Application of CD40 antibody and LPS co-stimulated gene modified B cell in cancer treatment

Abstract

The invention discloses application of a CD40 antibody and LPS co-stimulated gene modified B cell in cancer treatment, belongs to the technical field of biology, and firstly finds that the LPS and anti-CD40 antibody co-stimulated B cell can be used as a cell carrier for gene therapy to continuously express dFv-LDP protein in vivo to treat cancer. The invention finds that the B lymphocyte can continuously express dFv-LDP protein for a long time, solves the problem that the blood concentration of the scFv protein is reduced too quickly so as to achieve a treatment effect better than that of direct injection of the dFv-LDP protein, and meanwhile, can reduce the economic burden caused by injection of the scFv protein for multiple times for a patient.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to an application of CD40 antibody and LPS co-stimulated gene-modified B cells in treating cancer. Background Art

[0002] Gene therapy refers to a therapeutic technique that inserts functional genes into the patient's somatic cells to correct congenital genetic errors or provide new functions for cells. The current goals of clinical gene therapy are: correcting disabled cells (HSC), increasing secretory proteins (AAV-liver), and eliminating cancer cells (CAR-T cells). Gene transfer strategies: in vivo (viral vectors, non-viral vectors (lower efficiency)), in vitro (stem / progenitor cells).

[0003] B cells, also known as B lymphocytes, are an important part of the immune system and are primarily responsible for humoral immune responses. B cells have the potential to be used as therapeutic gene carriers, but most processed B cells can only survive for one to two months. Therefore, in order to perform gene therapy for a long time, longer-lasting B cells are needed. Summary of the invention

[0004] In the existing technology, only LPS is used to activate B lymphocytes, and they need to be cultured in vitro for 16 days before they can be infused for treatment. The existing technology requires screening out successfully edited B cells for infusion before infusion, which increases the treatment cost for patients. At present, one of the biggest difficulties in tumor treatment is the escape of tumor antigens. The existing technology is not suitable for tumor treatment because it needs to sense antigen stimulation to secrete antibodies.

[0005] Therefore, in order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.

[0006] The present invention provides the use of CD40 antibody and LPS co-stimulated gene-modified B cells in preparing a pharmaceutical composition for treating cancer.

[0007] Furthermore, the protein expressed by the gene can treat cancer.

[0008] Furthermore, the genetically modified B cells are B cells expressing dFv-LDP protein.

[0009] Furthermore, the B cells include naive B cells, conventional B cells, follicular B cells, marginal zone B cells, B1 cells, memory B cells, and plasma cells.

[0010] Furthermore, the B cells are naive B cells.

[0011] Furthermore, the pharmaceutical composition includes a pharmaceutically acceptable adjuvant.

[0012] Furthermore, the auxiliary agent includes a diluent, a dispersing aid, a suspending aid, a surfactant, an isotonic agent, a thickening or emulsifying agent, a preservative, a solid binder, and a lubricant.

[0013] In some embodiments, the dFv-LDP protein (dual scFv fragment coupled to lidamycin protein) refers to a fusion protein prepared by genetic engineering methods, which is composed of a single-chain antibody scFv of the anti-type IV collagenase antibody 3G11 and the lidamycin cofactor protein LDP. The dFv-LDP protein has a growth inhibitory effect on a variety of tumor cells. The dFv-LDP protein shows good tumor targeting ability in in vivo experiments, especially in nude mouse heterotopic transplanted tumors of human liver cancer Be1-7402, highly metastatic lung cancer PG-BE1 and colon cancer HCT-116.

[0014] Furthermore, the pharmaceutical composition is administered orally, via suppository, around the lesion, on the lesion surface, topically, intravenously, parenterally, intraperitoneally, intramuscularly, intralesionally, intrathecally, intranasally or subcutaneously.

[0015] The term "pharmaceutically acceptable" herein designates that the excipients are generally chemically and / or physically compatible with the other ingredients making up the formulation and physiologically compatible with the recipient thereof.

