secreted into the tumor microenvironment and targeted to other tumor cells (that is, the antigen peptide has tumor-targeted diffusion); the mRNA encoding the tumor antigen peptide complex can also be taken up by antigen presenting cells (APC) (such as macrophages, dendritic cells, etc.), processed and presented, and the APC further stimulates the activation and amplification of antigen peptide-specific CTL, thereby efficiently killing tumor cells.

[0056] In some embodiments, the antibody targets FOLR1 or CLAN18.2.

[0057] In specific implementation, since folate receptor 1 (FOLR1) is overexpressed in many solid tumors, including high-grade osteosarcoma, breast cancer, ovarian cancer, and non-small cell lung cancer, this embodiment uses FOLR1 as the antibody target, and the obtained mRNA encoding the antibody-antigen fusion protein and its corresponding mRNA-LNP complex, mRNA vaccine, etc. can be used for osteosarcoma, breast cancer, ovarian cancer, non-small cell lung cancer and other cancers at the same time, and has a certain versatility.

[0058] In some embodiments, the antibody sequence comprises the nucleotide sequence shown in SEQ ID NO: 1 or a degenerate sequence thereof; or is encoded by the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof.

[0059] In some embodiments, the cleavage sequence is a sequence recognized by a protease highly expressed in tumor tissue.

[0060] In some embodiments, the cleavage site corresponding to the cleavage sequence specifically comprises the amino acid sequence shown in any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.

[0061] In some embodiments, the antigen is selected from one or more of human cytomegalovirus, Epstein-Barr virus, novel coronavirus, and human antigen.

[0062] In some embodiments, the antigenic peptide sequence comprises one or more of the amino acid sequences shown in SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13.

[0063] In some embodiments, the mRNA encoding the antibody-antigen fusion protein comprises the following structure:

[0064] cap structure, 5'UTR, CDS, 3'UTR and Poly A.

[0065] In this embodiment, the specific structure of mRNA can be referred to Figure 1 The structure shown.

[0066] In some embodiments, the 3'UTR comprises the nucleotide sequence set forth in SEQ ID NO:14, and the 5'UTR comprises the nucleotide sequence set forth in SEQ ID NO:15.

[0067] In a second aspect, an embodiment of the present invention provides a method for preparing the mRNA encoding the antibody-antigen fusion protein described in the first aspect. The method uses a plasmid as an mRNA transcription template to prepare the mRNA encoding the antibody-antigen fusion protein.

[0068] In this example, the mRNA transcription template was constructed on the puc57 backbone vector, and a plasmid (supercoil ratio>85%) was prepared. The mRNA was prepared using a one-tube multi-step method, that is, linearization, transcription and capping reactions were performed in the same tube; and mRNA was obtained by magnetic bead purification.

[0069] In a third aspect, an embodiment of the present invention provides an mRNA-LNP complex, wherein the complex comprises the mRNA encoding the antibody-antigen fusion protein described in the first aspect.

[0070] In this embodiment, mRNA is encapsulated using a microfluidic device to obtain different types of LNP-mRNA, wherein the N / P ratio is any value among 6, 7, 8, 9, and 10. The total flow rate is 4-16 ml / min; and the flow rate ratio of lipid to RNA is 1:3.

[0071] In this embodiment, LNP-mRNA was purified based on the tangential flow system: the initial LNP-mRNA sample was diluted 10 times in volume and concentrated to the original volume, and then the liquid was replaced with 10 times in volume of freezing buffer. After the liquid replacement was completed, it was concentrated to 1 / 4 of the original volume; the inlet pressure was controlled to <0.5 bar, and the purification time did not exceed 2 hours.

[0072] LNP-mRNA detection items include: capping efficiency, poly A tail length and distribution, mRNA integrity, encapsulation rate, PDI, surface potential (zeta potential), etc.

[0073] In some embodiments, the LNP contains ionizable cationic lipids, cholesterol, neutral auxiliary phospholipids and PEG lipids; the molar ratio of ionizable cationic lipids, neutral auxiliary phospholipids, cholesterol and PEG lipids is 38-50:5-14:38-51:1-2.

[0074] In some embodiments, the molar ratio is optimized and screened. The molar ratio of ionizable cationic lipid, neutral auxiliary phospholipid, cholesterol and PEG lipid is 40.0:12.0:46.8:1.2 or 40.0:12.6:46.2:1.2 or 40.0:13.6:44.6:1.8 or 40.6:8.0:50.2:1.8 or 40.3:12.0:46.2:1.5 or 38.4:13.6:46.2:1.8 or 50.0:10.0:38.5:1.5.

