PEDV S protein N-glycosylation site mutation virus and application thereof

Abstract

The invention discloses a PEDV (Porcine Epidemic Diarrhea Virus) S protein N-glycosylation site mutation virus and application thereof. According to the present invention, the influence of the N-glycosylation of the S protein on the virus immunogenicity is detected by using the mutant virus to immunize the mouse, and the result shows that the recombinant PEDV virus strain with the single-point mutation of the N216, N324 and N1261 glycosylation sites of the S protein can activate the mouse to produce the high-level neutralizing antibody, and the neutralizing antibody can be increased by 3.2 times (N216A), 6.7 times (N324A) and 3.2 times (N1261A); the recombinant PEDV virus strain with the mutated three sites can be used as a potential candidate strain of a PEDV inactivated vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and in particular relates to a PEDV S protein N-glycosylation site mutant virus and an application thereof. Background Art

[0002] Coronavirus belongs to the order Nidovirales, family Coronaviridae. The family Coronaviridae can be further divided into subfamily Orthocoronavirus and Letovirinae, and the subfamily Orthocoronavirus can be divided into genera Alphacoronavirus, Betacoronavirus, Deltacoronavirus and Gammacoronavirus. Coronavirus has a wide range of natural hosts, including mammals, birds and amphibians, causing respiratory, intestinal, liver and nervous system diseases, causing epidemics and threatening the health of humans and animals.

[0003] Porcine epidemic diarrhea (PED) is a serious intestinal disease caused by porcine epidemic diarrhea virus (PEDV), with the main symptoms of diarrhea, vomiting and dehydration. Newborn piglets are susceptible to PEDV, with a mortality rate of up to 100%. PEDV was first discovered in Europe in the 1970s. Since 2010, after the PEDV strain mutated, the highly pathogenic PEDV variant began to spread widely in pigs, causing huge economic losses to the global breeding industry. To date, PEDV is still the main pathogen causing viral diarrhea in pigs, and its harm should not be underestimated. Vaccination is one of the most important methods for preventing and controlling PED epidemics. Most of the conventional inactivated vaccines currently available have the advantages of high safety and simple production process. However, inactivated vaccines also have many disadvantages. During the preparation process, their immunogenicity may be reduced. At the same time, since inactivated vaccines cannot replicate in the host, they need to be improved by adding adjuvants, high immunization doses and multiple immunizations. In order to better prevent and control PED and ensure healthy pig farming, it is of great significance to improve the immunogenicity of PEDV inactivated vaccine.

[0004] Glycosylation is a post-translational modification of proteins, which refers to the process of attaching glycans to protein polypeptides. To date, a variety of glycosylation modifications have been reported, including N-, O- and C-glycosylation modifications, glycosylphosphatidylinositolization and phosphoglycosylation. Among them, N-glycosylation is the most common and most widely studied form of protein glycosylation, with a conserved amino acid motif of NXS / T (X is all amino acids except proline), and glycans will be attached to the amide nitrogen of aspartic acid (N) residues. The N-glycans of viral glycoproteins have multiple functions, including promoting protein expression, transport, fusion, binding to cell surface receptors, and preventing neutralization by antibodies. SARS-CoV 2S protein is highly N-glycosylated and contains 22 N-glycosylation modification sites, which play an important role in its pathogenicity and immunogenicity. Many studies have shown that PEDV S protein is a highly glycosylated protein that plays a vital role in the immunogenicity and pathogenicity of PEDV. Therefore, there is still an urgent need to study the effect of S protein N-glycosylation on the life cycle and immunogenicity of PEDV in order to obtain more potential candidate strains for PEDV inactivated vaccines. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide an S protein with a mutation in the N-glycosylation site.

[0006] The technical problem that the present invention needs to solve is to provide a nucleic acid molecule encoding the S protein with the N-glycosylation site mutation.

[0007] The technical problem that the present invention also aims to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium containing the nucleic acid molecule.

[0008] The technical problem that the present invention also aims to solve is to provide a recombinant PEDV infectious clone plasmid with a mutation in the N-glycosylation site of the S protein and a construction method thereof.

[0009] The technical problem that the present invention also aims to solve is to provide a virus with a mutation in the N-glycosylation site of the PEDV S protein and a method for rescuing the virus.

[0010] The technical problem that the present invention also aims to solve is to provide an S protein with a mutation in an N-glycosylation site, the nucleic acid molecule, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria, the recombinant PEDV infectious clone plasmid with a mutation in an N-glycosylation site of the S protein, or the PEDV S protein N-glycosylation site mutation virus for use in the preparation of a PEDV vaccine or a PEDV antibody.

[0011] The technical problem that the present invention also aims to solve is to provide a PEDV vaccine.

[0012] The final technical problem to be solved by the present invention is to provide a PEDV neutralizing antibody.

[0013] Technical solution: In order to solve the above technical problems, the present invention provides an S protein with a mutation in an N-glycosylation site, wherein the S protein with a mutation in an N-glycosylation site is mutated on a PEDV S protein, and aspartic acid is mutated to alanine at position 62, 118, 216, 264, 300, 324, 344, 351, 425, 514, 556, 667, 688, 726, 743, 781, 787, 873, 1009, 1196, 1232, 1249, 1261, 1273, 1278, 1295 or 1308 of the amino acid sequence of the PEDV S protein, and the amino acid sequence of the PEDV S protein is shown in SEQ ID NO.2.

[0014] A nucleic acid molecule encodes the S protein with a mutation in the N-glycosylation site, wherein the nucleic acid molecule is mutated in the full length of the PEDV S gene, and the nucleotide sequence of the full length of the PEDV S gene is shown in SEQ ID NO.1.