[0016] Pharmaceutically acceptable adjuvants used in the compositions of the present invention may include, but are not limited to, for example, pharmaceutically acceptable liquids, gels or solid carriers, aqueous vehicles (e.g., sodium chloride injection, Ringer's injection, isotonic dextrose injection, sterile water injection or Ringer's dextrose and lactate injection), non-aqueous vehicles (e.g., fixed oils of plant origin, cottonseed oil, corn oil, sesame oil or peanut oil), antimicrobial agents, isotonic agents (e.g., sodium chloride or dextrose), buffers (e.g., phosphate or citrate buffer), antioxidants (e.g., sodium bisulfate), anesthetics (e.g., procaine hydrochloride), suspending / dispersing agents (e.g., sodium carboxymethylcellulose, hydroxypropyl methylcellulose or polyvinylpyrrolidone), chelating agents (e.g., EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid)), emulsifiers (e.g., polysorbate 80 (Tween-80)), diluents, adjuvants, excipients, or non-toxic auxiliary substances, other components known in the art, or various combinations thereof. Suitable components may include, for example, fillers, binders, disintegrants, buffers, preservatives, lubricants, flavoring agents, thickeners, colorants or emulsifiers.

[0017] The term "B cell" in the present invention refers to bone marrow-dependent lymphocytes, which originate from the bone marrow and account for 50-10% of the total number of blood lymphocytes. Initial B cells that mature in the bone marrow leave the bone marrow and migrate to the surrounding lymphoid organs and lymphoid tissues. After being stimulated by antigens, they proliferate and differentiate into effector B cells, i.e. plasma cells, which synthesize and secrete antibodies and exert immune functions; a small amount of them are converted into memory B cells and stored, and their role is the same as that of memory T cells. B cells survive in the body for a short time, only a few days to a few weeks, but their memory cells can survive in the body for a long time.

[0018] The term "modification" of the present invention refers to any form of modification of an amino acid sequence or a nucleotide sequence, such as substitution, deletion, insertion and / or addition of amino acids or nucleotides.

[0019] The present invention provides a pharmaceutical composition, which comprises the CD40 antibody used in the above application and LPS co-stimulated gene-modified B cells.

[0020] Furthermore, the genetically modified B cells are B cells expressing dFv-LDP protein.

[0021] As used herein, "gene" may be a natural (e.g., genomic) gene including transcriptional and / or translational regulatory sequences, and / or coding regions, and / or non-translated sequences (e.g., introns, 5'- and 3'-untranslated sequences). The coding region of a gene may be a nucleotide sequence encoding an amino acid sequence or a functional RNA (e.g., tRNA, rRNA, catalytic RNA, siRNA, miRNA, or antisense RNA). The term "gene" has the meaning understood in the art. However, those of ordinary skill in the art will appreciate that the term "gene" has many meanings in the art, some of which include gene regulatory sequences (e.g., promoters, enhancers, etc.) and / or intron sequences, while others are limited to coding sequences. It should also be understood that the definition of "gene" includes nucleic acids that do not encode proteins but encode functional RNA molecules (e.g., tRNA). For clarity, the term "gene" used in this application generally refers to a portion of a nucleic acid that encodes a protein; the term also optionally includes a regulatory sequence. This definition is not intended to exclude that the term "gene" can be used for non-protein encoding expression units, but is intended to clarify that, in most cases, the term used herein refers to nucleic acids that encode proteins.

[0022] In this specification, the term "long-acting" should be considered to mean effective after the initial dose and maintain its effect over a longer period of time. In some embodiments, the long-acting nature of the pharmaceutical composition provides an acceptable and sustained effect for more than 120 days after the initial dose.

[0023] As used herein, the term "CD40 antibody" or "anti-CD40 antibody" means an antibody that specifically binds to CD40. "Human CD40 antibody" or "human anti-CD40 antibody" means that the antibody that specifically binds to CD40 consists of a human immunoglobulin amino acid sequence. A human CD40 antibody that binds to human CD40 is an antibody that comprises a human immunoglobulin amino acid sequence that specifically binds to human CD40, although the antibody may also bind to a non-human sequence having an epitope recognized by the human CD40 antibody.

[0024] The CD40 antibodies of the invention include polyclonal or monoclonal antibodies, as well as fragments and modified forms as described herein. Pooled polyclonal and monoclonal antibodies containing two or more different CD40 antibodies with different binding specificities, binding affinities or functions are also provided.