[0075] In a fourth aspect, an embodiment of the present invention provides an mRNA vaccine. The mRNA vaccine comprises the mRNA encoding the antibody-antigen fusion protein described in the first aspect above.

[0076] The mRNA vaccine disclosed in the present invention can be used in combination with existing immunotherapy regimens (including anti-PD-1, anti-PD-L1, anti-CTLA-4 treatment and DC tumor vaccines) to enhance the anti-tumor effect.

[0077] In a fifth aspect, an embodiment of the present invention provides an application of the mRNA encoding the antibody-antigen fusion protein described in the first aspect, or the mRNA-LNP complex described in the third aspect, or the exogenous antigen mRNA vaccine described in the fourth aspect. The application includes: application in the preparation of tumor targeted therapeutic drugs, or application in the preparation of tumor targeted therapeutic drugs in combination with a second therapeutic agent.

[0078] In some embodiments, the second therapeutic agent is one or more of anti-PD-1, anti-PD-L1, anti-CTLA-4 and DC tumor vaccine.

[0079] In order to enable those skilled in the art to better understand the mRNA vaccine encoding the antibody-antigen fusion protein provided in the embodiments of the present invention, the following is a detailed description through specific embodiments. Among them, the reagents and instruments used, if not otherwise specified, are all existing commercial products and can be purchased directly.

[0080] The mRNA vaccine preparation scheme for introducing exogenous antigens into tumor cells disclosed in the embodiments of the present invention can be applied to a variety of tumor types (breast cancer, ovarian cancer, lung cancer, liver cancer, glioma, kidney cancer, bladder cancer, etc.). Here, taking ovarian cancer as an example, its screening and preparation scheme and in vivo and in vitro efficacy verification are explained.

[0081] The donor screening and PBMC collection involved in this embodiment were informed to healthy blood donors, and both parties signed an informed consent form.

[0082] Example 1. Preparation of mRNA encoding antibody-antigen fusion protein

[0083] Step 1. Protease cleavage site screening

[0084] Using the sequencing data of ovarian cancer samples in the TCGA database, we analyzed and screened the proteases that were highly expressed in ovarian cancer compared with normal tissues. The screened highly expressed proteases in ovarian cancer included: CTSD, CTSB, HPN, ST14, PLAUR, MMP7, MMP9, MMP11, MMP15 and MMP24.

[0085] Step 2. mRNA transcription template design and RNA preparation

[0086] like Figure 1 The mRNA transcription template is constructed as shown. Among them, the coding frame (CDS) is composed of an antibody sequence, different cleavage sequences and different antigen peptide sequences (here, the SARS-COV2 virus-derived antigen ATEGALNTPK is selected, which is restrictedly presented by HLA-A*0201).

[0087] The antibody in the embodiment targets folate receptor α (FRα / FOLR1), which is less expressed in normal tissues but overexpressed in tumor tissues, and is a potential anti-cancer target. Studies have shown that the overexpression rate of FRα in epithelial ovarian cancer is about 76-89%.

[0088] In this example, the anti-FOLR1 monoclonal antibody sequence (i.e., the nucleotide sequence shown in SEQ ID NO: 1 or its degenerate sequence) selected and optimized in the previous stage was selected, and fused with different cleavage sequences and viral antigen peptide ATEGALNTPK (i.e., the amino acid sequence shown in SEQ ID NO: 10) to obtain multiple different mRNA templates (specific information is shown in Table 1).

[0089] Table 1. Vector information of different cleavage sites

[0090]

[0091]

[0092] Step 3. Preparation of mRNA encoding antibody-antigen fusion protein

[0093] The different plasmids designed and prepared in step 2 were used as mRNA transcription templates, and the one-tube multi-step method was used to prepare mRNA, that is, linearization, transcription and capping reactions were carried out in the same tube. After the reaction was completed, the magnetic bead method was used to purify and obtain a variety of different mRNAs encoding antibody-antigen fusion proteins.

[0094] Plasmid linearization (1 unit reaction): reaction volume 5 μL, restriction endonuclease (BspQ1) concentration 1-10U / ug plasmid (5U / ug was used in this example), 50°C enzyme digestion time 0.5-3h (1h in this example).

