Rice insect-resistant key gene ospyl5 and application thereof

By screening and analyzing the rice hormone ABA receptor PYL5, and constructing a CRISPR/Cas9 gene-directed mutation vector for OsPYL5, the environmental and health hazards of chemical pesticides were solved, a new method for rice to resist brown planthopper was provided, and effective regulation of rice resistance to brown planthopper was achieved.

CN119751610BActive Publication Date: 2025-11-18YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411816560.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-11
Publication Date
2025-11-18
Estimated Expiration
2044-12-11

AI Technical Summary

Technical Problem

Existing chemical pesticides are harmful to the environment and human health, and the natural enemies of brown planthoppers are affected. There is a lack of environmentally friendly and healthy brown planthopper management strategies, and the development of rice resistance genes is insufficient.

Method used

By screening and analyzing the rice hormone ABA receptor PYL5, a directional mutant vector of the OsPYL5 gene was constructed using CRISPR/Cas9 technology. This vector was then used for rice genetic transformation, and mutant strains were screened and identified to regulate rice insect resistance.

Benefits of technology

Overexpression and knockout mutants of the OsPYL5 gene significantly affected the feeding behavior, egg production, and honeydew production of brown planthoppers, improving rice resistance to brown planthoppers and providing a new insect resistance mechanism.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119751610B_ABST
    Figure CN119751610B_ABST
Patent Text Reader

Abstract

The application discloses a rice pest-resistant key gene OsPYL5 and application thereof, and has an amino acid sequence as shown in SEQ ID NO: 2 or an amino acid sequence with more than 95 % homology with the amino acid sequence shown in SEQ ID NO: 2 and retaining the function of rice pest resistance. The application constructs a rice pest-resistant key gene OsPYL5 by constructing a rice OsPYL5 overexpression and knockout mutant strain, and the gene expression amount is regulated to affect the rice pest resistance. OsPYL5 The application proves that OsPYL5 OsPYL5 is a key gene for the rice resistance to the brown planthopper, and provides a new path for the rice resistance to the brown planthopper by cloning and function research on the gene. OsPYL5 OsPYL5 is a key gene for the rice resistance to the brown planthopper, and provides a new path for the rice resistance to the brown planthopper by cloning and function research on the gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the key gene OsPYL5 for rice resistance to brown planthopper and its application. Background Technology

[0002] Rice is an important food crop in my country, and the threat of rice pests is a significant factor restricting its yield. The brown planthopper is a monophagous pest that feeds on the phloem sap of rice through its mouthparts. Due to its strong reproductive capacity and environmental adaptability, once an outbreak occurs, it is characterized by an expanded affected area, increased outbreak frequency, and greater severity of damage. In recent years, with the extensive use of various pesticides, the resulting environmental and pesticide resistance problems have become increasingly prominent.

[0003] Currently, the application of chemical pesticides remains the primary method for controlling brown planthoppers in the field. However, the widespread use of these compounds is harmful to human health and the environment, and has side effects that affect the natural enemies of brown planthoppers. Therefore, it is essential to develop alternative brown planthopper management strategies that are more environmentally friendly, healthier, and more sustainable. Developing green biopesticides and utilizing the inherent resistance genes of rice to breed resistant rice varieties are widely considered the most cost-effective methods for sustainable control of brown planthoppers. Green biopesticides refer to preparations that directly utilize living organisms to control agricultural pests, and plant hormones are one of the important sources of plant-derived pesticides.

[0004] Plant hormones play an indispensable role in regulating plant growth and development and influencing plant stress resistance. Abscisic acid (ABA) is one of the most important hormones regulating plants and is also a plant-derived biochemical pesticide. Under abiotic stress, plants accumulate ABA to activate their own stress-resistance immune system, inducing traits such as cold resistance, salt tolerance, and drought resistance. Changes in ABA content in plant tissues trigger a signaling cascade, which depends on the induced expression of ABA-controlled genes. With increased ABA levels, receptor proteins sense the signal by binding to ABA. The receptor protein initiates the signaling cascade response, transmitting information to effector sites via neurotransmitters, and responding to stimuli through ABA-controlled gene expression products, thereby inducing plant responses to specific external or internal environmental conditions. A key component of the ABA signaling pathway, regulating the sensitivity of plant tissues to this plant hormone, is the ABA receptor (PYL / PYR / RCAR).

