Fish rhabdovirus binding protein as well as preparation method and application thereof

Abstract

The invention belongs to the field of prevention and control of aquatic pathogenic microorganisms, and particularly relates to a fish rhabdovirus binding protein as well as a preparation method and application thereof. The protein can be efficiently combined aiming at a binding site of the fish rhabdovirus and a host cell receptor, and an invasion channel of the fish rhabdovirus invading a host cell is effectively blocked, so that the virus is prevented from infecting the cell, and the virus is prevented from being copied and proliferated in a host body. The fish rhabdovirus binding protein provided by the invention has an efficient anti-rhabdovirus effect, a premixed feed additive prepared from the fish rhabdovirus binding protein as an active material can significantly improve the anti-rhabdovirus ability of fry, and the fish rhabdovirus binding protein is safe and pollution-free, and can be industrially applied on a large scale, so that the economic benefit of fish culture is improved.

Description

Technical Field

[0001] The invention belongs to the field of aquatic pathogenic microorganism prevention and control, and specifically relates to a fish rhabdovirus binding protein and a preparation method and application thereof. Background Art

[0002] Since 2010, the world's aquaculture production has grown rapidly, and the outbreak of fish rhabdovirus disease has become increasingly frequent, seriously affecting the healthy and sustainable development of aquaculture. In 1999, Chinese scholar Zhang Qiya first observed Siniperca chuatsi rhabdovirus (SCRV) in the tissues of diseased mandarin fish in Guangdong. SCRV is a member of the Rhabdoviridae family and a single-stranded negative-stranded non-segmented RNA virus. With the rapid development of fish farming, fish rhabdovirus disease has become one of the important diseases of farmed fish. Fish rhabdoviruses are highly pathogenic, especially VHSV, IHNV, HRV, SHRV and SVCV, which are widely prevalent around the world and cause significant economic losses to the aquaculture industry.

[0003] At present, there is still a lack of effective treatment for diseases caused by rhabdoviruses. Vaccines, as the most effective way to prevent viral infection, have been reported in the prevention of rhabdoviruses. However, the effect of virus prevention and treatment is still limited, making it difficult to meet the requirements of large-scale industrialization. Therefore, finding safer and more efficient anti-rhabdovirus preparations has become an urgent problem to promote the healthy development of aquaculture. Summary of the invention

[0004] In view of the problems in the prior art, the present invention provides a fish rhabdovirus binding protein, which can efficiently bind to the site where fish rhabdovirus binds to host cell receptors, effectively blocking the invasion channel of fish rhabdovirus to invade host cells, thereby blocking the virus from infecting cells and preventing the virus from replicating and proliferating in the host. The fish rhabdovirus binding protein provided by the present invention has a highly efficient anti-rhabdovirus effect, and the premixed feed additive prepared with this as the active material can significantly improve the anti-rhabdovirus ability of fish fry, and is safe and pollution-free, and can be applied on a large scale industrially, thereby improving the economic benefits of fish farming.

[0005] The purpose of the present invention can be achieved through the following technical solutions: The first aspect of the present invention provides a fish rhabdovirus binding protein, characterized in that the amino acid sequence of the fish rhabdovirus binding protein is shown in SEQ ID NO.1.

[0006] The second aspect of the present invention provides a gene encoding the above-mentioned fish rhabdovirus binding protein, and the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0007] The third aspect of the present invention provides a method for preparing the above-mentioned fish rhabdovirus binding protein, comprising: connecting the coding gene to the vector Pet-30a (+) using BamHI and HindⅢ as restriction sites to obtain a recombinant plasmid; transforming the recombinant plasmid into Escherichia coli BL21-DE3, inducing the expression of the target protein by IPTG, and obtaining the fish rhabdovirus binding protein after purification.

[0008] The fourth aspect of the present invention provides a premixed feed additive for preventing fish rhabdovirus, which comprises 1-3 parts of the above-mentioned fish rhabdovirus binding protein, 350-360 parts of basic auxiliary materials and 30-40 parts of plant extract auxiliary materials in parts by mass.

[0009] Preferably, based on weight, it includes 1 part of the above-mentioned fish rhabdovirus binding protein, 360 parts of basic auxiliary materials and 40 parts of plant extract auxiliary materials.