[0095] In vitro transcription (1 unit reaction): the total reaction volume is 10 μL, the reaction system includes 5 μL of enzyme digestion mixture, the T7 transcriptase concentration ranges from 100-500 U / μL (250 U / μL in this example), the final MgCl2 concentration ranges from 5-40 mM (20 mM in this example), the final Tris-HCl concentration is 50 mM, the final NTP concentration ranges from 1-5 mM (2.5 mM in this example, wherein the modified nucleotide N1 methyl plus uracil m1ψ replaces uracil), the pyrophosphatase concentration is 0.02 U / μL, the RNase inhibitor concentration is 1 U / μL, and the reaction is carried out at 37°C for 0.5-2 h (1 h in this example).

[0096] Capping reaction: the total reaction volume is 100 μL, the reaction system includes 10 μL of transcription reaction product, the final concentration of MgCl2 is in the range of 1-8 mM (4 mM in this embodiment), the final concentration of Tris-HCl is 50 mM, the final concentration of SAM is 0.5 mM, the final concentration of GTP is in the range of 1-5 mM (newly added) (2 mM in this embodiment), the concentration of 2-oxomethyltransferase is in the range of 50-250 U / μL (200 U / μL in this embodiment), the concentration of vaccinia capping enzyme is in the range of 50-1000 U / μL (500 U / μL in this embodiment), and the reaction range at 37°C is 1-2 h (1 h in this embodiment).

[0097] During mRNA purification, about 0.5-1 μg (0.5 μg in this example) of magnetic beads were used for purification per μl of capping product.

[0098] Example 2. LNP-mRNA preparation and purification

[0099] The different mRNAs prepared in Example 1 were diluted with sodium citrate buffer at pH 4.0 to make the final concentration of mRNA 110 ng / μL (any value in the range of 50-150 ng / μL is suitable);

[0100] Prepare a lipid mixture, wherein the molar ratio of ionizable cationic lipid: neutral auxiliary phospholipid: cholesterol: PEG lipid is 40.0: 12.0: 46.8: 1.2, and the total lipid mixture concentration is 12 mM (any value in the range of 10-16 mM is suitable);

[0101] The N / P ratio was 6 during LNP preparation, and the total flow rate was 12 ml / min.

[0102] Different LNP-mRNAs prepared according to various mRNAs prepared in Example 1 were diluted 10 times with sodium citrate (37.5 mM) at pH 4.0 (5-10 times dilution is acceptable in actual operation), then purified and concentrated to the original volume by a tangential flow filtration system, and then replaced with a freezing solution (pH 7.4-7.8) containing 10 mM Tris and 10% sucrose by 10 times the volume, and finally concentrated to 1 / 4 of the original volume; the purified LNP-mRNAs were collected and aliquoted and frozen at -80°C (the different LNP-mRNAs obtained here were grouped and stored according to the numbers shown in Table 1);

[0103] The LNP-mRNA detection items include: detecting the capping efficiency (>95%) and tailing distribution (100-140A) by mass spectrometry, detecting the mRNA integrity (>90%) by capillary electrophoresis, detecting the encapsulation efficiency (>90%) and mRNA content by RiboGreen staining, and using a nanoparticle size analyzer to detect the particle size (80-150nm), PDI (<0.15) and surface potential (zeta potential, -2 to -10mV).

[0104] In this example, the optimized 3'UTR (SEQ ID NO: 14) nucleotide sequence is as follows:

[0105] AAAGCAAAACTAACATGAAACAAGGCTAGAAGTCAGGTCGGATTAAGCCATAGTACGGAAAAAACTATGCT

[0106] ACCTGTGAGCCCGTCCAAGGACGTTAAAAGAAGTCAGGCCATCATAAATGCCATAGCTTGAGTAAACTATG

[0107] CAGCCTGTAGCTCCACCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGG

[0108] CGTAGTGGACTAGCGGTTAGAGGAGACCCCTCCCTTACAAATCGCAGCAACAATGGGGGCCCAAGGCGAGA

[0109] TGAAGCTGTAGTCTCGCTGGAAGGACTAGAGGTTAGAGGAGACCCCCCGAAACAAAAAACAGCATATTGA

[0110] CGCTGGGAAAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAAT

[0111] GGTGCTGTTGAATCAACAGGTTCT

[0112] In this example, the optimized 5'UTR (SEQ ID NO: 15) nucleotide sequence is as follows:

[0113] ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC

[0114] Example 3. Optimization of tumor-specific LNP component ratios

[0115] This example optimizes the component ratio of the LNP preparation provided in the above example 2. The specific contents are as follows:

[0116] It is known that the selection of LNP lipid components and the relative proportions of each component can affect its in vivo transfection efficiency and tissue-specific delivery. During the optimization process of the mRNA vaccine preparation scheme disclosed in this embodiment, the proportion of LNP components will be screened and optimized according to different tumor types.