[0015] The specific mutations of the PEDV S gene include: nucleotides 186-187, nucleotides 354-355, nucleotides 648-649, nucleotides 792-793, nucleotides 900-901, nucleotides 1032-1033, nucleotides 1053-1054, nucleotides 2001-2002, nucleotides 2064-2065, nucleotides 2229-2230, nucleotides 2 Nucleotides 343-2344, 2619-2620, 3027-3028, 3588-3589, 3696-3697, 3783-3784, 3819-3820, 3834-3835 or 3885-3886 are mutated from AA to GC, and the PEDV The nucleotides at positions 972-974 of the S gene mutate from AAT to GCC, the nucleotides at positions 1275-1277 of the PEDV S gene mutate from AAT to GCG, and the nucleotides at positions 1542-1543, 1668-1669, 2178-2179, 2361-2362, 3747-3748 or 3924-3925 of the PEDV S gene mutate from AA to GC.

[0016] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium, which contains the nucleic acid molecule.

[0017] The present invention also includes a recombinant PEDV infectious clone plasmid with a mutation in the N-glycosylation site of the S protein. The recombinant PEDV infectious clone plasmid is obtained by introducing the nucleic acid molecule into a vector.

[0018] The present invention also includes a method for constructing a recombinant PEDV infectious clone plasmid with a mutation in the N-glycosylation site of the S protein, comprising the following steps:

[0019] (1) DNA fragment amplification: Amplify a DNA fragment of the PEDV S gene containing the following mutation sites, wherein the DNA fragment is located at nucleotides 186-187, nucleotides 354-355, nucleotides 648-649, nucleotides 792-793, nucleotides 900-901, nucleotides 1032-1033, nucleotides 1053-1054, nucleotides 2001-2002, nucleotides 2064-2065, nucleotides 2229-2230, nucleotides 2343-2344 of the PEDV S gene. The nucleotides at positions 2344, 2619-2620, 3027-3028, 3588-3589, 3696-3697, 3783-3784, 3819-3820, 3834-3835 or 3885-3886 are mutated from AA to GC, and the DNA fragment is in the PEDV The nucleotides at positions 972-974 of the S gene mutate from AAT to GCC, the nucleotides at positions 1275-1277 of the PEDV S gene of the DNA fragment mutate from AAT to GCG, the nucleotides at positions 1542-1543 of the PEDV S gene of the DNA fragment, the nucleotides at positions 1668-1669 of the S gene of the DNA fragment, the nucleotides at positions 2178-2179 of the S gene of the DNA fragment, the nucleotides at positions 2361-2362 of the S gene of the DNA fragment, the nucleotides at positions 3747-3748 or the nucleotides at positions 3924-3925 of the S gene of the DNA fragment mutate from AA to GC;

[0020] (2) Amplification of the target fragment: using the DNA fragment of step (1) as a template to amplify the first part of the target fragment and the second part of the target fragment, and then amplify the middle fragment, and finally connect the three fragments to obtain the target fragment;

[0021] (3) The first step is Red recombination: transform the targeting fragment into competent cells and verify the positive clones;

[0022] (4) The second step is Red recombination: positive clones are selected for temperature and L-arabinose induction, and finally the final positive clones are further obtained through antibiotic screening.

[0023] The present invention also includes a PEDV S protein N-glycosylation site mutant virus, wherein the PEDV S protein N-glycosylation site mutant virus is obtained by transfecting cells with the recombinant PEDV infectious clone plasmid.

[0024] The present invention also includes a method for rescuing the virus with N-glycosylation site mutation of PEDV S protein, comprising the following steps: co-transfecting cells with the infectious clone plasmid and the helper plasmid.

[0025] The present invention also includes the use of the S protein with N-glycosylation site mutation, the nucleic acid molecule, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria, the recombinant PEDV infectious clone plasmid with S protein N-glycosylation site mutation or the PEDV S protein N-glycosylation site mutation virus in the preparation of PEDV vaccine or PEDV antibody.

[0026] The present invention also includes a PEDV vaccine, which contains the S protein with N-glycosylation site mutation, the nucleic acid molecule, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria, the recombinant PEDV infectious clone plasmid with S protein N-glycosylation site mutation or the PEDV S protein N-glycosylation site mutation virus.

[0027] The present invention also includes a PEDV neutralizing antibody, which is obtained by infecting animals with the PEDV S protein N-glycosylation site mutant virus.

[0028] In order to study the effect of N-glycosylation of S protein on the life cycle and immunogenicity of PEDV, the present invention firstly predicted the N-glycosylation modification sites of PEDV GX4 / 2021S protein using the online tool NetNGlyc-1.0. There are 27 potential N-glycosylation modification sites in the S protein of GX4 / 2021 strain. The Red recombination technology was used to construct 27 N-glycosylation single-point mutation PEDV infectious clone plasmids and rescue the virus. The results showed that the 873-position N-glycosylation site was crucial for the rescue of the virus. Finally, the effect of S protein N-glycosylation on the immunogenicity of the virus was explored, and the most comprehensive PEDV S protein N-glycosylation site single-point mutation virus library was successfully obtained.

