Fish rhabdovirus binding protein and preparation method and application thereof

Abstract

The present application belongs to the field of prevention and control of aquatic pathogenic microorganisms, and particularly relates to a fish rhabdovirus binding protein and a preparation method and application thereof. The protein can efficiently bind to the site of fish rhabdovirus binding to a host cell receptor, effectively block the invasion channel of fish rhabdovirus invading a host cell, thereby blocking virus infection of a cell and avoiding virus replication and proliferation in a host body. The fish rhabdovirus binding protein provided by the present application has a high-efficiency anti-rhabdovirus effect, and a premixed feed additive prepared by taking the protein as an active material can significantly improve the anti-rhabdovirus capacity of fry, is safe and non-polluting, can be applied on a large scale, and can further improve the economic benefits of fish culture.

Description

Technical Field

[0001] This invention belongs to the field of aquatic pathogenic microorganism control, specifically relating to a fish rhabdovirus binding protein and its preparation method and application. Background Technology

[0002] Since 2010, the global aquaculture industry has experienced rapid growth in output, and outbreaks of fish rhabdovirus diseases have become increasingly frequent, seriously impacting the healthy and sustainable development of aquaculture. In 1999, Chinese scholar Zhang Qiya first observed Siniperca chuatsi rhabdovirus (SCRV) in the tissues of diseased mandarin fish in Guangdong. SCRV is a member of the Rhabdoviridae family and is a single-stranded, negative-sense, non-segmented RNA virus. With the rapid development of fish farming, fish rhabdovirus diseases have become one of the most important diseases affecting farmed fish. Fish rhabdoviruses are highly pathogenic, especially VHSV, IHNV, HRV, SHRV, and SVCV, which are widespread worldwide, causing significant economic losses to the aquaculture industry.

[0003] Currently, there is still a lack of effective treatments for diseases caused by rhabdoviruses. While vaccines, as the most effective way to prevent viral infection, have been reported to be effective in preventing rhabdovirus infections, their effectiveness remains limited, making them unsuitable for large-scale industrial application. Therefore, finding safer and more effective anti-rhabdovirus agents has become an urgent problem to be solved to promote the healthy development of aquaculture. Summary of the Invention

[0004] To address the problems in existing technologies, this invention provides a fish rhabdovirus binding protein. This protein can efficiently bind to the binding site of fish rhabdovirus and host cell receptors, effectively blocking the invasion pathway of fish rhabdovirus into host cells, thereby preventing viral infection and viral replication and proliferation within the host. The fish rhabdovirus binding protein provided by this invention has highly efficient anti-rhabdovirus activity. Premixed feed additives prepared using this protein as an active material can significantly improve the resistance of fish fry to rhabdovirus, and are safe and pollution-free, enabling large-scale industrial application and thus improving the economic benefits of fish farming.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The first aspect of the present invention provides a fish rhabdovirus binding protein, characterized in that: the amino acid sequence of the fish rhabdovirus binding protein is shown in SEQ ID NO.1.

[0007] A second aspect of the present invention provides a gene encoding the above-mentioned fish rhabdovirus binding protein, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0008] The third aspect of the present invention provides a method for preparing the above-mentioned fish rhabdovirus binding protein, comprising: ligating the encoding gene into the vector Pet-30a(+) with BamHI and HindIII as restriction enzyme sites to obtain a recombinant plasmid; transforming the recombinant plasmid into Escherichia coli BL21-DE3, inducing the expression of the target protein by IPTG, and obtaining the fish rhabdovirus binding protein after purification.

[0009] The fourth aspect of the present invention provides a premixed feed additive for preventing fish rhabdomyovirus, comprising, by weight, 1-3 parts of the above-mentioned fish rhabdomyovirus binding protein, 350-360 parts of basic excipients and 30-40 parts of plant extract excipients.

[0010] Preferably, by weight, it includes 1 part of the fish rhabdovirus binding protein, 360 parts of basic excipients, and 40 parts of plant extract excipients.

[0011] Furthermore, the basic auxiliary materials include the following raw materials in parts by weight: 1-5 parts calcium-based montmorillonite, 1-3 parts modified diatomaceous earth, 0.1-1 parts water glass, 2-5 parts garlic powder, 2-10 parts broken cell wall yeast powder, 5-20 parts wheat bran, 2-5 parts mixed oils, 0.5-1 part salt, 5-20 parts fish meal, and 5-15 parts peanut residue.