[0117] In this embodiment, a total of 63 different LNP component ratios were set (the specific numbers and ratio data are shown in Table 2, which lists the relevant data corresponding to the numbered groups with better mRNA delivery expression effects), and GFP mRNA was packaged (N / P=3, total flow rate=12ml / min, water phase flow rate: lipid phase flow rate=3:1), and LNP-mRNA was prepared by dialysis and liquid exchange. Ovarian cancer cell lines were transfected (4μg / 1E6 cells), and the expression of different LNP-mRNAs was detected by flow cytometry after 24 hours. Figure 2 The FACS (flow cytometry) analysis shows the expression positive rate of GFP mRNA delivered to OVCAR8 cells by LNPs with different composition ratios in Example 3 (Table 2). Figure 3 The FACS analysis shows the average fluorescence intensity of GFP mRNA delivered to OVCAR8 cells by LNPs with different composition ratios in Example 3 (Table 2).

[0118] according to Figure 2 and Figure 3 The results of the comprehensive comparison of transfection positive rate (GFP + The results of the analysis of the expression intensity (percentage) and green fluorescence mean fluorescence intensity (MFI, mean fluorescence intensity of green fluorescence) showed that the lipid composition ratios of LNP#19, LNP#20, LNP#25, LNP#29, LNP#33, LNP#34, LNP#35 and CC#2 showed better mRNA expression. The lipid composition ratios of LNP#19 or LNP#25 were selected in subsequent studies.

[0119] Table 2. Ratios of different LNP components set in this Example 3

[0120]

[0121]

[0122] * Among them, the LNP#SM102 group is the LNP product ratio data disclosed by Modena, and is used as the control group in this example.

[0123] Example 4. Cleavage site screening and peptide-MHC complex verification

[0124] Based on the above LNP lipid ratio screening results, the lipid composition ratio of LNP#19 was selected to encapsulate the mRNA encoding various antibody-antigen fusion proteins prepared in Example 1. Subsequently, the ethanol in the LNP-mRNA prepared by microfluidics was removed by dialysis and replaced by dialysis into a freezing solution containing 20mM Tris and 10% sucrose to obtain LNP-mRNA with different cleavage sites. The preparation and detection results of LNP-mRNA with different cleavage sites are shown in Table 3 below.

[0125] Table 3. LNP-mRNA preparation and detection results at different cleavage sites

[0126]

[0127]

[0128] After transfecting OVCAR8-FORL1 ovarian cancer cells (4 μg / 1E6) with different LNP-mRNAs prepared in the above examples for 24 hours, the cells were stained with an anti-human FC antibody, and the expression of LNP-mRNA was detected by flow cytometry. Figure 4 The results of FACS analysis of the expression of mRNA encoding different antibody-antigen fusion proteins in this example are shown. Figure 4 The expression results of different groups corresponding to FSC#0-FSC#12 in this example are shown by FACS analysis. Figure 5 The expression results of different groups corresponding to FSC#13-FSC#25 in this example are shown by FACS analysis. Figure 4 The control group contained no antibody-antigen fusion protein mRNA. Figure 4 The test results show that the positive rates of OVCAR8-FORL1 anti-FC antibody staining after all LNP-mRNA transfections are comparable, all >95%. This proves that the mRNA constructed in the embodiment of the present invention can be correctly expressed and secreted, and binds to the FOLR1 protein on the cell surface.