[0029] Beneficial effects: The present invention immunized mice with mutant viruses to detect the effect of N-glycosylation on viral immunogenicity. The results showed that recombinant PEDV virus strains with mutations in the glycosylation sites N216, N324, and N1261 of the S protein can activate mice to produce higher levels of neutralizing antibodies, which can be increased by 3.2 times (N216A), 6.7 times (N324A), and 3.2 times (N1261A). The recombinant PEDV virus strains with mutations in these three sites can be used as potential PEDV inactivated vaccine candidates. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The N-glycosylation site prediction results of PEDV GX4 / 2021S protein;

[0031] Figure 2 homology modeling of the PEDV GX4 / 2021S protein;

[0032] Figure 3 The results of Sanger sequencing of the infectious clone plasmid with mutation of the N-glycosylation site of PEDV S protein;

[0033] Figure 4 It is the cytopathic effect of PEDV recombinant virus;

[0034] Figure 5 For IFA identification of PEDV recombinant viruses;

[0035] Figure 6 Western blot identification of PEDV recombinant virus;

[0036] Figure 7 TCID50 determination for PEDV recombinant virus;

[0037] Figure 8 For the identification of adsorption, invasion and release of recombinant PEDV;

[0038] Fig. 9 For the determination of neutralizing antibodies in mouse serum. DETAILED DESCRIPTION

[0039] The present invention will be further described below in conjunction with the accompanying drawings and specific implementation methods.

[0040] 1. Experimental Materials

[0041] PEDV virus strain PEDV GX4 / 2021 (GenBank accession number: OP382083) was isolated, purified and stored by this laboratory. Vero cells, pET30a, pBAC-PEDV, E. coli GS1783-pBAC-PEDV GX4 / 2021 strain, and pCAGGS-PEDV N were stored by this laboratory. (The above plasmids and strains were published in Chinese Patent Publication No. CN116445528A Construction Method of Recombinant Porcine Epidemic Diarrhea Virus Infectious Clone and Its Infectious Clone and Application) Anti-PEDV-N monoclonal antibody and anti-PEDV-S monoclonal antibody were prepared and stored by this laboratory. Sheep anti-mouse IgG (H+L)-HRP and anti-GAPDH monoclonal antibody were purchased from Wuhan ABclonal Company; ECL luminescent liquid was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd. 6-8 week old BALB / c female mice were purchased from the Experimental Animal Center of Yangzhou University Comparative Medical College.

[0042] 2. Analysis of N-glycosylation modification sites of PEDV GX4 / 2021S protein

[0043] The online tool NetNGlyc-1.0 (https: / / services.healthtech.dtu.dk / services / NetNGlyc-1.0 / ) was used to predict the N-glycosylation modification sites of PEDV GX4 / 2021S protein. The results showed that the GX4 / 2021 strain S protein had a total of 27 potential N-glycosylation modification sites, with 15 N-glycosylation sites in the S1 region and 12 N-glycosylation sites in the S2 region ( Figure 1 ). The distribution of N-glycosylation sites in the S1 region is as follows: the D0 domain contains 3 N-glycosylation sites, the NTD domain contains 6 N-glycosylation sites, the SD1 domain does not contain predicted N-glycosylation sites, the CTD domain contains 2 N-glycosylation sites, and the SD2 domain contains 4 N-glycosylation sites.

[0044] 3. Homology modeling of PEDV GX4 / 2021S protein

[0045] The online tool SWISS-MODEl (https: / / swissmodel.expasy.org / ) was used to perform homology modeling on the PEDV GX4 / 2021S protein trimer. The protein model used was the PEDV Pintung 52S protein, and its PDB number was: 7w6m. Finally, the N-glycosylation sites were annotated. The results showed that 22 predicted N-glycosylation sites were located on the surface of the S protein trimer. Among them, the N-glycosylation sites located in the S1 region are all exposed to the surface of the S protein trimer. Due to the function of the S2 subunit and the correct folding of the S protein, the N-glycosylation site located near the HR2-TM region is located inside the S protein, and the remaining N-glycosylation sites are all located on the surface of the S protein ( Figure 2 ).

[0046] 4. Construction of recombinant viral plasmid with mutation of N-glycosylation site of PEDV S protein

[0047] According to the prediction results of the N-glycosylation site of the S protein, a single-point mutation PEDV GX4 / 2021 recombinant virus plasmid was constructed. The rule for the mutation of the N-glycosylation site was as follows: aspartic acid (Asn, N) in the Asn-X-Ser / Thr (X is any amino acid except proline) motif was mutated to alanine (Ala, A). The primer sequences are shown in Table 1.

[0048] Table 1 Primers for mutation of N-glycosylation site of PEDV S gene

[0049]

[0050]

[0051]

[0052] Red recombination technology was used to mutate individual N-glycosylation sites, where PE-nsp16 F1, PE-S-cR2, I-SceI-CAT F1, and CATpro-Kan R were universal primers. Taking the construction process of the recombinant virus infectious clone plasmid pBAC-PEDV GX4 / 2021-S-N62A in which the aspartic acid at position 62 of the S gene was mutated to alanine as an example, the specific steps are as follows:

[0053] (1) Amplification of DNA fragment S-N62A. Using pBAC-PEDV as template 1, using the reaction system in Table 2, using primer pair PE-nsp16 F1 and PE-SN62AR1 to amplify fragment S-N62A-F, using the reaction system in Table 2, using primer pair PE-SN62A F1 and PE-Sc R2 to amplify fragment S-N62A-R; using fragment S-N62A-F and fragment S-N62A-R as template 2 and template 3, using the reaction system in Table 3, using primer pair PE-nsp16 F1 and PE-Sc R2 to amplify fragment S-N62A by overlap PCR. All PCR reactions were performed according to the conditions in Table 5.