[0025] The CD40 antibodies of the present invention contain κ or λ chain sequences. Each antibody molecule contains two κ or two λ light chains. The main difference between κ and λ light chains is the sequence of the constant region. In humans, the κ chain variable region sequence has more diversity than the λ chain variable region sequence, which leads to the production of more different (diversified) antibodies. The exemplary CD40 antibody produced by hybridoma F4-465 contains a human λ light chain.

[0026] Exemplary antibodies are designated as nos. 11 (ATCC PTA-2308), 30, 72 (ATCC PTA-2309), and 366, or are produced by hybridomas designated as F1-102, F2-103, F5-77, F5-152, F5-157, and F4-465. While not wishing to be bound by theory, exemplary CD 40 antibodies that inhibit CD 40 activity, such as antibodies produced by nos. 30, 72, 366, and hybridoma F4-465, appear to reduce CD40L binding to CD 40 and do not induce CD 40 signaling. In contrast, CD40 antibodies that stimulate CD 40 activity, such as antibodies produced by nos. 11 and hybridomas F1-102, F2-103, F5-77, F5-152, and F5-157, appear to induce CD 40 signaling and enhance CD40L activity.

[0027] Unless otherwise specified, the term "LPS" refers to bacterial lipopolysaccharide, whose full English name is lipopolysaccharide.

[0028] In some embodiments, the pharmaceutical composition further comprises other active ingredients that can be added, including but not limited to weight loss agents (appetite suppressants, slimming agents), antacids (anti-acidosis agents), anti-hypoxic agents, analgesics (anti-rheumatic drugs), anti-worm drugs, anti-allergic drugs, anti-anemic drugs, anti-arrhythmic agents, antibiotics (anti-infective drugs), anti-dementia drugs (nootropic drugs), anti-diabetic drugs, antidote, antiemetic drugs (anti-vertigo agents), anti-epileptic drugs, anti-hemorrhagic drugs (anti-fibrinolytic drugs and other hemostatic agents), anti-hypertensive drugs, anti-hypoglycemic agents, anti-hypotensive agents, anticoagulants, antifungal drugs, anti-parasitic agents, anti-inflammatory drugs, antitussive drugs (expectorants), anti-atherosclerotic agents, bath therapy , anti-inflammatory and thermotherapeutic agents, beta-blockers, calcium channel blockers and inhibitors of the renin-angiotensin-aldosterone system, bronchial drugs (antiasthmatics), choleretics and biliary therapeutic agents, cholinergic drugs, adrenocortical hormones, skin drugs, disinfectants (antibacterial drugs), dietary agents (nutritional agents), diagnostic agents and preparations for diagnosis, diuretics, drugs that promote blood circulation, detoxification agents (drugs for the treatment of addiction), enzyme inhibitors, preparations for enzyme deficiencies, transporters, fibrinolytics, geriatric drugs, antigout preparations, cold and flu drugs and cough and sneezing medicines, gynecological drugs, hemorrhoid drugs (rectal drugs), liver drugs, hypnotics (sedatives), pituitary hormones, hypothalamic hormones and other regulatory peptides and their inhibitors, immunomodulators.

[0029] The present invention provides a method for constructing a gene-modified B cell that expresses a target protein for a long time, the method comprising using LPS and an anti-CD40 antibody to co-stimulate the B cell for 1-3 days before electroporating the target gene; the target protein is a protein that can treat cancer.

[0030] Furthermore, the B cells are in vitro cells.

[0031] Furthermore, the target protein is dFv-LDP protein.

[0032] Furthermore, the B cells are from humans or non-human mammals.

[0033] Furthermore, the B cells are from humans, gorillas, monkeys, horses, cattle, sheep, pigs, donkeys, camels, dogs, rabbits, cats, rats, and mice.

[0034] In an embodiment of the present invention, the B cells are from any animal (eg, mammal) that can produce B cells, including, but not limited to, humans, non-human primates, dogs, cats, rodents, etc. Further, the B cells are from humans.

[0035] Further, the construction method comprises the following steps:

[0036] 1×10 7LPS and anti-CD40 antibodies are added to B cells with a concentration of 1 cell / ml, and the cells are stimulated in vitro for 1-3 days. The gene vector capable of expressing the target protein is then transformed into the stimulated B cells by electroporation. The cells are then cultured in complete B cell culture medium supplemented with LPS and anti-CD40 antibodies, and caspase inhibitors are added.