[0012] The particle size of the basic auxiliary materials is above 200 mesh.

[0013] Calcium-based montmorillonite, used as a mineral supplement.

[0014] Modified diatomaceous earth, used as an adsorbent or as a component to improve gut health.

[0015] Water glass (sodium silicate) acts as a dispersant to promote the dispersion of various raw materials.

[0016] Garlic powder has antibacterial and immune-enhancing effects.

[0017] Broken cell wall yeast powder serves as a source of protein and B vitamins.

[0018] Wheat bran, as a source of fiber.

[0019] Mixed fats and oils as an energy source.

[0020] Salt is used as an electrolyte and a flavoring agent.

[0021] Fish meal and peanut residue can be used as protein sources.

[0022] Furthermore, the plant extract excipients include the following raw materials in parts by weight: honeysuckle 0.1-1 part, honeysuckle vine 0.1-1 part, purslane 0.1-1 part, dandelion 0.1-1 part, forsythia 0.1-1 part, prunella vulgaris 0.1-1 part, dried tangerine peel 0.05-0.5 part, clove 0.05-0.5 part, cinnamon 0.05-0.5 part, and licorice 0.5-2 parts.

[0023] Among them, the particle size of the plant extract excipients is above 200 mesh.

[0024] Honeysuckle, Lonicera japonica vine, purslane, dandelion, forsythia, and prunella vulgaris are natural antiviral and immune enhancers.

[0025] Dried tangerine peel, cloves, and cinnamon not only have flavoring properties but also offer certain health benefits.

[0026] Licorice has immunomodulatory effects.

[0027] The fifth aspect of the present invention provides a method for preparing the above-mentioned premixed feed additive for preventing fish rhabdomyovirus: the above-mentioned fish rhabdomyovirus binding protein, basic excipients and plant extract excipients are added to a mixer in sequence and stirred thoroughly by the mixer to obtain the premixed feed additive for preventing fish rhabdomyovirus.

[0028] The sixth aspect of the present invention provides the application of the above-mentioned fish rhabdovirus binding protein or the above-mentioned premixed feed additive for preventing fish rhabdovirus in the preparation of feed for preventing fish rhabdovirus.

[0029] Furthermore, the premixed feed additive for preventing fish rhabdomyovirus is added to the feed for preventing fish rhabdomyovirus at a mass percentage of 0.1% to 1%.

[0030] The beneficial effects achieved by one or more technical solutions of the present invention are as follows:

[0031] The fish rhabdovirus binding protein provided by this invention can efficiently bind to the binding site of fish rhabdovirus and host cell receptors, effectively blocking the invasion channel of fish rhabdovirus to infect host cells, thereby blocking viral infection of cells and preventing viral replication and proliferation in the host, achieving a highly efficient anti-rhabdovirus effect. When this protein is added to premixed feed additives, it can significantly improve the body's anti-rhabdovirus ability, and it is safe and pollution-free, enabling large-scale industrial application and thus improving the economic benefits of fish farming. Attached Figure Description

[0032] Figure 1 SDS-PAGE image for verifying the induced expression of the target protein of the fish rhabdovirus binding protein of this invention;

[0033] Figure 2 This is an SDS-PAGE image used to verify the purification of the fish rhabdovirus binding protein of this invention. Detailed Implementation

[0034] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0035] Unless otherwise specified, all materials, reagents, and experimental equipment involved in the embodiments of this invention are commercially available products.

[0036] Example 1

[0037] A rhabdovirus-binding protein, with the following amino acid sequence (SEQ ID NO.1):

[0038] SKDELETPYMPEDNCDWATISDNEKTLKGGKCASTVGGGSIPSEAPRESCQLGSGGGGSGSAYSSEDVTGKIVDGGGGSNGNRMDNGTLRGGGGSSSNESDVLSAFRGGGGSLKKRKSQSTSQTTGGGGSGG GGSGGGGSSKDELETPYMPEDNCDWATISDNEKTLKGGKCASTVGGGSIPSEAPRESCQLGSGGGGSGSAYSSEDVTGKIVDGGGGSNGNRMDNGTLRGGGGSSSNESDVLSAFRGGGGSLKKRKSQSTSQTT

[0039] Gene sequence optimized for expression codons in E. coli (SEQ ID NO.2):