[0005] The PYL receptor possesses a conserved steroid hormone synthesis acute regulation-associated lipid transfer (START) domain, thus belonging to the START protein superfamily. Fourteen genes encoding ABA receptor proteins have been identified in the Arabidopsis genome, characterized by conserved amino acid sequences. The most well-known ABA receptor in monocotyledons is the rice receptor. To date, thirteen homologs of the PYL receptor have been identified in this species, ten of which are considered active. These proteins can simultaneously bind plant hormones and inhibit PP2C, leading to activation of other elements of the ABA signaling pathway. Inhibition of 2C-type phosphatase activity restores SnRK2 kinase activity, whose phosphorylation induces signal transduction and initiates transcription of genes dependent on increased ABA concentrations (such as those related to stress adaptation). PYL5, PYL8, and PYL9 in Arabidopsis are induced to increase under drought conditions. Conversely, experiments have shown that all identified Arabidopsis PYR / PYL receptors (except AtPYL13) can induce signal transduction through their receptor activity.

[0006] This invention further screened the rice hormone ABA receptor PYL5, analyzed its structure and function, constructed a recombinant vector for directed mutation of the OsPYL5 gene using CRISPR / Cas9 technology, and used this vector to genetically transform Zhonghua 11 (ZH11) rice. The transformed plants were screened and the mutations were identified, resulting in mutant rice plants. The resistance of the mutants to brown planthoppers was detected, providing new insights into the mechanism of rice resistance to brown planthoppers. Summary of the Invention

[0007] Technical problem to be solved: In view of the shortcomings of the existing technology, the present invention provides a key insect resistance gene OsPYL5 in rice and its application in regulating insect resistance in rice.

[0008] Technical solution: A rice insect-resistant protein having an amino acid sequence as shown in SEQ ID NO:2, or an amino acid sequence having more than 95% homology with the amino acid sequence shown in SEQ ID NO:2, and retaining the insect-resistant function of rice.

[0009] The gene OsPYL5 encoding the protein has a nucleic acid sequence as shown in SEQ ID NO:1, or a nucleic acid sequence that has at least 95% homology with the nucleic acid sequence shown in SEQ ID NO:1, and can encode a protein that regulates rice insect resistance.

[0010] A vector for genetic transformation of rice, comprising a gene OsPYL5 encoding an amino acid sequence having at least 95% homology with or without insect-resistant function as shown in SEQ ID NO:2, and necessary regulatory elements for expressing the gene in rice cells.

[0011] The above-mentioned genes are used as positive regulators in regulating rice resistance to brown planthopper.

[0012] A method for improving rice resistance to brown planthopper includes the step of increasing the expression of the aforementioned protein.

[0013] A method for breeding rice varieties resistant to brown planthoppers, the method comprising screening for plants with enhanced expression of the aforementioned gene.

[0014] A kit for detecting the presence or expression level of the aforementioned proteins in rice, comprising an antibody that specifically recognizes the protein or a probe that specifically binds to the gene.

[0015] The above-mentioned proteins are used as detection markers in the preparation of biological agents for detecting the resistance of rice to brown planthopper.

[0016] The above-mentioned genes are used as detection markers in the preparation of transgenic rice or biological agents for detecting the resistance of rice to brown planthopper.