[0054] Table 2 PCR reaction system

[0055]

[0056]

[0057] Table 3 PCR reaction system

[0058] <![CDATA[ddH2O]]> Make up to 50 μL Upstream primer 1μL Downstream primer 1μL Template 2 1μL Template 3 1μL PrimeSTAR Max Premix (2X) 25μL

[0059] Table 4

[0060] <![CDATA[ddH2O]]> Make up to 50 μL Upstream primer 1μL Downstream primer 1μL Template 5 1μL Template 6 1μL Template 7 1μL PrimeSTAR Max Premix (2X) 25μL

[0061] Table 5 PCR amplification conditions

[0062]

[0063] (2) Amplification of the target fragment bS-N62A-Kan-c. Using fragment S-N62A as template 4, the reaction system in Table 2 was used, and the primer pair PE-nsp16 F1 and PE-S N62AR2 were used to amplify the first part of the target fragment bS-N62A, and the primer pair PE-S N62A F2 and PE-Sc R2 were used to amplify the second part of the target fragment S-N62A-c. Using pET30a as a template, the primer pair I-SceI-CAT F1 and CATpro-Kan R were used to amplify the middle part of the target fragment Kan. Using fragment bS-N62A, fragment Kan and S-N62A-c as templates 5, template 6 and template 7, the reaction system was configured according to the PCR reaction system in Table 4, and the primer pair PE-nsp16 F1 and PE-Sc R2 were used to amplify the target fragment bS-N62A-Kan-c by three-fragment overlap PCR. All PCR reactions were performed according to the conditions in Table 5.

[0064] (3) First step Red recombination. The target fragment bS-N62A-Kan-c was transformed into GS1783-pBAC-PEDV GX4 / 2021 competent cells by electroporation, and the competent cells were spread on LB plates containing chloramphenicol and kanamycin dual resistance and cultured at 32°C for 24 h for the first step Red recombination.

[0065] (4) Pick a single colony on the plate, use primers PE-nsp16 F1 and PE-Sc R2 for colony PCR identification, streak the positive colony identified correctly on a plate containing Kanana resistance, and incubate at 32°C for 16 h. Use primers PE-nsp16 F1 and PE-Sc R2 for colony PCR identification again, and name the purified positive colony pBAC-PEDV GX4 / 2021-S-N62A-Kan.

[0066] (5) Step 2: Red recombination. A single positive bacterial colony was selected and inoculated into 2 mL of LB liquid medium containing chloramphenicol resistance, and cultured in a shaking incubator at 32°C until turbidity occurred. 2 mL of LB liquid medium containing 2% L-arabinose and chloramphenicol resistance was added thereto, and cultured for 1 h, and then cultured in a shaking incubator at 42°C for 30 min, and then transferred to a shaking incubator at 32°C for further 3 h.

[0067] (6) Take 100 μL of bacterial solution and do 10 4 Dilution was performed by 200 μL dilution, and 200 μL of the diluted bacterial solution was spread on an LB plate containing 1% L-arabinose and chloramphenicol resistance. After the bacterial solution was fully absorbed, it was inverted and cultured in a 32°C bacterial incubator for about 24 h.

[0068] (7) Pick the single colonies obtained in step (6) and apply them to LB plates containing chloramphenicol resistance and kanamycin resistance respectively. The colonies that do not grow in kanamycin resistance LB solid medium and grow in chloramphenicol LB solid medium are colonies with successful recombination, and the obtained positive clones are named pBAC-PEDV GX4 / 2021-S-N62A, and the successful construction of the recombinant plasmid is verified by DNA sequencing.

[0069] The mutation process of other sites is basically the same as that of the 62nd amino acid site of the S protein, the difference lies in the replacement of the mutation primer:

[0070] For example: Construction of pBAC-PEDV GX4 / 2021-S-N216A: The primers used are PE-S N216AF1, PE-SN216AR1, PE-S N216AR2 and PE-S N216AF2. The specific steps are: using pBAC-PEDV as template 1, using the reaction system in Table 2, using primer pair PE-nsp16 F1 and PE-S N216A R1 to amplify fragment S-N216A-F, using the reaction system in Table 2, using primer pair PE-S N216AF1 and PE-Sc R2 to amplify fragment S-N216A-R; using fragment S-N216A-F and fragment S-N216A-R as template 2 and template 3, using the reaction system in Table 3, using primer pair PE-nsp16 F1 and PE-Sc R2 to amplify fragment S-N216A by overlap PCR. All PCR reactions were performed according to the conditions in Table 5. Amplification of the target fragment bS-N216A-Kan-c. Using fragment S-N216A as template 4, the reaction system in Table 2 was used, and the primer pair PE-nsp16F1 and PE-S N216A R2 were used to amplify the first part of the target fragment bS-N216A, the primer pair PE-S N216A F2 and PE-Sc R2 were used to amplify the second part of the target fragment S-N216A-c, and pET30a was used as a template, and the primer pair I-SceI-CAT F1 and CATpro-Kan R were used to amplify the middle part of the target fragment Kan. The fragments bS-N216A, Kan and S-N216A-c were used as templates 5, 6 and 7, and the reaction system was configured according to the PCR reaction system in Table 4. The primer pairs PE-nsp16 F1 and PE-Sc R2 were used to amplify the target fragment bS-N216A-Kan-c by three-fragment overlap PCR. All PCR reaction processes were performed according to the conditions in Table 5.

[0071] The construction methods of other recombinant plasmids were the same as above.

[0072] Construction of pBAC-PEDV GX4 / 2021-S-N118A: The primers used were PE-S N118A F1, PE-S N118A R1, PE-S N118A R2 and PE-S N118A F2.

[0073] Construction of pBAC-PEDV GX4 / 2021-S-N264A: The primers used were PE-S N264A F1, PE-S N264A R1, PE-S N264A R2 and PE-S N264A F2.

[0074] Construction of pBAC-PEDV GX4 / 2021-S-N300A: The primers used were PE-S N300A F1, PE-S N300A R1, PE-S N300A R2 and PE-S N300A F2.

[0075] Construction of pBAC-PEDV GX4 / 2021-S-N324A: The primers used were PE-S N324A F1, PE-S N324A R1, PE-S N324A R2 and PE-S N324A F2.