[0040] AGCAAAGATGAATTAGAAACCCCGTATATGCCGGAAGATAATTGTGATTGGGCCACCATCAGCGATAATGAAAAAACTCTGAAAGGTGGCAAATGTGCCAGCACCGTTGGTGGCGGCAGCATTCCGAGCGAAGCGCCGCGCGAAAGCTGCCAGCTGGGTTCCGGCGGCGGTGGCAGCGGCAGCGCCTATTCAAGCGAAGATGTTACCGGCAAAATTGTCGATGGCGGCGGCGGTAGCAACGGTAACCGCATGGATAATGGCACGCTGCGTGGCGGCGGCGGCAGCTCAAGCAACGAATCGGACGTTCTGAGCGCATTCCGTGGCGGCGGCGGTAGCCTGAAAAAACGTAAAAGTCAGTCTACCAGCCAGACCACCGGTGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCTCTAGTAAAGATGAACTGGAAACCCCGTATATGCCGGAAGATAACTGCGATTGGGCGACCATTAGCGATAATGAAAAAACCCTGAAAGGCGGCAAATGCGCGAGCACCGTGGGCGGCGGCAGCATTCCGAGCGAGGCGCCGCGTGAAAGCTGTCAGCTGGGAAGTGGCGGCGGCGGCTCTGGTAGCGCGTATAGCAGCGAAGATGTGACCGGTAAAATTGTGGATGGAGGCGGCGGCTCTAACGGTAATCGTATGGATAACGGCACCCTGCGCGGCGGCGGCGGCAGCAGCAGCAACGAAAGCGACGTACTGAGCGCGTTTCGTGGCGGCGGCGGCAGCCTGAAAAAACGCAAATCGCAGAGCACCTCACAGACCACCTAA

[0041] The preparation method of this fish rhabdovirus binding protein is as follows:

[0042] Based on the above gene sequence, restriction enzyme sites BamHI and HindIII were introduced. These sites were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and cloned into the corresponding restriction sites of the vector pET-30a(+) using BamHI and HindIII at both ends of the gene sequence. The clones were transformed into Escherichia coli Top10 clones using the heat shock method and grown on LB solid medium containing 50 μg / ml Kan+. Transformants containing the recombinant plasmid were screened by colony PCR and inoculated into LB liquid medium containing 50 μg / ml Kan+ at 37°C with shaking at 200 rpm for 14 hours. The recombinant plasmid was then extracted using a common plasmid extraction kit from Tiangen Biotech (Beijing) Co., Ltd.

[0043] The recombinant plasmid containing the target gene fragment was transformed into Escherichia coli BL21-DE3 competent cells using the heat shock method. The transformed cells were then plated on LB solid medium containing 50 μg / ml Kan+ and screened for BL21-DE3 transformants containing the recombinant plasmid.

[0044] A single colony of BL21-DE3 bacteria containing the recombinant plasmid, grown on a Kan+ resistant plate, was picked with a sterile toothpick and inoculated into 10 ml of LB liquid medium containing 50 μg / ml Kan+. The culture was incubated overnight at 37°C with shaking at 200 rpm. The next day, the bacterial culture was transferred to LB liquid medium containing 50 μg / ml Kan+ at a ratio of 1:100. When the OD600 value reached approximately 0.5-0.8 (about 3-4 hours), IPTG stock solution (100 mmol / L) was added at a ratio of 1:200, and the culture was continued for 5 hours to induce the expression of the target protein. The SDS-PAGE image verifying the induced expression of the fish rhabdovirus binding protein is shown below. Figure 1 As shown (where M: 180kDa color-stained pre-stained protein molecular weight standard; lane 1: un-IPTG induced bacterial culture; lanes 2-4: IPTG induced bacterial culture).