[0017] Beneficial effects: This invention constructs rice OsPYL5 overexpression and knockout mutant lines, and influences rice insect resistance by regulating the expression level of the OsPYL5 gene. It confirms that OsPYL5 is a key gene for rice resistance to brown planthopper, and provides a new pathway for rice resistance to brown planthopper through cloning and functional studies of the OsPYL5 gene. Attached Figure Description

[0018] Figure 1 The cDNA and amino acid sequences of rice OsPYL5 were obtained from the MSU_Locus database at the National Rice Data Center. The full genome sequence, CDS region, and protein sequence of OsPYL5 were found. The full-length OsPYL5 sequence is 2468 bp, and the full-length CDS region is 630 bp, containing a total of 209 amino acids.

[0019] Figure 2 To compare the PYL5 amino acid sequences and determine phylogenetic relationships among different species, a phylogenetic tree analysis using the nearest neighbor method was performed on the PYL5 amino acid sequences. The tree was divided into dicotyledons, monocotyledons, and other branches. Rice and Aegilops are most closely related, followed by wheat. Phylogenetic relationships also exist between PYL5 sequences of plants from different families within the same species.

[0020] Figure 3 The spatiotemporal expression pattern of OsPYL5 was determined; the expression level of OsPYL5 gene in rice seedling, tillering and maturity stages and in root, stem, leaf and leaf sheath tissues was detected by quantitative fluorescence analysis.

[0021] Figure 4Subcellular localization of OsPYL5 was determined using injected tobacco and Confocol assays. Confocal analysis showed that OsPYL5 was localized in the cytoplasm and nucleus, and the addition of ABA did not affect its localization; it remained stably expressed in the nucleus and cytoplasm.

[0022] Figure 5 To identify and quantify hygromycin in homozygous rice overexpression lines OsPYL5-OE8 and OsPYL5-OE34; a recombinant plasmid was constructed by ligating the full-length CDS clone of OsPYL5 into the vector pCambia1301. After two generations of screening using rice tissue culture, hygromycin was identified, resulting in the identification of two homozygous OsPYL5 overexpression lines, OsPYL5-OE8 and OsPYL-OE34.

[0023] Figure 6 We designed, sequenced, and quantified target sites for the rice knockout mutant lines ospyl5-3 and ospyl5-9. Using CRISPR-Cas9 technology, we designed knockout target sites for the target genes on the targetDesign website (scau.edu.cn). We designed two knockout target sites, Target1 and Target2, on the mRNA of OsPYL5.

[0024] Figure 7 The phenotype of OsPYL5 overexpressing plants after infestation by brown planthoppers; OsPYL5-OE8 and OsPYL5-OE34 overexpressing plants and WT plants after infestation, after the WT plants died, the overexpressing plants still survived ( Figure 7 ).

[0025] Figure 8 The phenotypes of ospyl5 knockout mutant plants after infestation by brown planthoppers were observed. The fresh and dry weights of overexpressing plants were greater than those of the rootstock (WT) after feeding on the brown planthoppers. After inoculation with ospyl5-3 and ospyl5-9 knockout mutant plants and WT plants, the WT plants survived even after the knockout mutant plants died, and the brown planthoppers showed a significantly increased tendency to feed on the knockout mutant plants. The fresh and dry weights of WT plants after feeding on the brown planthoppers were greater than those of the knockout mutant plants.

[0026] Figure 9The average damage level and plant function loss index of OsPYL5 overexpression and knockout mutant plants after infestation by brown planthoppers were calculated. A comprehensive evaluation of the average damage level and function loss index of OsPYL5 overexpression and knockout mutant plants showed that brown planthoppers feeding on overexpression lines caused significantly less damage than WT and knockout mutant plants, with a significantly lower plant function loss index and a 20% reduction in damage level. However, the average damage level of knockout mutant plants reached 9, and the plant function loss index was as high as 100%, an increase of 30% compared to WT, indicating that brown planthoppers preferred to feed on knockout mutant plants.