[0037] Furthermore, the Caspase inhibitor is Boc-D-FMK.

[0038] Furthermore, the construction method used Cas9 protein (Invitrogen) and purified gRNA for pre-incubation at room temperature for 30 minutes during electroporation. B cells were cultured at 1×10 7 Resuspend in Buffer T at a final density of 10 cells / ml. 6 Each cell contained 5 μg of pre-complexed Cas9 and gRNA, and 10 μg of DNA template. Electroporation was performed at 1600 V, 20 ms, and 2 pulses.

[0039] The term "electroporation" used in this article, also known as electroporation or electrotransfection, refers to the process of transiently increasing the permeability of cell membranes through the action of high-intensity electric fields, thereby absorbing foreign molecules in the surrounding medium. This technology can introduce nucleotides, DNA and RNA, proteins, sugars, dyes, and virus particles into prokaryotic and eukaryotic cells.

[0040] The term "CRISPR / Cas9" used in this article refers to an adaptive immune defense formed by bacteria and archaea during the long-term evolution process, which can be used to fight invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technology for specific DNA modification of targeted genes. CRISPR / Cas9-based gene editing technology has shown great application prospects in a series of gene therapy application fields, such as blood diseases, tumors and other genetic diseases. This technological achievement has been applied to the precise modification of the genomes of human cells, zebrafish, mice and bacteria.

[0041] The term "sgRNA" used in this article generally refers to a single-molecule guide RNA or a single-stranded guide RNA in an artificial CRISPR / Cas9 system, which refers to an RNA that guides the Cas9 protein to specifically bind to a target nucleic acid sequence, and is an important component of the CRISPR gene knockout / knock-in system. The sgRNA of the present application comprises a guide sequence that targets a target sequence. In a preferred embodiment, the sgRNA of the present application further comprises a tracrRNA sequence and a crRNA sequence.

[0042] The present invention provides a cell, wherein the cell is constructed by the aforementioned construction method, the cell can express a target gene for a long time, and the cell is used to treat cancer.

[0043] The present invention provides the use of CD40 antibody and LPS in preparing a product of gene-modified B cells that express a target protein for a long time; the target protein is a protein that can treat cancer.

[0044] Furthermore, the target protein is dFv-LDP protein.

[0045] In this article, the cancer types include but are not limited to acute lymphoblastic leukemia (ALL), acute myeloid leukemia, adrenocortical carcinoma, adult acute myeloid leukemia, adult cancer of unknown primary site, adult malignant mesothelioma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, childhood cerebellum or cerebral cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone tumor, osteosarcoma / malignant fibrous histiocytoma, brain cancer, brain stem glioma, breast cancer, bronchial adenoma / carcinoid, Burkitt's lymphoma, carcinoid tumor, cancer of unknown primary site, central nervous system lymphoma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, childhood acute myeloid leukemia, childhood cancer of unknown primary site, Childhood cancer, childhood cerebral astrocytoma, childhood mesothelioma, chondrosarcoma, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorder, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, endometrial uterine cancer, ependymoma, epithelioid hemangioendothelioma (EHE), esophageal cancer, Ewing's sarcoma family of tumors, Ewing's sarcoma in the Ewing's tumor family, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, gallbladder cancer, gastric (stomach) cancer, gastric carcinoid, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), gestational trophoblastic tumor, brainstem glioma, glioma, Hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway gliomas, islet cell cancer (endocrine pancreas), Kaposi's sarcoma, kidney cancer (renal cell carcinoma), laryngeal cancer, acute lymphoblastic leukemia (also known as acute lymphoblastic leukemia), acute myeloid leukemia (also known as acute myeloid leukemia), chronic lymphocytic leukemia (also known as chronic lymphocytic leukemia), leukemia (leukaemia), chronic myeloid leukemia (also known as chronic myeloid leukemia), hairy cell leukemia (leukemia), lip and oral cancer, liposarcoma, liver cancer (primary), non-small cell lung cancer, small cell lung cancer, lymphoma (AIDS-related), lymphoma , macroglobulinemia, male breast cancer, malignant fibrous histiocytoma of bone / osteosarcoma, medulloblastoma, melanoma, Merkel cell carcinoma, squamous cell carcinoma of the neck with occult metastatic primary lesions, oral cancer, multiple endocrine neoplasms syndrome, multiple myeloma (bone marrow cancer) in children, multiple myeloma / plasma cell neoplasms, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative diseases, chronic myeloid leukemia, myxoma, nasal and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oligodendroglioma, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial carcinoma (surface epithelial-stromal tumor), ovarian germ cell tumor, ovarian low malignant potential tumor,Pancreatic cancer, islet cell carcinoma, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pineoblastoma and supratentorial primitive neuroectodermal tumor, pituitary adenoma, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), transitional cell carcinoma of the renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, skin cancer (melanoma), skin cancer ( non-melanoma), Merkel cell skin cancer, small cell lung cancer, small intestinal cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell carcinoma of the neck with occult metastatic primary, gastric cancer, supratentorial primitive neuroectodermal tumor, cutaneous T-cell lymphoma, testicular cancer, laryngeal cancer, thymoma and thymic carcinoma, thymoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, transitional cell carcinoma of the ureter and renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, optic pathway and hypothalamic glioma, optic pathway and hypothalamic glioma in children, vulvar cancer, macroglobulinemia, and Wilms tumor (kidney cancer).