[0010] Furthermore, the basic auxiliary materials include the following raw materials in parts by mass: 1-5 parts of calcium-based montmorillonite, 1-3 parts of modified diatomaceous earth, 0.1-1 parts of water glass, 2-5 parts of garlic powder, 2-10 parts of broken yeast powder, 5-20 parts of wheat bran, 2-5 parts of mixed oils and fats, 0.5-1 parts of salt, 5-20 parts of fish meal, and 5-15 parts of peanut residue.

[0011] Among them, the particle size of the basic auxiliary materials is above 200 meshes.

[0012] Calcium montmorillonite, used as a mineral supplement.

[0013] Modified diatomaceous earth as an adsorbent or ingredient to improve intestinal health.

[0014] Water glass (sodium silicate), as a dispersant, promotes the mutual dispersion of various raw materials.

[0015] Garlic powder, which has antibacterial and immune-boosting properties.

[0016] Cracked yeast powder, as a source of protein and B vitamins.

[0017] Wheat bran, as a source of fiber.

[0018] Mixed with fats and oils as a source of energy.

[0019] Salt, as an electrolyte and flavoring.

[0020] Fish meal and peanut residue as protein sources.

[0021] Furthermore, the plant extract excipients include the following raw materials in parts by weight: 0.1-1 part of honeysuckle, 0.1-1 part of honeysuckle vine, 0.1-1 part of purslane, 0.1-1 part of dandelion, 0.1-1 part of forsythia, 0.1-1 part of selfheal, 0.05-0.5 part of tangerine peel, 0.05-0.5 part of clove, 0.05-0.5 part of cinnamon, and 0.5-2 parts of licorice.

[0022] Among them, the particle fineness of the plant extract auxiliary material is above 200 mesh.

[0023] Honeysuckle, honeysuckle vine, purslane, dandelion, forsythia, and selfheal act as natural antiviral and immune enhancers.

[0024] Tangerine peel, cloves, and cinnamon not only serve as flavoring agents, but also have certain health benefits.

[0025] Licorice has immunomodulatory effects.

[0026] The fifth aspect of the present invention provides a method for preparing the above-mentioned premixed feed additive for preventing fish rhabdovirus: the above-mentioned fish rhabdovirus binding protein, basic auxiliary materials and plant extract auxiliary materials are added to a blender in sequence, and the blender is used to fully stir them to obtain a premixed feed additive for preventing fish rhabdovirus.

[0027] A sixth aspect of the present invention provides a use of the above-mentioned fish rhabdovirus binding protein or the above-mentioned premixed feed additive for preventing fish rhabdovirus in the preparation of a feed for preventing fish rhabdovirus.

[0028] Furthermore, the premixed feed additive for preventing fish rhabdovirus is added to the fish rhabdovirus prevention feed at a mass percentage of 0.1% to 1%.

[0029] The beneficial effects achieved by one or more technical solutions of the present invention are as follows: The fish rhabdovirus binding protein provided by the present invention can efficiently bind to the site where fish rhabdovirus binds to the host cell receptor, effectively blocking the invasion channel of fish rhabdovirus to infringe the host cell, thereby blocking the virus from infecting the cell, preventing the virus from replicating and proliferating in the host, and achieving a highly effective anti-rhabdovirus effect. The protein is added to a premixed feed additive to significantly improve the body's anti-rhabdovirus ability, is safe and pollution-free, and can be applied on a large scale in industry, thereby improving the economic benefits of fish farming. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the SDS-PAGE diagram for verifying the induced expression of the target protein of the fish rhabdovirus binding protein of the present invention; Figure 2This is an SDS-PAGE diagram for the purification verification of the fish rhabdovirus binding protein of the present invention. DETAILED DESCRIPTION

[0031] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0032] Unless otherwise specified, the materials, reagents and experimental equipment involved in the embodiments of the present invention are all commercially available products.