[0027] Figure 10 The study aimed to identify the insect resistance of OsPYL5 overexpression and knockout mutant plants. The feeding tendency of brown planthoppers on WT, overexpression, and knockout mutant plants was measured. The number of brown planthoppers was 18 on overexpression plants, 31 on WT, and 42 on knockout mutant plants. Oviposition also showed significant differences: 90 eggs were laid on overexpression plants, 200 on WT, and a significantly higher number of 325 on knockout mutant plants. Honeydew production was only 1.5 μL on overexpression plants, 19.0 μL on WT, and 45.0 μL on knockout mutant plants. The survival rate of 3-day-old nymphs was lowest on overexpression lines (17.5%), rising to 52.5% on WT, and reaching 65.0% on knockout mutant plants. The results above indicate that OsPYL5 can affect the feeding behavior, egg production, and honeydew amount of brown planthoppers, thus playing a positive regulatory role in the resistance of rice to brown planthoppers, reducing the feeding of brown planthoppers and reducing the damage caused by brown planthoppers.

[0028] Figure 11 The study investigated the levels of antibiotic substances in OsPYL5 overexpression and knockout mutant plants after infestation by brown planthoppers. The OsPYL5 overexpression plants showed significantly increased levels of flavonoids, total plant phenols, hydrogen peroxide (H2O2), and MDA, while the OsPYL5 knockout mutant plants showed a significantly higher level of total plant phenols compared to the WT mutant. The other three antibiotic substances showed significantly decreased levels.

[0029] Figure 12 Enzyme activities in OsPYL5 overexpressing and knockout mutant plants after infestation by brown planthoppers were measured. The activities of POD, PPO, SOD, and CAT were significantly increased in the overexpressing plants, increasing by 2.0, 1.4, 30.0, and 4.0 times, respectively, compared to the WT plants. Except for CAT, which showed no significant difference in activity between the knockout mutant and WT plants, the activities of POD, PPO, and SOD were significantly decreased by 1.58, 4.43, and 2.24 times, respectively, compared to WT. Detailed Implementation

[0030] The technical solution described in this invention will be further explained in detail below through specific implementation.

[0031] Example 1: Cloning the rice OsPYL5 gene

[0032] (1) Based on the National Rice Data Center, primers were designed using Snap Gene, with the PYL5 forward primer being 5'-ATGGTGGGGCTTGTGGGAGG-3' and the reverse primer being 5'-CTACTGTTCAAGTGGCGAGG-3'. The high-fidelity PCR reaction system was as follows: 2×Primer Star Buffer 25μL; forward primer (10μM) 1μL; reverse primer (10μM) 1μL; template (rice ZH11 cDNA); ddH2O added to a final volume of 50μL. The reaction program was: (98℃ 10s - 55℃ 15s - 72℃ 1 min 30s) × 32 cycles, stored at -4℃.

[0033] (2) CRISPR-Cas9 target design and transformation

[0034] Based on the Sg Sequence provided by Baige Gene Technology (Jiangsu) Co., Ltd., the target primer sequence is designed as follows:

[0035] PYL5-gRT1: acggcttgta cctctgcggc gttttagagc tagaaat;

[0036] PYL5-OsU6bT1: gccgcagagg tacaagccgt caacacaagc ggcagc.

[0037] The primer sequence for target 2 is as follows:

[0038] PYL5-gRT2:tgctagccgctctgatacctgttttagagctagaaat;

[0039] PYL5-OsU6cT2: aggtatcagagcggctagcactgagcctcagcgcag.

[0040] Oligo dimer was prepared, and then a CRISPR-Cas vector was constructed. The reaction system consisted of 2 μL Vector, 1 μL EnzymeMix, 1 μL Oligo dimer, and 6 μL H2O. The reaction conditions were 25 °C for 1 h. Competent cells were then transformed.

[0041] Take 5 μL of the above reaction solution, add 20 μL of competent cells (DH5α), mix, and incubate on ice for 30 min (do not shake); gently remove, heat shock at 42℃ for 35 s, and immediately place on ice for 2 min; add 100 μL of LB, and incubate at 37℃ with shaking for 1 h; take 60 μL of bacterial culture and spread it on an LB agar plate containing kanamycin, and incubate overnight at 37℃ upside down. Select single clones, extract plasmids, and send for sequencing. The sequencing primers are PUV4-R: 5'-TCCCAGTCACGACGTTGTAA.