[0129] The antibody against the polypeptide MHC complex (i.e., ATEGALNTPK polypeptide-HLA-A*1101 complex) (TCR mimic antibody) was used to detect the proportion of the antigen peptide (ATEGALNTPK) formed after enzyme cleavage of different fusion proteins that was bound and presented by HLA-A*1101. Figure 6 The FACS analysis shows the ratio of antigen peptides (ATEGALNTPK) generated by enzyme cleavage of fusion proteins containing different cleavage sites in Example 4 that are bound and presented by HLA-A*1101. Figure 6 The results of the ratio show that fusion protein FSC#23 has the best cutting efficiency, and the proportion of tumor cells labeled with exogenous peptides is close to 60%, that is, LNP-mRNA (FSC#23) has the highest efficiency in introducing exogenous antigens into tumor cells. In addition, fusion proteins FSC#1, FSC#2, FSC#5, FSC#7, FSC#10, FSC#12, FSC#13, FSC#17, FSC#19, FSC#20, FSC#21, and FSC#22 also have relatively good cutting efficiencies, and the corresponding LNP-mRNAs can also be used to introduce exogenous antigens into tumor cells.

[0130] Example 5. In vivo and in vitro efficacy verification

[0131] Based on the research results of Examples 1-4 above, the lipid composition ratio of LNP#19 was used to encapsulate the mRNA encoding the antibody-antigen fusion protein corresponding to FSC#23 (N / P=3, total flow rate=12 ml / min, water phase flow rate: lipid phase flow rate=3:1), and then concentrated and replaced by a tangential flow purification system. The prepared LNP-mRNA (FSC#23) had an encapsulation efficiency of 94.7%, a particle size of 119 nm, a PDI of 0.078, and a zeta potential of -3.298 mV.

[0132] At the same time, the control group LNP-mRNA (F) was prepared by the same method, with a lipid composition ratio of LNP#19, which encapsulated mRNA expressing only anti-FOLR1 antibodies without introducing exogenous SARS-CoV2 antigen ATEGALNTPK.

[0133] In vitro validation:

[0134] One day after LNP-mRNA (FSC#23) was transfected into OVCAR8-A*11:01-FOLR1 cells, different ratios of LNP-mRNA (FSC#23) and ATEGALNTPK (HLA-A*1101)-specific CD8 + T cells were co-cultured for 2 days and then specific CD8 + The killing percentage of T. The same operation was performed on the control group LNP-mRNA (F), and then counted.

[0135] Figure 7 In this embodiment, CD8 +The percentage of T cells killing mRNA encoding antibody (LNP-mRNA (F)) and mRNA encoding antibody-antigen fusion protein (LNP-mRNA (FSC#23)). Figure 7 The results showed that the killing rate of the group transfected with LNP-mRNA (FSC#23) was significantly higher than that of the control group LNP-mRNA (F).

[0136] In vivo validation:

[0137] The in vivo effect of LNP-mRNA (FSC#23) was verified by humanized mouse tumor model. Figure 8 This is a flow chart of the in vivo efficacy verification of Example 5.

[0138] After NCG mice were adapted to the feeding environment for 7 days, OVCAR8-A*11:01-FOLR1 cells were subcutaneously inoculated, and 5E5 (i.e., 5×10 5 ) cells / mouse; 6 days later, 7E6 (i.e., 7×10 6 ) Personal source CD8 + T cells were humanized, and 10 μg LNP-mRNA (volume about 50 μL) was injected into the tumor inoculation site 2 days later for the first treatment, followed by treatment on days 3, 7, 14, and 21. The tumor volume was counted 3 weeks after the treatment endpoint. The size of the tumor inhibition effect was determined based on the change in tumor volume.

[0139] Fig. 9 The graph shows the tumor growth in tumor-bearing mice injected with mRNA encoding antibody (LNP-mRNA(F)) and mRNA encoding antibody-antigen fusion protein (LNP-mRNA(FSC#23)) in Example 5. Fig. 9 The results show that the LNP control group LNP-mRNA (F) had a partial tumor inhibition effect, and LNP-mRNA (FSC#23) had a significant tumor inhibition effect compared to LNP-mRNA (F).

[0140] Example 6

[0141] The amino acid sequence of the antigen peptide in the antibody-antigen fusion protein constructed in this example is shown in SEQ ID NO: 12 (QYDPVAALF, human cytomegalovirus antigen peptide). The prepared mRNA expresses the antibody-antigen fusion protein, whose cleavage sequence is SEQ ID NO: 2 (LRELHLDN), and the antigen sequence is QYDPVAALF (human cytomegalovirus antigen peptide restricted for presentation by HLA-A*24:02), and the other operations are the same as those in Examples 1-4.