[0033] Example 1 A rhabdovirus binding protein, its amino acid sequence (SEQ ID NO.1): SKDELETPYMPEDNCDWATISDNEKTLKGGKCASTVGGGSIPSEAPRESCQLGSGGGGSGSAYSSEDVTGKIVDGGGGSNGNRMDNGTLRGGGGSSSNESDVLSAFRGGGGSLKKRKSQSTSQTTGGGGSGG GGSGGGGSSKDELETPYMPEDNCDWATISDNEKTLKGGKCASTVGGGSIPSEAPRESCQLGSGGGGSGSAYSSEDVTGKIVDGGGGSNGNRMDNGTLRGGGGSSSNESDVLSAFRGGGGSLKKRKSQSTSQTT Gene sequence optimized by codons for E. coli expression (SEQ ID NO. 2): AGCAAAGATGAATTAGAAACCCCGTATATGCCGGAAGATAATTGTGATTGGGCCACCATCAGCGATAATGAAAAAACTCTGAAAGGTGGCAAATGTGCCAGCACCGTTGGTGGCGGCAGCATTCCGAGCGAAGCGCCGCGCGAAAGCTGCCAGCTGGGTTCCGGCGGCGGTGGCAGCGGCAGCGCCTATTCAAGCGAAGATGTTACCGGCAAAATTGTCGATGGCGGCGGCGGTAGCAACGGTAACCGCATGGATAATGGCACGCTGCGTGGCGGCGGCGGCAGCTCAAGCAACGAATCGGACGTTCTGAGCGCATTCCGTGGCGGCGGCGGTAGCCTGAAAAAACGTAAAAGTCAGTCTACCAGCCAGACCACCGGTGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCTCTAGTAAAGATGAACTGGAAACCCCGTATATGCCGGAAGATAACTGCGATTGGGCGACCATTAGCGATAATGAAAAAACCCTGAAAGGCGGCAAATGCGCGAGCACCGTGGGCGGCGGCAGCATTCCGAGCGAGGCGCCGCGTGAAAGCTGTCAGCTGGGAAGTGGCGGCGGCGGCTCTGGTAGCGCGTATAGCAGCGAAGATGTGACCGGTAAAATTGTGGATGGAGGCGGCGGCTCTAACGGTAATCGTATGGATAACGGCACCCTGCGCGGCGGCGGCGGCAGCAGCAGCAACGAAAGCGACGTACTGAGCGCGTTTCGTGGCGGCGGCGGCAGCCTGAAAAAACGCAAATCGCAGAGCACCTCACAGACCACCTAA The preparation method of the fish rhabdovirus binding protein is as follows: Based on the above gene sequence, restriction enzyme sites BamHI and HindⅢ were introduced, which were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and cloned into the corresponding restriction enzyme sites of vector pET-30a (+) through the restriction enzyme sites BamHI and HindⅢ at both ends of the gene sequence. The strain was transformed into Escherichia coli Top10 clone strain by heat shock method, and grown on LB solid medium containing 50 μg / ml Kan+. Transformants containing recombinant plasmids were screened by colony PCR method, inoculated in LB liquid medium containing 50 μg / ml Kan+, and cultured at 37°C with shaking at 200 rpm for 14 hours. The recombinant plasmid was extracted using the common plasmid extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0034] The obtained recombinant plasmid containing the target gene fragment was transformed into Escherichia coli BL21-DE3 competent cells by heat shock method, the transformed cells were spread on LB solid medium containing 50 μg / ml Kan+ for growth, and BL21-DE3 transformants containing the recombinant plasmid were screened.

[0035] Use a sterile toothpick to pick up a single colony of BL21-DE3 bacteria containing the recombinant plasmid grown on the Kan+ resistant plate, inoculate it into 10 ml of LB liquid culture medium containing 50μg / ml Kan+, and culture it overnight in a constant temperature shaker at 37°C and 200 rpm. The next day, transfer the bacterial liquid to LB liquid culture medium containing 50μg / ml Kan+ at a ratio of 1:100. When the OD600 value is about 0.5-0.8 (about 3-4 hours), add IPTG storage solution (100 m mol / L) at a ratio of 1:200, and continue to culture for 5 hours to induce the expression of the target protein. The SDS-PAGE image of the induced expression of the fish rhabdovirus binding protein target protein is shown in the figure below. Figure 1 As shown (where M: 180kDa color pre-stained protein molecular weight standard; lane 1: bacterial solution without IPTG induction; lanes 2-4: bacterial solution induced by IPTG).

[0036] Purification of Fish Rhabdovirus Binding Proteins: The E. coli fermentation broth expressing the recombinant protein was centrifuged at 5000rpm for 8 minutes to collect the cells, and the cells were resuspended in PBS with 1 / 20 volume of the fermentation broth, and the cells were homogenized and broken by a high-pressure homogenizer. Appropriate protease inhibitors were added during the breaking process to prevent protein degradation. The broken liquid mixture was centrifuged again at 13000rpm, 4℃, for 10 minutes, and the precipitate was collected. The target protein (precipitate) was resuspended in PBS containing 0.1% Triton-X100 and 0.5M urea, and the precipitate was collected by centrifugation at 10000rpm after oscillation at room temperature for 20 minutes. This was repeated twice to remove most of the soluble impurities. The washed precipitated protein was dissolved in a PBS solution containing 8M urea, oscillated at room temperature for 30 minutes until the precipitated protein was fully dissolved and free of white particles, and centrifuged at 13000rpm at 4℃ to remove cell debris and unbroken cells, and the supernatant was collected to obtain the purified protein. The SDS-PAGE diagram of the purified fish rhabdovirus binding protein purification verification is shown below Figure 2 As shown (wherein, M: 180 kDa color pre-stained protein molecular weight standard; lane 1: protein washing solution; lane 2: purified protein solution of collection tube 1; lane 3: purified protein solution of collection tube 2), the purified protein obtained was spray-dried and stored at 5°C for future use.