[0046] Furthermore, the cancer is pancreatic cancer.

[0047] The term "treatment" of the present invention includes preventive or preventive treatment (preventing the targeted pathological condition or disorder and / or slowing its development) and curative, therapeutic or disease-modifying treatment, including treatment measures that cure, slow down, alleviate the symptoms of the diagnosed pathological condition or disorder and / or prevent its progress; and treatment of patients at risk of contracting a disease or suspected of having contracted a disease and patients who are ill or have been diagnosed with a disease or medical condition. The term does not necessarily mean that the individual is treated to complete recovery. The term "treatment" also refers to maintaining and / or promoting the health of individuals who are not ill but may be prone to unhealthy conditions. The term "treatment" is also intended to include strengthening or enhancing one or more major preventive or therapeutic measures. The term "treatment" is also intended to include dietary control of a disease or condition or dietary control for preventing or preventing a disease or condition. Treatment can be patient- or doctor-related.

[0048] When the term "comprising" is used, this is intended to indicate that the one or more components, one or more functions, one or more features mentioned or listed thereafter can not only be implemented alone, but also that one or more other components and / or features (e.g. other additives, other functions) may be present in addition to those specifically mentioned. This is in contrast to the term "containing" or "consisting of", which in this context means that no other components or features are included except those specifically mentioned after the term, thus indicating a complete listing / representation of features and / or components. Wherever "comprising" is used, it can be replaced (independently of the term appearing elsewhere) by the narrower term "consisting of" or (in terms of a process or method) by "a step comprising..." when possible and convenient, thereby producing specific and preferred embodiments of the present invention.

[0049] Advantages and beneficial effects of the present invention:

[0050] The present invention first discovered that B cells co-stimulated by LPS and anti-CD40 antibodies can be used as cell vectors for gene therapy to continuously express dFv-LDP protein in vivo to treat pancreatic cancer. The present invention discovered that B lymphocytes can continuously express dFv-LDP protein, solving the problem of too fast reduction in blood concentration of scFv protein to achieve better therapeutic effect than direct injection of dFv-LDP protein, and at the same time can reduce the economic burden of multiple injections of scFv protein on patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is the result of WB verification of B lymphocytes expressing dFv-LDP protein.

[0052] Figure 2 This is the result of ELISA verification of B lymphocyte secretion of dFv-LDP protein three days after gene editing.

[0053] Figure 3 The graph shows the results of ELISA detection of dFv-LDP protein in serum proteins after reinfusion into mice within 16 weeks.

[0054] Figure 4 This is a statistical chart of the tumor volume results of all mice after B lymphocyte transfusion.

[0055] Figure 5 This is a statistical chart of the tumor weights of all mice after B lymphocyte transfusion.

[0056] Figure 6 This is an abbreviated result diagram of tumor volume in the pancreatic cancer animal model after B lymphocyte transfusion.