[0142] The lipid composition ratio of LNP#5 was used to encapsulate the fusion protein (FCC#5) encoding the anti-FOLR1 antibody and the CMV-derived antigen by microfluidics, and the intermediate cleavage sequence was SEQ ID NO: 2. The LNP-mRNA preparation conditions were: N / P=3, total flow rate=12ml / min, water phase flow rate: lipid phase flow rate=3:1, and then concentrated and replaced by a tangential flow purification system. The prepared LNP-mRNA (FCC#5) had an encapsulation rate of 95.8%, a particle size of 109nm, a PDI of 0.093, and a zeta potential of -4.125mV.

[0143] Example 7

[0144] The amino acid sequence of the viral antigen peptide used in this example is shown in SEQ ID NO: 13 (AVFDRKSDAK, Epstein-Barr virus antigen peptide). The prepared mRNA expresses an antibody-antigen fusion protein, whose cleavage sequence is SEQ ID NO: 5 (RPLALWRS), and the antigen sequence is AVFDRKSDAK (Epstein-Barr virus antigen peptide restricted for presentation by HLA-A*11:01), and the other operations are the same as those in Examples 1-4.

[0145] The lipid composition ratio of LNP#19 was used to encapsulate the fusion protein (FEC#13) encoding the anti-FOLR1 antibody and the Epstein-Barr virus antigen peptide by microfluidics, and the intermediate cleavage sequence was SEQ ID NO: 5. The LNP-mRNA preparation conditions were: N / P=3, total flow rate=12 ml / min, water phase flow rate: lipid phase flow rate=3:1, and then concentrated and replaced by a tangential flow purification system. The prepared LNP-mRNA (FEC#13) had an encapsulation rate of 92.9%, a particle size of 120 nm, a PDI of 0.053, and a zeta potential of -3.633 mV.

[0146] Example 8

[0147] The amino acid sequence of the human antigen peptide used in this example is shown in SEQ ID NO: 11 (ELAGIGILTV, MART1 protein-derived antigen peptide). The prepared mRNA expresses an antibody-antigen fusion protein, whose cleavage sequence is SEQ ID NO: 6 (PLGMTS), and the antigen sequence is ELAGIGILTV (MART1 protein-derived antigen peptide restrictedly presented by HLA-A*02:01), and the other operations are the same as those in Examples 1-4.

[0148] The lipid composition ratio of CC#2 was used to encapsulate the fusion protein (FMC#17) encoding the anti-FOLR1 antibody and the MART1 antigen peptide by microfluidics, and the intermediate cleavage sequence was SEQ ID NO: 6. The LNP-mRNA preparation conditions were: N / P=3, total flow rate=12ml / min, water phase flow rate: lipid phase flow rate=3:1, and then concentrated and replaced by a tangential flow purification system. The prepared LNP-mRNA (FMC#17) had an encapsulation efficiency of 95.5%, a particle size of 113nm, a PDI of 0.074, and a zeta potential of -5.201mV.

[0149] Example 9 In vivo efficacy verification

[0150] The same verification method as in Example 5 was used to verify the in vivo pharmacodynamic effects of LNP-mRNA (FCC#5), LNP-mRNA (FEC#13) and LNP-mRNA (FMC#17) prepared in Examples 6-8.

[0151] Figure 10-12 The figures show the inhibitory effects of the experimental groups LNP-mRNA (FCC#5), LNP-mRNA (FEC#13) and LNP-mRNA (FMC#17) and the control group LNP-mRNA (F) on tumors after peritumoral injection in Examples 6-8. Fig.10 The figure shows the inhibitory effect of LNP-mRNA (FCC#5) on tumors after paratumoral injection in the experimental group. Fig.11 The figure shows the inhibitory effect of LNP-mRNA (FEC#13) on tumors after paratumoral injection in the experimental group. Fig.12 The results show that the experimental group LNP-mRNA (FMC#17) has a partial tumor inhibition effect after paratumor injection. Figure 10-12 The results show that LNP-mRNA (FCC#5), LNP-mRNA (FEC#13) and LNP-mRNA (FMC#17) have significant tumor inhibition effects compared to the control group LNP-mRNA (F). That is, by adopting the technical concept provided by the present invention, the exogenous antigen peptide is introduced into the tumor tissue through the antibody targeting the tumor surface protein, the tumor tissue can be marked, and the antigen-specific TCR-T cells can effectively recognize and kill the tumor cells presenting the antigen peptide.

[0152] Example 10 In vivo efficacy verification of combined DC tumor vaccine

[0153] The in vivo pharmacodynamic effect of the LNP-mRNA (FSC#23) combined with DC tumor vaccine prepared in Example 5 was verified.