[0037] Example 2 This embodiment provides a premixed feed additive for preventing fish rhabdovirus: Basic auxiliary materials (particle fineness is 200 mesh): 2 parts of calcium-based montmorillonite, 2 parts of modified diatomaceous earth, 1 part of water glass, 3 parts of garlic powder, 5 parts of broken yeast powder, 10 parts of wheat bran, 2 parts of mixed oil, 1 part of salt, 10 parts of fish meal, and 10 parts of peanut residue.

[0038] Plant extract excipients (particle size is 200 mesh): 1 part of honeysuckle, 1 part of honeysuckle vine, 1 part of purslane, 1 part of dandelion, 1 part of forsythia, 1 part of selfheal, 0.5 part of tangerine peel, 0.5 part of cloves, 0.5 part of cinnamon, and 1 part of licorice.

[0039] One portion of fish rhabdovirus binding protein, 360 portions of the above basic auxiliary materials and 40 portions of the above plant extract auxiliary materials are sequentially added into a blender, and the mixture is fully stirred by the blender to obtain a premixed feed additive for preventing fish rhabdovirus.

[0040] Example 3 Evaluation of performance against fish rhabdoviruses: Case 1: Preparation method of feed coated with a premixed feed additive for preventing fish rhabdovirus: Take 100g of the premixed feed additive for preventing fish rhabdovirus prepared in Example 2, add it to about 600ml of water, stir and add it to fully mix until a suspension is completely formed, stir and mix it with 20kg of feed, and naturally air-dry for more than 10 minutes to obtain feed uniformly coated with the premixed feed additive for preventing fish rhabdovirus.

[0041] The preparation method of fish rhabdovirus binding protein mixed feed is as follows: 0.25g of fish rhabdovirus binding protein mixed feed is added to about 600ml of water, fully stirred, and then fully stirred and mixed with 20kg of feed, and naturally air-dried for more than 10 minutes to obtain fish rhabdovirus binding protein mixed feed.

[0042] 450 raw fish infected with rhabdovirus from the same fish pond were taken. The CT value of rhabdovirus detection was 32.45, and the body was 8-12cm. They were divided into 3 groups, 150 fish in each group, 3 parallels were set for each group, and 50 fish in each parallel group were raised in two circulating water tanks with a total of 9 fish tanks, and the feeding conditions were consistent. Experimental group 1 was fed with fish rhabdovirus-binding protein mixed feed, one meal a day for 5 consecutive days, and then fed with ordinary feed. Experimental group 2 was fed with feed wrapped in premixed feed additives for preventing fish rhabdovirus, one meal a day for 5 consecutive days, and then fed with ordinary feed. The control group was fed with the same dose of ordinary feed every day. Observe for 14 days and record the number of survival fish in each group. After 14 days, 5 mixed samples were sampled from each parallel group for rhabdovirus detection. The experimental results are shown in Tables 1 and 2.

[0043] Table 1 Statistics of survival rate of experimental fish in each group

[0044] Table 2 Virus detection results

[0045] According to Table 1 and Table 2, the average survival rate of the three parallel groups of experimental group 1 (fed with fish rhabdovirus binding protein mixed feed) was 57.3%, the average survival rate of the three parallel groups of experimental group 2 (fed with premixed feed additives for preventing fish rhabdovirus) was 73.3%, and the average survival rate of the control group was only 32.0%. The surviving fish in experimental groups 1 and 2 tested negative for rhabdovirus, and their swimming posture, fish body and feeding were normal, while the CT value of the rhabdovirus test of the surviving fish in the control group was 31.66, and rhabdovirus infection was still present. The experimental results show that fish rhabdovirus binding protein helps fish resist rhabdovirus infection, and the use of premixed feed additives for preventing fish rhabdovirus can effectively prevent rhabdovirus infection and significantly improve the survival rate of raw fish in the early stage of rhabdovirus infection.