[0057] Figure 7This is a statistical graph showing the survival rate of mice after B lymphocyte transfusion.

[0058] Figure 8 This is a graph showing the change in tumor volume in a single mouse after B lymphocyte transfusion. DETAILED DESCRIPTION

[0059] The terms used in this specification generally have their ordinary meaning in the art, in the context of the present invention, and in the specific context in which each term is used. Certain terms used to describe the present invention will be discussed below or elsewhere in the specification to provide additional guidance to practitioners about the description of the present invention. For convenience, certain terms may be highlighted, such as using italics and / or quotation marks. The use of highlighting has no effect on the scope and meaning of the terms; in the same context, whether or not highlighted, the scope and meaning of the terms are the same. It will be understood that the same thing can be expressed in more than one way. Therefore, for any one or more terms discussed herein, alternative language and synonyms can be used, but this does not give any special meaning to whether the terms are elaborated or discussed herein. Synonyms for certain terms are provided. The description of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification (including examples of any term discussed herein) is merely illustrative and in no way limits the scope and meaning of the present invention or any exemplified term. Similarly, the present invention is not limited to the various embodiments given in this specification.

[0060] Those of ordinary skill in the art will appreciate that, in addition to the specifically exemplified starting materials, biomaterials, reagents, synthesis methods, purification methods, analytical methods, assay methods, and biomethods, other starting materials, biomaterials, reagents, synthesis methods, purification methods, analytical methods, assay methods, and biomethods may also be used in the practice of the present invention without resorting to excessive experiments. All functional equivalents known in the art of any such materials and methods are intended to be included in the present invention. The terms and expressions that have been adopted are used as descriptive terms rather than restrictive terms, and when using these terms and expressions, it is not intended to exclude any equivalents of the features shown and described or parts thereof, but it should be recognized that within the scope of the claimed invention, various modifications may exist. Therefore, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, those skilled in the art may modify and change the concepts disclosed herein, and these modifications and changes are considered to be within the scope of the present invention as defined by the appended claims.

[0061] Example 1

[0062] 1. Experimental methods

[0063] 1) Isolation and culture of primary mouse B cells

[0064] Naive B cells were isolated from BALB / c mice using mouse 1× lymphocyte separation medium (7211011, DAKEWE) and used according to the manufacturer's protocol. Mouse CD43(Untouched TM B Cells) (11422D, Invitrogen) were purified. Briefly, whole spleens were extracted from 8-week-old male Balb / c mice and mechanically pulverized in mouse 1× lymphocyte isolation medium. The cells were centrifuged at 800 g for 30 min at room temperature without braking. The mononuclear cell layer was aspirated, ten volumes of RPMI 1640 medium were added, and the cells were centrifuged at 300 g for 10 min at room temperature. The cells were resuspended in 2% FBS / PBS and then Mouse CD43(Untouched TM Naive B cells were negatively sorted by magnetic beads. Naive B cells were cultured in RPMI 1640 medium supplemented with 15% FBS and 20 ng / μl LPS (L2630, Sigma), 10 ng / μl CD40 monoclonal antibody (16-0401-82, Invitrogen), 50 μM β-mercaptoethanol, GlutaMAX, NEAA, penicillin (100 U / ml) and streptomycin (100 g / ml; Gibco) at a final density of 1×10 7 cells / ml.

[0065] 2) Electroporation

[0066] B cells co-stimulated with LPS and anti-CD40 antibody were electroporated using the Neon transfection system after 1-3 days of in vitro stimulation. The Raso26 gRNA sequence was GGATTCTCCCAGGCCCAGGG, with CGG as the protozoan adjacent motif (PAM) site. Cas9 protein (Invitrogen) and purified gRNA were pre-incubated at room temperature for 30 minutes. B cells were cultured at 1×10 7 Resuspend in Buffer T at a final density of 10 cells / ml. 6 Each cell contained 5 μg of pre-complexed Cas9 and gRNA, and 10 μg of DNA template. The cells were electroporated at 1600 V, 20 ms, and 2 pulses, and cultured in complete B cell culture medium (with LPS and anti-CD40 antibody), plus the Caspase inhibitor Boc-D-FMK (ab142036, Abcam).