[0154] PBMCs were isolated from healthy subjects, and then purified to obtain monocytes and stimulated to obtain mature DCs (dendritic cells) after in vitro differentiation. 4 hours after transfection of LNP-mRNA (FSC#23) into DCs, DCs were packaged and frozen for later use. A tumor-bearing model was constructed according to a similar scheme as in Examples 5-9 above, and CD8 + T cell humanization, humanized mice were randomly divided into LNP treatment group, DCs treatment group, LNP-mRNA (FSC#23) treatment group and LNP-mRNA (FSC#23) and DCs combined treatment group. LNP-mRNA or / and cryopreserved DCs (5E6 / mouse) were injected into the tail vein on days 3, 7, 14 and 21 respectively.

[0155] Fig.13 The inhibitory effects of the LNP treatment group, DCs treatment group, LNP-mRNA (FSC#23) treatment group, and LNP-mRNA (FSC#23) and DCs combined treatment group on tumors after injection in Example 10 are shown. Fig.13 The tumor growth monitoring results showed that the combined treatment had a better tumor growth inhibition effect than the single LNP, DCs or LNP-mRNA (FSC#23) treatment. That is, the mRNA vaccine encoding the antibody-antigen fusion protein provided by the present invention can be used alone for tumor treatment or in combination with other treatment methods, and can achieve better therapeutic effects.

[0156] Example 11 In vitro functional verification of CLDN18.2 targeting antibody-antigen fusion protein mRNA

[0157] CLDN18.2 is a tight junction molecule highly expressed on the surface of gastric cancer cells and is a widely studied target for gastric cancer treatment. Using the aforementioned construction scheme, we constructed mRNA encoding an anti-CLDN18.2 antibody (the amino acid sequence of the CLDN18.2 antibody is shown in the sequence SEQ ID NO: 18) and a fusion protein of the SARS-CoV2 antigen ATEGALNTPK, and the antibody and antigen are connected by the cleavage sequence SEQ ID NO: 17 (PRHLRN). Using the lipid composition ratio of LNP#19, LNP-mRNA encoding the antibody-antigen fusion protein (CSC#19) and LNP-mRNA encoding the antibody (C) were prepared. During the LNP-mRNA preparation process, N / P=3, total flow rate=12ml / min, aqueous phase flow rate: lipid phase flow rate=3:1, and then the solution was concentrated and replaced by a tangential flow purification system. The encapsulation efficiency of the prepared LNP-mRNA (CSC#19) was 98.2%, the particle size was 102nm, the PDI was 0.049, and the zeta potential was -6.218mV; the encapsulation efficiency of LNP-mRNA (C) was 97.0%, the particle size was 99nm, the PDI was 0.072, and the zeta potential was -5.702mV.

[0158] LNP-mRNA (CSC#19) and LNP-mRNA (C) were transfected into HGC-27-A*11:01-CLDN18.2 (HGC-27 cells transformed to express CLDN18.2 and HLA-A*11:01) gastric cancer cells, respectively. After 1 day of expression, they were co-expressed with ATEGALNTPK (HLA-A*1101)-specific CD8 + T cells were co-cultured for 2 days and then specific CD8 + T's kill percentage.

[0159] Fig.14 The killing percentages of the experimental group LNP-mRNA (CSC#19) and the control group LNP-mRNA (C) in this embodiment 11 are shown. Fig.14 The results showed that the relative killing rate of the group transfected with LNP-mRNA (CSC#19) was significantly higher than that of the control group LNP-mRNA (C).

[0160] It can be seen from the above Examples 4-11 that the antibody-antigen fusion protein encoded by the mRNA provided by the present invention specifically recognizes highly expressed proteins on the surface of tumor cells through antibodies, and introduces highly immunogenic antigens into the identified tumor target cells to mark the tumor cells.

[0161] The present invention uses mRNA, which can be taken up, processed and presented by antigen presenting cells, thereby stimulating and activating antigen-specific TCR-T cells in the body. Thus, widely labeled tumor cells can be specifically recognized and killed by antigen-specific TCR-T cells in the body. In addition, the mRNA encoding the antibody-antigen fusion protein provided by the present invention can be directly injected adjacent to the tumor or injected into the tumor using LNP, and the tumor inhibition effect is good.