[0076] Construction of pBAC-PEDV GX4 / 2021-S-N344A: The primers used were PE-S N344A F1, PE-S N344A R1, PE-S N344A R2 and PE-S N344A F2.

[0077] Construction of pBAC-PEDV GX4 / 2021-S-N351A: The primers used were PE-S N351A F1, PE-S N351A R1, PE-S N351A R2 and PE-S N351A F2.

[0078] Construction of pBAC-PEDV GX4 / 2021-S-N425A: The primers used were PE-S N425AF1, PE-SN425AR1, PE-S N425A R2 and PE-S N425A F2.

[0079] Construction of pBAC-PEDV GX4 / 2021-S-N514A: The primers used were PE-S N514A F1, PE-S N514A R1, PE-S N514A R2 and PE-S N514A F2.

[0080] Construction of pBAC-PEDV GX4 / 2021-S-N556A: The primers used were PE-S N556A F1, PE-S N556A R1, PE-S N556A R2 and PE-S N556A F2.

[0081] Construction of pBAC-PEDV GX4 / 2021-S-N667A: The primers used were PE-S N667AF1, PE-SN667AR1, PE-S N667AR2 and PE-S N667A F2.

[0082] Construction of pBAC-PEDV GX4 / 2021-S-N688A: The primers used were PE-S N688A F1, PE-S N688A R1, PE-S N688A R2 and PE-S N688A F2.

[0083] Construction of pBAC-PEDV GX4 / 2021-S-N726A: The primers used were PE-S N726A F1, PE-S N726A R1, PE-S N726A R2 and PE-S N726A F2.

[0084] Construction of pBAC-PEDV GX4 / 2021-S-N743A: The primers used were PE-S N743A F1, PE-S N743A R1, PE-S N743A R2 and PE-S N743A F2.

[0085] Construction of pBAC-PEDV GX4 / 2021-S-N781A: The primers used were PE-S N781A F1, PE-S N781A R1, PE-S N781A R2 and PE-S N781A F2.

[0086] Construction of pBAC-PEDV GX4 / 2021-S-N787A: The primers used were PE-S N787A F1, PE-S N787AR1, PE-S N787AR2 and PE-S N787A F2.

[0087] Construction of pBAC-PEDV GX4 / 2021-S-N873A: The primers used were PE-S N873A F1, PE-S N873A R1, PE-S N873A R2 and PE-S N873A F2.

[0088] Construction of pBAC-PEDV GX4 / 2021-S-N1009A: The primers used were PE-S N1009A F1, PE-SN1009AR1, PE-S N1009AR2 and PE-S N1009AF2.

[0089] Construction of pBAC-PEDV GX4 / 2021-S-N1196A: The primers used were PE-S N1196AF1, PE-SN1196AR1, PE-S N1196A R2 and PE-S N1196A F2.

[0090] Construction of pBAC-PEDV GX4 / 2021-S-N1232A: The primers used were PE-S N1232AF1, PE-SN1232AR1, PE-S N1232A R2 and PE-S N1232A F2.

[0091] Construction of pBAC-PEDV GX4 / 2021-S-N1249A: The primers used were PE-S N1249A F1, PE-S N1249A R1, PE-S N1249A R2 and PE-S N1249A F2.

[0092] Construction of pBAC-PEDV GX4 / 2021-S-N1261A: The primers used were PE-S N1261A F1, PE-S N1261A R1, PE-S N1261A R2 and PE-S N1261A F2.

[0093] Construction of pBAC-PEDV GX4 / 2021-S-N1273A: The primers used were PE-S N1273A F1, PE-S N1273A R1, PE-S N1273A R2 and PE-S N1273A F2.

[0094] Construction of pBAC-PEDV GX4 / 2021-S-N1278A: The primers used were PE-S N1278AF1, PE-SN1278AR1, PE-S N1278AR2 and PE-S N1278A F2.

[0095] Construction of pBAC-PEDV GX4 / 2021-S-N1295A: The primers used were PE-S N1295AF1, PE-SN1295AR1, PE-S N1295AR2 and PE-S N1295A F2.

[0096] Construction of pBAC-PEDV GX4 / 2021-S-N1308A: The primers used were PE-S N1308AF1, PE-S N1308A R1, PE-S N1308A R2 and PE-S N1308A F2.

[0097] The constructed recombinant plasmid was subjected to Sanger sequencing. Figure 3 As shown, the plasmids of 27 S protein N-glycosylation sites constructed by the present invention were successfully constructed.

[0098] 5. Rescue of PEDV mutant viruses

[0099] (1) After the 27 positive colonies of the PEDV infectious clone plasmids containing single-point mutations in the N-glycosylation site of the S protein obtained above were expanded and cultured, the plasmids were extracted using a plasmid extraction kit.

[0100] (2) Evenly spread the Vero cells in good growth state into a 6-well plate. When the cell density reaches 70%-80%, Transfection was performed according to the 3000 reagent instructions.

[0101] (3) The amount of plasmids used in each well is: 0.2 μg of auxiliary plasmid pCAGGS-PEDV-N, 1.8 μg of PEDV infectious clone plasmid with mutation of S protein N-glycosylation site. Use wild-type PEDV infectious clone plasmid (pBAC-PEDV) as a positive control. After 4-6 hours of transfection, replace the cell culture medium with fresh DMEM medium containing 10% FBS, and after 24 hours of transfection, discard the cell culture supernatant, wash the cell monolayer twice with sterile PBS buffer (0.01M, pH=7.2), and add 2 mL of DMEM medium containing 2 μg / mL trypsin. After 2 days, collect the cell supernatant and infect fresh Vero cells again.

[0102] (4) When typical nuclear and cytoplasmic lesions appear in the cells, the recombinant virus is considered to have been successfully rescued and marked as the P0 generation. The rescued virus is continuously passaged in Vero cells, and each generation of virus fluid is labeled and stored at -80°C.