[0067] 2. Experimental results

[0068] 1) After gene editing, WB was used to verify that B lymphocytes can express dFv-LDP protein

[0069] B cells electroporated with RNP and the homologous repair template of dFv-LDP, and B cells electroporated with the homologous repair template of dFv-LDP alone can express dFv-LDP protein ( Figure 1 ). Among them, dFv-LDP protein has been reported in existing articles, and its specific amino acid sequence is as follows:.

[0070] Group description: Blank control group: empty electroporated B cells, RNP electroporated group: B cells electroporated with gRNA and cas9 protein, dFv-LDP template electroporated group: B cells electroporated with dFv-LDP DNA template only, RNP and dFv-LDP template electroporated group: B cells co-electroporated with RNP and dFv-LDP DNA template, dFv-LDP: recombinant dFv-LDP protein was used as a positive control.

[0071] 2) Three days after gene editing, ELISA was used to prove that B lymphocytes can secrete dFv-LDP protein

[0072] B cells electroporated with RNP and the homologous repair template of dFv-LDP, as well as B cells electroporated with only the homologous repair template of dFv-LDP, were able to secrete dFv-LDP protein ( Figure 2 ).

[0073] 3) After gene editing, B lymphocytes were infused back into mice, and serum proteins were detected by ELISA within 16 weeks to prove that B lymphocytes can secrete dFv-LDP protein for a long time

[0074] The edited B cells were re-infused, and blood samples were collected every two weeks for ELISA testing of dFv-LDP. The results showed that mice re-infused with co-electroporated DNA template and RNPb cells were able to secrete dFv-LDP protein for a long time. At 16 weeks, dFv-LDP protein was still detected in the serum ( Figure 3 ).

[0075] Example 2

[0076] 1. Experimental methods

[0077] 1) Preparation of therapeutic B cells

[0078] Mouse naive B cells were isolated from mouse spleen using the above-mentioned mouse primary B cell isolation protocol, and stimulated and cultured with LPS and anti-CD40 antibodies for 1-3 days. After stimulation and culture, the homologous repair templates of RNP and dFv-LDP were electroporated using the above-mentioned electroporation protocol.

[0079] 2) In vivo anti-tumor experiments

[0080] In order to analyze the anti-tumor ability of dFv-LDP-secreting B cells, a pancreatic cancer mouse model was first established. On day 0, nude mice were subcutaneously injected with 2×10 6 On day 7, 5×10 6 The dFv-LDP-secreting B cells were infused back into nude mice, and tumor growth was subsequently monitored.

[0081] Group description: Normal saline: normal saline was re-infused, dFv-LDP protein group: dFv-LDP recombinant protein was re-infused, non-edited B cell group: non-gene-edited B cells stimulated for the same time as dFv-LDP secreting B cells were re-infused, dFv-LDP secreting B cells: B cells electroporated with dFv-LDP DNA template and RNP (gRNA and cas9 protein) were re-infused.

[0082] 2. Experimental results

[0083] 1) After B lymphocyte transfusion, the synergistic treatment of B lymphocytes and dFv-LDP significantly reduced the tumor volume of mice

[0084] After the B lymphocytes were reinfused, the tumor volume was measured by a vernier caliper every three days, and the tumor volume was calculated by the length, width and height of the tumor. Compared with the injection of dFv-LDP protein alone and the reinfusion of unedited B lymphocytes, the reinfusion of B cells secreting dFv-LDP significantly reduced the tumor volume of the pancreatic cancer animal model, that is, it had better anti-tumor ability ( Figure 4 ).

[0085] 2) Synergistic treatment of B lymphocytes and dFv-LDP significantly reduced tumor weight in pancreatic cancer animal models

[0086] 21 days after the infusion, the mice in each group were euthanized, and the tumors were then removed and weighed. Compared with the injection of dFv-LDP protein alone and the infusion of unedited B cells, the infusion of B cells secreting dFv-LDP significantly reduced the tumor weight of the pancreatic cancer animal model, that is, better anti-tumor ability ( Figure 5 ).