[0162] For the method embodiments, for the sake of simplicity, they are all described as a series of action combinations, but those skilled in the art should know that the present invention is not limited by the order of the actions described, because according to the present invention, some steps can be performed in other orders or simultaneously. Secondly, those skilled in the art should also know that the embodiments described in the specification are all preferred embodiments, and the actions and components involved are not necessarily required by the present invention.

[0163] The above is a detailed introduction to an mRNA or mRNA-LNP complex encoding an antibody-antigen fusion protein and its application provided by the present invention. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for a person skilled in the art, according to the idea of ​​the present invention, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. An mRNA encoding an antibody-antigen fusion protein, characterized in that: The coding frame sequence of the mRNA includes: an antibody sequence, a cleavage sequence and an antigen peptide sequence; wherein the antibody targets a tumor surface protein that is highly expressed, and the antigen is a highly immunogenic antigen.

2. The mRNA encoding the antibody-antigen fusion protein according to claim 1, characterized in that The antibodies target FOLR1 or CLAN18.

2.

3. The mRNA encoding the antibody-antigen fusion protein according to any one of claims 1-2, characterized in that: The cleavage sequence is a sequence recognized by a protease highly expressed in tumor tissue.

4. The mRNA encoding the antibody-antigen fusion protein according to claim 3, characterized in that: The cleavage site corresponding to the cleavage sequence specifically comprises the amino acid sequence shown in any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO:

9.

5. The mRNA encoding the antibody-antigen fusion protein according to any one of claims 1 to 4, characterized in that: The antigen is selected from one or more of human cytomegalovirus, Epstein-Barr virus, novel coronavirus and human antigen.

6. The mRNA encoding the antibody-antigen fusion protein according to any one of claims 1 to 5, characterized in that: The antigen peptide sequence comprises one or more of the amino acid sequences shown in SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO:

13.

7. The mRNA encoding the antibody-antigen fusion protein according to any one of claims 1 to 6, characterized in that: The mRNA encoding the antibody-antigen fusion protein comprises the following structure: CDS, 3'UTR and 5'UTR; preferably, it also includes a cap structure and a PolyA structure.

8. The mRNA encoding the antibody-antigen fusion protein according to claim 7, characterized in that: The 3'UTRs comprises the nucleotide sequence shown in SEQ ID NO:

14.

9. The mRNA encoding the antibody-antigen fusion protein according to any one of claims 7-8, characterized in that: The 5'UTRs comprises the nucleotide sequence shown in SEQ ID NO:

15.

10. A method for preparing mRNA encoding an antibody-antigen fusion protein according to any one of the above claims, characterized in that: The mRNA encoding the antibody-antigen fusion protein is prepared according to the mRNA template.

11. An mRNA-LNP complex, characterized in that The complex comprises the mRNA encoding the antibody-antigen fusion protein according to any one of claims 1 to 9.

12. The mRNA-LNP complex according to claim 11, characterized in that The LNP contains ionizable cationic lipid, cholesterol, neutral auxiliary phospholipid and PEG lipid; the molar ratio of the ionizable cationic lipid, neutral auxiliary phospholipid, cholesterol and PEG lipid is 38-50:5-14:38-51:1-2.

13. The mRNA-LNP complex according to claim 12, characterized in that The molar ratio of the ionizable cationic lipid, neutral auxiliary phospholipid, cholesterol and PEG lipid is 40.0:12.0:46.8:1.2 or 40.0:12.6:46.2:1.2 or 40.0:13.6:44.6:1.8 or 40.6:8.0:50.2:1.8 or 40.3:12.0:46.2:1.5 or 38.4:13.6:46.2:1.8 or 50.0:10.0:38.5:1.

5.

14. An mRNA vaccine, characterized in that: The mRNA vaccine comprises the mRNA encoding the antibody-antigen fusion protein as described in any one of claims 1 to 9.

15. A use of the mRNA encoding the antibody-antigen fusion protein according to any one of claims 1 to 9, the mRNA-LNP complex according to claim 11, or the exogenous antigen mRNA vaccine according to claim 14, characterized in that: The application includes: application in the preparation of tumor targeted therapeutic drugs, or application in the preparation of tumor targeted therapeutic drugs in combination with a second therapeutic agent.

16. The use according to claim 15, characterized in that The second therapeutic agent is one or more of anti-PD-1, anti-PD-L1, anti-CTLA-4 and DC tumor vaccine.

Images