[0103] like Figure 4 As shown, the PEDV recombinant virus with a mutation at the N873 site of the S protein did not show typical nuclear and somatic lesions when infecting Vero cells, and the recombination rescue failed. The remaining 26 viruses with single-point mutations at the N-glycosylation sites all showed typical nuclear and somatic lesions after infecting Vero cells, indicating that these 26 recombinant viruses were successfully rescued.

[0104] 6. Identification of recombinant viruses

[0105] 6.1 Indirect immunofluorescence identification

[0106] Vero cells were infected with the parental virus rGX4 / 2021 and the S protein N-glycosylation site mutant virus, respectively. The cells were fixed for 24 hours and detected using a monoclonal antibody against the PEDV-N protein. The specific steps are as follows:

[0107] (1) Vero cells in good growth condition were evenly spread into a 12-well plate. When the cell density reached 90%, the cell monolayer was washed twice with sterilized PBS buffer (0.01 M, pH = 7.2), 300 μL of P0 generation rescue virus solution was inoculated into the cell monolayer, and a well without virus solution was set. After incubation for 2 h in a 37°C, 5% CO2 constant temperature incubator, the supernatant was discarded, and DMEM medium containing 2 μg / mL pancreatin was added. The culture was continued for 24 h, and the cell culture supernatant was collected and marked as P1 generation.

[0108] (2) The cell monolayer was washed once with PBS, fixed with pre-cooled 4% paraformaldehyde at room temperature for 10 min, and washed twice with PBS.

[0109] (3) Add pre-cooled PBS solution containing 0.1% TritonX-100 and 2% BSA, permeabilize and block the membrane at room temperature for 30 minutes, and wash twice with PBS.

[0110] (4) Add 1:2000 diluted anti-PEDV-N monoclonal antibody, incubate at 37°C for 1 h, and wash three times with PBS.

[0111] (5) Add 1:2000 diluted DyLight 488-labeled goat anti-mouse IgG secondary antibody, incubate at 37°C in the dark for 1 h, and wash three times with PBS.

[0112] (6) Add 1:10 diluted DAPI staining solution, incubate at room temperature for 5 min, wash three times with PBS, add appropriate amount of PBS, observe and photograph under an inverted fluorescence microscope.

[0113] like Figure 5 As shown, in addition to the rGX4 / 2021-S-N873A infected cell group, another 26 PEDV recombinant viruses with mutations in the N-glycosylation sites of the S protein had green fluorescence, indicating that 26 PEDV mutant viruses were successfully rescued.

[0114] 6.2 Western blot identification of recombinant viruses

[0115] (1) Vero cells were plated in 12-well plates in advance and cultured until the cell density reached 90%.

[0116] (2) The parental virus rGX4 / 2021 and the 26 successfully rescued PEDV mutant viruses were infected with Vero cells at an MOI of 0.01 for 24 h. The virus-uninfected group was set as a negative control.

[0117] (3) Discard the culture supernatant, wash twice with PBS buffer, add 150 μL of RIPA lysis buffer to each well, and collect protein samples.

[0118] (4) The collected protein samples were subjected to western blot identification. The primary antibodies used were anti-PEDV N protein monoclonal antibody and anti-PEDV S protein monoclonal antibody, and the secondary antibody used was goat anti-mouse IgG (H+L)-HRP.

[0119] The results are as follows Figure 6 As shown, the expression of N protein and S protein can be detected in both virus-infected groups, indicating that the mutation of the N-glycosylation site of S protein does not affect the expression of S protein.

[0120] 6.3 TCID of recombinant virus 50 Determination of

[0121] The successfully rescued virus was used to infect Vero cells for 24 h, and the supernatant was collected and analyzed by TCID 50 Determination of Figure 7 As shown, after mutations at different N-glycosylation sites of the S protein, the TCID 50 The N-glycosylation site mutations in the S1 subunit had significant effects on the TCID of PEDV. 50 The TCID of the parent virus rGX / 2021 50 In comparison, after the N351 site mutation, the TCID 50 It can be reduced by 3000 times. After the N216 site mutation, the TCID of the recombinant virus 50 It can be reduced by 1000 times. After mutation of N264, N324, and N688 sites, the TCID of the recombinant virus 50 The TCID50 of the recombinant virus decreased by 100 times after mutations at N118 and N425. In the S2 subunit, the N787 mutation had an effect on the TCID50 of the recombinant virus. 50 The biggest impact was a 15-fold decrease. After mutations at N726, N1249, N1261, N1273, N1278, and N1308, the TCID 50 About 5 to 10 times lower.

[0122] 7. Characterization of PEDV S protein N-glycosylation site mutant viruses

[0123] 7.1 Virus adsorption test

[0124] (1) Vero cells were evenly plated in a 24-well plate. When the cell density reached 90%, the cell culture medium was discarded and the cells were washed twice with PBS buffer.

[0125] (2) The recombinant PEDV virus with mutations in the N-glycosylation site of the S1 region (PEDV recombinant virus with mutations in aspartic acid at position 62, 118, 216, 264, 300, 324, 344, 425, 514, 556, 667, 688 or 743 of the S protein) was diluted with DMEM medium (company: Gibco, catalog number: 11965092) containing 2 μg / mL trypsin and added to the cell monolayer and incubated at 4°C for 1 h.

[0126] (3) Remove the cells, discard the supernatant, wash the cells twice with pre-cooled PBS buffer, and collect the cell sample.