[0046] Case 2: The raw fish fry raised in a raw fish fry breeding farm were about 5 cm in length. Two adjacent fish ponds, Pond A and Pond B, were selected. Each pond had about 400,000 fry, and more than 5,000 fry died every day before the experiment. Pond A was selected as the experimental pond and Pond B as the control pond. The experimental pond was fed with feed wrapped in a premixed feed additive for preventing fish rhabdovirus for 7 consecutive days, one meal a day, and ordinary feed was fed at other times. The control group was fed with the same dose of ordinary feed every day. The observation was conducted for 14 days, and the death statistics of each group of experimental fish were recorded. The results are shown in Table 3.

[0047] Table 3 Statistics of the number of fish deaths in the experimental group and the control group

[0048] According to the experimental results, after the experimental group was fed with feed coated with premixed feed additives for preventing fish rhabdovirus for 7 consecutive days, the number of fish deaths from the diseased fish decreased from more than 5,000 per day before the experiment to 243, while the number of fish deaths in the control group, Pond B, was more than 5,000. By the 14th day of the experiment, the number of fish deaths in the experimental pond had dropped to 0, and the rhabdovirus disease was effectively controlled, while the number of fish deaths in the control pond remained high at 4,520. The experimental results show that premixed feed additives for preventing fish rhabdovirus can effectively alleviate the horizontal transmission of rhabdovirus among fish schools and reduce the loss rate of diseased fish schools.

Claims

1. A fish rhabdovirus binding protein, characterized in that: The amino acid sequence of the fish rhabdovirus binding protein is shown in SEQ ID NO.

1.

2. A gene encoding the fish rhabdovirus binding protein according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. A method for preparing the fish rhabdovirus binding protein according to claim 1, characterized in that: include: The coding gene was connected to the vector Pet-30a (+) using BamHI and HindⅢ as restriction sites to obtain a recombinant plasmid; the recombinant plasmid was transformed into Escherichia coli BL21-DE3, the expression of the target protein was induced by IPTG, and the fish rhabdovirus binding protein was obtained after purification.

4. A premixed feed additive for preventing fish rhabdovirus, characterized in that: Calculated by weight, it comprises 1-3 parts of the fish rhabdovirus binding protein according to claim 1, 350-360 parts of basic auxiliary materials and 30-40 parts of plant extract auxiliary materials.

5. The premixed feed additive for preventing fish rhabdovirus according to claim 4, characterized in that: Calculated by weight, it comprises 1 part of the fish rhabdovirus binding protein according to claim 1, 360 parts of basic auxiliary materials and 40 parts of plant extract auxiliary materials.

6. The premixed feed additive for preventing fish rhabdovirus according to claim 4, characterized in that: The basic auxiliary materials include the following raw materials in proportion by weight: 1-5 parts of calcium-based montmorillonite, 1-3 parts of modified diatomaceous earth, 0.1-1 parts of water glass, 2-5 parts of garlic powder, 2-10 parts of broken yeast powder, 5-20 parts of wheat bran, 2-5 parts of mixed oils and fats, 0.5-1 parts of salt, 5-20 parts of fish meal, and 5-15 parts of peanut residue.

7. The feed additive for preventing fish rhabdovirus according to claim 4, characterized in that: The plant extract excipients include the following raw materials in parts by weight: 0.1-1 part of honeysuckle, 0.1-1 part of honeysuckle vine, 0.1-1 part of purslane, 0.1-1 part of dandelion, 0.1-1 part of forsythia, 0.1-1 part of selfheal, 0.05-0.5 part of tangerine peel, 0.05-0.5 part of clove, 0.05-0.5 part of cinnamon, and 0.5-2 parts of licorice.

8. The method for preparing the premixed feed additive for preventing fish rhabdovirus according to claim 4, characterized in that: The fish rhabdovirus binding protein, basic auxiliary materials and plant extract auxiliary materials are sequentially added into a stirrer, and fully stirred by the stirrer to obtain a premixed feed additive for preventing fish rhabdovirus.

9. Use of the fish rhabdovirus binding protein according to claim 1 or the premixed feed additive for preventing fish rhabdovirus according to claim 4 in preparing feed for preventing fish rhabdovirus.

10. The use according to claim 9, characterized in that: The premixed feed additive for preventing fish rhabdovirus is added to the fish rhabdovirus prevention feed at a mass percentage of 0.1%-1%.

Images