[0045] Purification of fish rhabdovirus-binding protein:

[0046] The *E. coli* fermentation broth expressing the recombinant protein was centrifuged at 5000 rpm for 8 minutes to collect the bacterial cells. The cells were resuspended in PBS (1 / 20 volume of fermentation broth) and homogenized using a high-pressure homogenizer. An appropriate protease inhibitor was added during homogenization to prevent protein degradation. The homogenized liquid mixture was centrifuged again at 13000 rpm, 4°C, for 10 minutes, and the precipitate was collected. The target protein (precipitate) was resuspended in PBS containing 0.1% Triton-X100 and 0.5M urea, and centrifuged at 10000 rpm after shaking at room temperature for 20 minutes. This washing process was repeated twice to remove most of the soluble impurities. The washed precipitate was dissolved in PBS containing 8M urea and shaken at room temperature for 30 minutes until the precipitate was completely dissolved and free of white particles. The precipitate was then centrifuged at 13000 rpm, 4°C to remove cell debris and unbroken cells. The supernatant was collected to obtain the purified protein. The purified fish rhabdovirus binding protein purification verification SDS-PAGE image is shown below. Figure 2 As shown (where M: 180kDa color-stained pre-stained protein molecular weight standard; lane 1: protein washing solution; lane 2: purified protein solution from collection 1; lane 3: purified protein solution from collection tube 2), the obtained purified protein was spray-dried and stored at 5°C for later use.

[0047] Example 2

[0048] This embodiment provides a premixed feed additive for preventing fish rhabdomyovirus:

[0049] Basic auxiliary materials (particle size 200 mesh): 2 parts calcium-based montmorillonite, 2 parts modified diatomaceous earth, 1 part water glass, 3 parts garlic powder, 5 parts broken cell wall yeast powder, 10 parts wheat bran, 2 parts mixed oil, 1 part salt, 10 parts fish meal, and 10 parts peanut residue.

[0050] Plant extract excipients (particle size 200 mesh): 1 part honeysuckle, 1 part honeysuckle vine, 1 part purslane, 1 part dandelion, 1 part forsythia, 1 part prunella vulgaris, 0.5 part dried tangerine peel, 0.5 part clove, 0.5 part cinnamon, and 1 part licorice.

[0051] One part of fish rhabdomyovirus binding protein, 360 parts of the above-mentioned basic excipients and 40 parts of the above-mentioned plant extract excipients were added to a mixer in sequence and mixed thoroughly to obtain a premixed feed additive for preventing fish rhabdomyovirus.

[0052] Example 3

[0053] Performance evaluation of fish rhabdovirus prevention:

[0054] Case 1:

[0055] Preparation method of feed coated with premixed feed additive for preventing fish rhabdomyovirus: Take 100g of the premixed feed additive for preventing fish rhabdomyovirus prepared in Example 2, add it to about 600ml of water, add it while stirring and mix it thoroughly until a suspension is completely formed, mix it thoroughly with 20kg of feed, and air dry it for more than 10 minutes to obtain feed uniformly coated with premixed feed additive for preventing fish rhabdomyovirus.

[0056] Fish rhabdomyovirus-binding protein feed preparation method: Take 0.25g of fish rhabdomyovirus-binding protein feed, add it to about 600ml of water, stir thoroughly, then mix it thoroughly with 20kg of feed, and air dry it naturally for more than 10 minutes to obtain fish rhabdomyovirus-binding protein feed.

[0057] Forty-five hundred fish infected with rhabdovirus (RAV) from the same pond, with a CT value of 32.45 and a body length of 8-12 cm, were collected and divided into three groups of 150 fish each, with three replicates of 50 fish per replicate. These fish were housed in nine aquariums using two recirculating water systems under identical conditions. Group 1 was fed a feed containing RAV conjugate protein once daily for five days, followed by a regular diet. Group 2 was fed a premixed feed additive for RAV prevention once daily for five days, followed by a regular diet. The control group was fed the same dose of regular feed daily. The number of surviving fish in each group was recorded for 14 days. After 14 days, five fish from each replicate were sampled for RAV testing. The results are shown in Tables 1 and 2.

[0058] Table 1. Survival rate statistics of experimental fish in each group

[0059]

[0060] Table 2 Virus Detection Results

[0061]

[0062] According to Tables 1 and 2, the average survival rate of the three parallel groups in Experimental Group 1 (feeding with feed mixed with fish rhabdovirus binding protein) was 57.3%, the average survival rate of the three parallel groups in Experimental Group 2 (feeding with feed coated with a premixed feed additive for preventing fish rhabdovirus) was 73.3%, and the average survival rate of the control group was only 32.0%. The surviving fish in Experimental Groups 1 and 2 tested negative for rhabdovirus, and their swimming behavior, body condition, and feeding were normal. However, the CT value of the surviving fish in the control group was 31.66, indicating that they were still infected with rhabdovirus. The experimental results show that fish rhabdovirus binding protein helps fish resist rhabdovirus infection, and the use of a premixed feed additive for preventing fish rhabdovirus infection can effectively prevent rhabdovirus infection and significantly improve the survival rate of fish in the early stages of rhabdovirus infection.