[0127] (4) According to the RNA-easy extraction kit of Novozyme and the instructions, total cell RNA was extracted and then reverse transcribed to obtain cDNA. According to the instructions of the qPCR kit (Cat. No.: 11201ES08) of Yisheng Biotechnology, relative fluorescence quantitative PCR was used to detect the effect of PEDV GX4 / 2021 after removal of N-glycosylation on its adsorption efficiency. The content of PEDV in cells was detected by PEDV-N gene, GAPDH was a housekeeping gene, and the quantitative PCR primers were shown in Table 6.

[0128] Table 6 Quantitative PCR primers

[0129] Primer name Primer sequence (5'-3') q-PEDV-N F CCGTGGTGAGCGAATTGAAC q-PEDV-N R TCAGACGCCTTTCTGACACC q-monkey-GAPDH F TCGGAGTCAACGGATTTGGT q-monkey-GAPDH R AACCTGGGGGAATACGCAAG

[0130] 7.2 Virus invasion test

[0131] (1) After the virus adsorption test is completed, the cell plate is removed, the supernatant is discarded, and the cells are washed twice with pre-cooled PBS buffer and coronavirus culture medium is added.

[0132] (2) Place the cell plate in a 37°C cell culture incubator and let it stand for 1 hour.

[0133] (3) Remove the cell plate, knock off the supernatant, wash the cells twice with pre-cooled PBS buffer, and collect the cell sample.

[0134] (4) Same as step (4) in 7.1.

[0135] 7.3 Virus Replication

[0136] The mutant virus with mutation of N-glycosylation site in S1 region was inoculated into Vero cells and ST cells at MOI=0.01, and the virus solution was collected after 24 hours for TCID 50 Determination of.

[0137] Previous experimental results show that PEDV S protein has N-glycosylation modification, and this N-glycosylation modification affects virus rescue and virus titer. In order to explore the stage of the virus life cycle affected by these N-glycosylation site mutations, we conducted relevant experiments on the effects of S1 subunit N-glycosylation site mutations on the adsorption, invasion and release stages of the virus. For the invasion stage of the virus, in Vero cells, mutations in the N514, N556 sites in the CTD region and the N688 sites in the SD2 region significantly inhibited the adsorption efficiency of the recombinant virus ( Figure 8 A) In ST cells, mutations at N556, N688, N726, N743, and N216 inhibited the virus's adsorption efficiency to ST cells ( Figure 8 D) During the virus invasion stage, mutations at N514, N556, and N688 sites significantly inhibited the virus from invading Vero cells ( Figure 8 B), mutations at N556, N688, N324, N300, and N216 sites inhibit virus invasion of ST cells ( Figure 8 E). After the virus invades the cell, it uses the cell's nutrients to complete its own proliferation. Whether in Vero cells or ST cells, mutations in the N216, N324, N514, and N688 sites significantly inhibit the replication of the virus in the cell ( Figure 8 C and 8F).

[0138] 8. Animal testing

[0139] 8.1 Immunization of mice

[0140] In order to explore the effect of N-glycosylation modification of S protein on viral immunogenicity, the characteristics of mutant viruses and the highest TCID that can be amplified were comprehensively considered. 50 We selected five PEDV S protein N-glycosylation site mutant viruses (rGX4 / 2021-S-N118A, rGX4 / 2021-S-N216A, rGX4 / 2021-S-N324A, rGX4 / 2021-S-N1009A, rGX4 / 2021-S-N1261A) and immunized mice 2 weeks apart each time according to the experimental scheme in Table 7. RGX4 / 2021 immunized mice served as the positive control group. Ten days after the fourth immunization, blood was collected to detect antibody titers.

[0141] Table 7 Experimental design of immunizing mice with PEDV S protein N-glycosylation site mutant virus

[0142]

[0143] 8.2 Determination of neutralizing antibodies in mouse serum

[0144] (1) Vero cells were plated into a 96-well plate one day in advance, and the experiment was performed when the cell density reached 90%.

[0145] (2) The serum after the fourth immunization was inactivated at 56°C for 30 min and filtered using a 0.22 μm filter in a clean bench.

[0146] (3) The serum was diluted 2-fold with DMEM medium. 250 μL of diluted antibody and 250 μL of diluted PEDV GX4 / 2021 virus solution (100 TCID 50 / 100 μL) and mix thoroughly, and incubate at 37°C for 1 h.

[0147] (4) After the incubation, discard the culture medium in the 96-well plate, take 100 μL of serum-virus mixture and add it to the cell wells. Make 4 parallels for each dilution, and set up a positive control well (add only 100 TCID 50 Virus solution) and negative control wells (only DMEM medium) were added and incubated in a 5% CO2, 37°C incubator for 1 h.

[0148] (5) After the reaction is completed, discard the supernatant, wash twice with PBS, add 100 μL of coronavirus culture medium containing 2 μg / mL trypsin to the cell wells, continue to culture for 48 hours, and calculate the neutralizing titer of the immunized mouse serum. The calculation formula is: lg (neutralizing antibody titer) = L + d (S-0.5). (L: logarithm of the highest serum dilution; d: group distance, that is, dilution coefficient, which is -0.3 in a 2-fold serial dilution; S: the sum of the ratios of the number of CPE wells to the number of inoculated wells in each group.)

[0149] We used virus neutralization assay to detect the level of neutralizing antibodies against PEDV in the sera of immunized mice. Fig. 9 As shown, mice in the DMEM immunization group could not produce neutralizing antibodies against PEDV, and mice immunized with rGX4 / 2021 produced neutralizing antibodies against PEDV with a titer of 2 3.4 The mutations at N216, N324, and N1261 can significantly enhance the production of neutralizing antibodies against PEDV in PEDV-induced mice. The neutralizing antibody titers against PEDV produced by mice immunized with rGX4 / 2021-S-N216A, rGX4 / 2021-S-N324A, and rGX4 / 2021-S-N1261A were 2 5 , 2 6 , 2 5 , the neutralizing antibody titer increased by 3.2 times, 6.7 times, and 3.2 times, respectively.