[0042] Example 2: Genetic transformation of the OsPYL5 gene

[0043] The constructed CRISPR-Cas9 vector was transferred into rice through Agrobacterium infection. The experimental steps were: induction for 10 days, subculture for 5 days, Agrobacterium streaking for 2 days, co-culture for 3 days, selection for 30 days, differentiation for 30 days, and rooting for 7 days, for a total of 87 days.

[0044] (1) Callus Induction and Subculture: Select mature rice seeds (preferably newly harvested seeds of the current year), peel off the glumes, pour into 50mL centrifuge tubes, add 75% ethanol for 1 min to sterilize, discard the ethanol, rinse once with sterile water, discard the ethanol, then add 30% sodium hypochlorite for 20 min to sterilize, discard the sodium hypochlorite, and rinse 5-6 times with sterile water. Use a pipette to remove excess water (or use sterile filter paper to absorb the water), and transfer the seeds to induction medium, 20-25 seeds per dish.

[0045] (2) After the callus grows, it can be directly transformed using the protoembryo. The small particles growing next to the protoembryo can be picked and subcultured on a new induction medium. When they grow to a suitable size, they can also be transformed.

[0046] (3) Agrobacterium culture: Agrobacterium EHA105 containing the target gene vector is streaked on a plate containing the corresponding antibiotic and cultured in the dark at 28°C for 2 days until a single colony appears.

[0047] (4) Agrobacterium infection: Prepare the infection solution by using a pipette to wash off the Agrobacterium on the plate, thus obtaining the Agrobacterium suspension for co-culture transformation of rice. Select a sufficient number of callus tissues (the callus should be in good condition, bright yellow in color, round and firm in texture, and the particle diameter should be about 3 mm), place them in a 100 mL sterile Erlenmeyer flask, add an appropriate amount of Agrobacterium suspension (ensure sufficient bacterial solution to contact the material), and incubate at room temperature for 20 min, shaking occasionally. Discard the bacterial solution, place the callus tissues on sterile filter paper to absorb excess bacterial solution, and then transfer them to a solid co-culture medium covered with a layer of sterile filter paper. Incubate at 26°C in the dark for 3 days.

[0048] (5) Screening and Culture: After 3 days of co-culture, the callus tissue needs to be cleaned. Using a 1mL blue pipette tip, transfer the callus from the co-culture medium to a sterilized Erlenmeyer flask, rinse twice with sterile water, and then rinse a third time with sterile water containing 500μL / L carbenicillin. After removing excess water with a pipette, transfer the callus to sterile filter paper and use the air blower in a laminar flow hood to dry the water on the callus. The air blowing time should be controlled at about 30 minutes. After the callus is dried, transfer it to the screening medium for screening culture. The culture conditions are 28-30℃, dark culture. The screening time is 3-4 weeks.

[0049] (6) Differentiation and regeneration: After one month of screening, bright yellow positive calluses will appear. At this time, the positive calluses can be picked and placed on differentiation medium for differentiation and regeneration. Place 16 positive calluses on each differentiation dish and place them in a greenhouse at 28-30℃ for light cultivation. Generally, green spots will appear on the calluses after about 10 days, and seedlings will differentiate after another 10 days.

[0050] (7) Seedling rooting: When the differentiated seedlings grow to about 2-3cm and have obvious roots, they can be transferred to the rooting medium to allow them to grow. The rooting medium should be poured into a relatively tall bottle or tube so that the seedlings have enough space to grow tall after rooting. The rooting culture conditions are 28-30℃ and sterile light culture.