[0087] 3) Synergistic treatment of B lymphocytes and dFv-LDP significantly reduced tumor size in pancreatic cancer animal models

[0088] 21 days after the infusion, the mice in each group were euthanized, and the tumors were removed and photographed. Compared with the injection of dFv-LDP protein alone and the infusion of unedited B cells, the tumors of the pancreatic cancer animal model in which the B cells secreting dFv-LDP were infused were significantly smaller than those in other groups, that is, the B cells secreting dFv-LDP infused had better anti-tumor ability ( Figure 6 ).

[0089] 4) The survival curve proves that the synergistic therapeutic effect of B lymphocytes and dFv-LDP is a long-term manifestation

[0090] The tumor volume was measured 120 days after the infusion. According to the ethical requirements of experimental animals, if the maximum diameter of the tumor exceeded 1.5 cm, the mice were euthanized. The results showed that all the mice in the group of B cells secreting dFv-LDP were alive at 120 days, while most of the mice in other groups died early. This result shows that the infusion of B cells secreting dFv-LDP has long-term anti-tumor ability ( Figure 7 ).

[0091] 5) Record the changes in tumor volume of a single mouse to demonstrate the long-term synergistic therapeutic effect of B lymphocytes and dFv-LDP

[0092] The tumor volume was measured 120 days after the transfusion. According to the ethical requirements of experimental animals, if the maximum diameter of the tumor exceeded 1.5 cm, the mouse was euthanized. Figure 8 ) It can be seen that the mice in the saline group were euthanized within 45 days when the tumor volume reached more than 1.5 cm. The mice using B lymphocytes alone and dFv-LDP protein alone had a certain therapeutic effect, and the tumor volume of B cells secreting dFv-LDP protein used in combination was significantly smaller than that of the other three groups, and the tumors of two mice completely disappeared. The above results prove that the synergistic treatment of B lymphocytes and dFv-LDP is long-term and effective.

Claims

1. Application of CD40 antibody and LPS co-stimulated genetically modified B cells in the preparation of a pharmaceutical composition for treating cancer.

2. The use according to claim 1, wherein the protein expressed by the gene can treat cancer; Preferably, the genetically modified B cells are B cells expressing dFv-LDP protein.

3. The use according to claim 1, wherein the B cells include naive B cells, conventional B cells, follicular B cells, marginal zone B cells, B1 cells, memory B cells, and plasma cells; Preferably, the pharmaceutical composition comprises a pharmaceutically acceptable adjuvant; Preferably, the auxiliary agent includes a diluent, a dispersing aid, a suspending aid, a surfactant, an isotonic agent, a thickening or emulsifying agent, a preservative, a solid binder, and a lubricant.

4. A pharmaceutical composition comprising the CD40 antibody used in any one of claims 1 to 3 and LPS co-stimulated genetically modified B cells; Preferably, the genetically modified B cells are B cells expressing dFv-LDP protein.

5. A method for constructing a gene-modified B cell that expresses a target protein for a long time, the method comprising using LPS and anti-CD40 antibodies to co-stimulate the B cell for 1-3 days before electroporation of the target gene; the target protein is a protein that can treat cancer; Preferably, the B cells are in vitro cells. The construction method according to claim 5 , wherein the target protein is dFv-LDP protein.

7. The construction method according to claim 5, wherein the B cells are from humans or non-human mammals; Preferably, the B cells are from humans, gorillas, monkeys, horses, cows, sheep, pigs, donkeys, camels, dogs, rabbits, cats, rats, or mice.

8. The construction method according to claim 7, comprising the following steps: 1×10 7 LPS and anti-CD40 antibodies are added to B cells of 10 cells / ml, and the cells are stimulated in vitro for 1-3 days. The gene vector capable of expressing the target protein is then transformed into the stimulated B cells by electroporation. The cells are then cultured in complete B cell culture medium supplemented with LPS and anti-CD40 antibodies, and caspase inhibitors are added. Preferably, the Caspase inhibitor is Boc-D-FMK.

9. A cell, wherein the cell is constructed by the construction method according to any one of claims 5 to 8, the cell is capable of expressing a target gene for a long time, and the cell is used to treat cancer.

10. Use of CD40 antibody and LPS in the preparation of a product of gene-modified B cells that express a target protein for a long time; the target protein is a protein that can treat cancer; Preferably, the target protein is dFv-LDP protein.

Images