[0150] SEQ ID NO.1:

[0151]

[0152]

[0153] SEQ ID NO.2:

[0154]

[0155]

Claims

1. An S protein with a mutation in an N-glycosylation site, characterized in that: The S protein with a mutation in the N-glycosylation site is mutated on the PEDV S protein, and the 62nd, 118th, 216th, 264th, 300th, 324th, 344th, 351st, 425th, 514th, 556th, 667th, 688th, 726th, 743th, 781st, 787th, 873th, 1009th, 1196th, 1232th, 1249th, 1261st, 1273th, 1278th, 1295th or 1308th position of the amino acid sequence of the PEDV S protein is mutated from aspartic acid to alanine, and the amino acid sequence of the PEDV S protein is shown in SEQ ID NO.

2.

2. A nucleic acid molecule, characterized in that It encodes the S protein with N-glycosylation site mutation according to claim 1, the nucleic acid molecule mutates in the full length of the PEDV S gene, and the nucleotide sequence of the full length of the PEDV S gene is shown in SEQ ID NO.1; preferably, the mutations in the PEDV S gene include: nucleotides 186-187, nucleotides 354-355, nucleotides 648-649, nucleotides 792-793, nucleotides 900-901, nucleotides 1032-1033, nucleotides 1053-1054, nucleotides 2001-2002, nucleotides 2064-2065, nucleotides 2229-2230, nucleotides 2 Nucleotides 343-2344, 2619-2620, 3027-3028, 3588-3589, 3696-3697, 3783-3784, 3819-3820, 3834-3835 or 3885-3886 are mutated from AA to GC, and the PEDV The nucleotides at positions 972-974 of the S gene mutate from AAT to GCC, the nucleotides at positions 1275-1277 of the PEDV S gene mutate from AAT to GCG, and the nucleotides at positions 1542-1543, 1668-1669, 2178-2179, 2361-2362, 3747-3748 or 3924-3925 of the PEDV S gene mutate from AA to GC.

3. An expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium, characterized in that: It contains the nucleic acid molecule according to claim 2.

4. A recombinant PEDV infectious clone plasmid with a mutation in the N-glycosylation site of the S protein, characterized in that: The recombinant PEDV infectious clone plasmid is obtained by introducing the nucleic acid molecule according to claim 2 into a vector.

5. The method for constructing a recombinant PEDV infectious clone plasmid with a mutation in the N-glycosylation site of the S protein according to claim 4, characterized in that: The following steps are involved: (1) DNA fragment amplification: Amplify a DNA fragment of the PEDV S gene containing the following mutation sites, wherein the DNA fragment is located at nucleotides 186-187, nucleotides 354-355, nucleotides 648-649, nucleotides 792-793, nucleotides 900-901, nucleotides 1032-1033, nucleotides 1053-1054, nucleotides 2001-2002, nucleotides 2064-2065, nucleotides 2229-2230, nucleotides 2343-2344 of the PEDV S gene. The nucleotides at positions 2344, 2619-2620, 3027-3028, 3588-3589, 3696-3697, 3783-3784, 3819-3820, 3834-3835 or 3885-3886 are mutated from AA to GC, and the DNA fragment is in the PEDV The nucleotides at positions 972-974 of the S gene mutate from AAT to GCC, the nucleotides at positions 1275-1277 of the PEDV S gene of the DNA fragment mutate from AAT to GCG, and the nucleotides at positions 1542-1543 of the S gene, the nucleotides at positions 1668-1669 of the PEDV S gene, the nucleotides at positions 2178-2179 of the PEDV S gene, the nucleotides at positions 2361-2362 of the PEDV S gene, the nucleotides at positions 3747-3748 or the nucleotides at positions 3924-3925 of the PEDV S gene of the DNA fragment mutate from AA to GC; (2) Amplification of the target fragment: using the DNA fragment of step (1) as a template to amplify the first part of the target fragment and the second part of the target fragment, and then amplify the middle fragment, and finally connect the three fragments to obtain the target fragment; (3) The first step is Red recombination: transform the targeting fragment into competent cells and verify the positive clones; (4) The second step is Red recombination: positive clones are selected for temperature and L-arabinose induction, and finally the final positive clones are further obtained through antibiotic screening.

6. A PEDV S protein N-glycosylation site mutant virus, characterized in that: The PEDV S protein N-glycosylation site mutant virus is obtained by transfecting cells with the recombinant PEDV infectious clone plasmid described in claim 4 or 5.

7. The method for rescuing a virus with a mutation in the N-glycosylation site of the PEDV S protein according to claim 6, characterized in that: The method comprises the following steps: co-transfecting cells with the infectious clone plasmid described in claim 4 and the auxiliary plasmid.

8. Use of the S protein with N-glycosylation site mutation according to claim 1, the nucleic acid molecule according to claim 2, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 3, the recombinant PEDV infectious clone plasmid with S protein N-glycosylation site mutation according to claim 4, or the PEDV S protein N-glycosylation site mutation virus according to claim 6 in the preparation of PEDV vaccines or PEDV antibodies.

9. A PEDV vaccine, characterized in that: It contains the S protein with N-glycosylation site mutation according to claim 1, the nucleic acid molecule according to claim 2, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 3, the recombinant PEDV infectious clone plasmid with S protein N-glycosylation site mutation according to claim 4, or the PEDV S protein N-glycosylation site mutation virus according to claim 6.

10. A PEDV neutralizing antibody, characterized in that The neutralizing antibodies are obtained by infecting animals with the virus having the N-glycosylation site mutation of the PEDV S protein according to claim 6.

Images