[0063] Case 2:

[0064] A snakehead fish fry farm, with a body length of approximately 5cm, selected two adjacent ponds, Pond A and Pond B, each containing approximately 400,000 fry. Before the experiment, more than 5,000 fry died daily. Pond A was selected as the experimental pond, and Pond B as the control pond. The experimental pond was fed feed coated with a premixed feed additive for preventing fish rhabditis virus for 7 consecutive days, once a day. The remaining time, the fish were fed ordinary feed. The control group was fed the same dose of ordinary feed daily. The fish were observed for 14 days, and the mortality statistics for each group were recorded. The results are shown in Table 3.

[0065] Table 3. Statistics on the number of fish deaths in the experimental and control groups.

[0066]

[0067] The experimental results showed that after the experimental group was fed premixed feed containing a preventative feed additive for fish rhabdomyovirus prevention for 7 consecutive days, the number of fish deaths decreased from over 5,000 per day before the experiment to 243, while the number of fish deaths in the control group (pond B) exceeded 5,000. By day 14 of the experiment, the number of fish deaths in the experimental pond had decreased to zero, and the rhabdomyovirus disease was effectively controlled, while the number of fish deaths in the control pond remained high at 4,520. The experimental results indicate that the premixed feed additive for preventing fish rhabdomyovirus can effectively alleviate the horizontal transmission of the virus among fish populations and reduce the loss rate of infected fish.

Claims

1. A fish rhabdovirus binding protein, characterized in that: The amino acid sequence of the fish rhabdovirus binding protein is shown in SEQ ID NO.

1.

2. A gene encoding the fish rhabdovirus binding protein of claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. A method for preparing the fish rhabdovirus binding protein according to claim 1, characterized in that: include: The coding gene was ligated into the vector Pet-30a(+) with BamHI and HindIII as restriction sites to obtain a recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli BL21-DE3, and the expression of the target protein was induced by IPTG. After purification, the fish rhabdovirus binding protein was obtained.

4. A premixed feed additive for preventing fish rhabdovirus, characterized in that: The product comprises, by weight, 1-3 parts of the fish rhabdovirus binding protein as described in claim 1, 350-360 parts of basic excipients, and 30-40 parts of plant extract excipients; The basic auxiliary materials include the following raw materials in parts by weight: 1-5 parts calcium-based montmorillonite, 1-3 parts modified diatomaceous earth, 0.1-1 parts water glass, 2-5 parts garlic powder, 2-10 parts broken cell wall yeast powder, 5-20 parts wheat bran, 2-5 parts mixed oil, 0.5-1 part salt, 5-20 parts fish meal, and 5-15 parts peanut residue; The plant extract excipients include the following raw materials in parts by weight: honeysuckle 0.1-1 part, honeysuckle vine 0.1-1 part, purslane 0.1-1 part, dandelion 0.1-1 part, forsythia 0.1-1 part, prunella vulgaris 0.1-1 part, dried tangerine peel 0.05-0.5 part, clove 0.05-0.5 part, cinnamon 0.05-0.5 part, and licorice 0.5-2 parts.

5. The premixed feed additive for preventing fish rhabdomyovirus as described in claim 4, characterized in that: The product comprises, by weight, 1 part of the fish rhabdovirus binding protein as described in claim 1, 360 parts of basic excipients, and 40 parts of plant extract excipients.

6. The method for preparing the premixed feed additive for preventing fish rhabdovirus as described in claim 4, characterized in that: Fish rhabdomyovirus binding protein, basic excipients and plant extract excipients are added to a mixer in sequence and thoroughly mixed to obtain a premixed feed additive for preventing fish rhabdomyovirus.

7. The use of the fish rhabdovirus binding protein as described in claim 1 or the premixed feed additive for preventing fish rhabdovirus infection as described in claim 4 in the preparation of feed for preventing fish rhabdovirus infection.

8. The application as described in claim 7, characterized in that: The premixed feed additive for preventing fish rhabdomyovirus is added to the feed for preventing fish rhabdomyovirus infection at a mass percentage of 0.1%-1%.

Images