[0051] Example 3: Transient expression and subcellular localization detection of exogenous proteins in tobacco

[0052] The exogenous OsPYL5 recombinant plasmid was introduced into tobacco leaves for expression using Agrobacterium tumefaciens. The experimental steps are as follows:

[0053] (1) Select Agrobacterium clones containing the OsPYL5 recombinant plasmid and transfer them to 5 mL of K + The samples were cultured in LB medium at 30°C in a shaker at 250 rpm for 1 day.

[0054] (2) After centrifuging the above-cultured Agrobacterium tumefaciens culture, 50 μL of Agrobacterium tumefaciens cells were inoculated into a new 5 mL LB medium containing K+. 100 μL of 0.5 M MES and 2 μL of 100 mM AS were added. The culture was incubated in a constant temperature shaker at 30℃ at 250 rpm until the OD600 was 1.0. The cells were then recovered by centrifuging at 4000 rpm for 10 min at room temperature.

[0055] (3) The recovered bacterial cells were resuspended in 10mM MgCl2 and diluted to OD600 of 1.0. The corresponding AS was added at a ratio of 2μL of AS to 1mL of resuspended bacterial solution, and the bacterial solution was allowed to stand at room temperature for more than 3h.

[0056] (4) Take a healthy tobacco plant, draw the above-mentioned settled bacterial solution into a 1mL syringe, make a small incision on the back of the leaf with a needle, and inject the bacterial solution into the leaf from the back of the leaf.

[0057] After incubating tobacco injected with Agrobacterium at 23°C for 2 days in a constant temperature incubator, a 1 cm sample of the injection site was taken and subjected to fluorescence imaging under a laser confocal microscope. The presence of fluorescence was then observed by imaging with the corresponding excitation light.

[0058] Example 4: Identification of insect resistance in OsPYL5 overexpression and knockout mutant plants

[0059] Determination of the effect of OsPYL5 overexpression and knockout mutant rice plants on the feeding tendency of brown planthoppers

[0060] Rice plants with WT, OsPYL5 overexpression, and knockout mutants were soaked and germinated, then hydroponically cultured in a plant growth chamber until the 4-leaf stage. The cultured rice plants were placed in black glass cups, arranged in three equidistant locations. Fifteen plants were collected for each treatment, with each cup representing a replicate, for a total of 15 replicates. One hundred and twenty fourth-instar nymphs were starved for one hour before inoculation. Brown planthoppers were placed between the three types of rice plants, allowing them to freely choose which rice to feed on. The experiment was conducted at room temperature, and the number of brown planthoppers on each seedling was recorded.

[0061] Determination of average damage level and plant function loss index in rice plants after brown planthoppers feed on OsPYL5 overexpression and knockout mutants.

[0062] Rice seeds of WT and OsPYL5 overexpression and knockout mutants were soaked and germinated, then hydroponically cultured in a plant growth chamber until the 4-leaf stage. Eight uniformly growing rice seedlings were taken from each line, each representing a replicate. A rice plant was inserted into the center of a perforated PVC sheet, and the rice stem was surrounded by a transparent plastic cover, sealed with a round sponge. Eighty 3rd-4th instar brown planthopper nymphs were starved for 1 hour, then all the nymphs were poured into a cup. The cups were incubated at room temperature. After 7 days, the round sponge was removed, and the brown planthoppers were removed using a siphon. The damage level of the rice plants in each cup was examined, and the identification criteria are shown in Table 1.

[0063] After determining the extent of damage to rice plants following the average damage level assessment, the plants were sliced, washed, dried at 110℃ for 20 minutes, and then dried at 60℃ to constant weight. The dry weight was measured using a precision electronic balance, and the Functional Plant Loss Index (FPLI) was calculated according to the method described by Chen et al. (2009).

[0064]

[0065] Table 1. Criteria for identifying rice resistance after brown planthopper infestation.

[0066] Damage level during the seedling stage (level) International Rice Research Institute Standard 0 Unharmed 1 The victim was very minor. 3 The first and second leaves of most plants turned yellow. 5 The plants turn noticeably yellow and become stunted, or more than half of the plants wither and die. 7 More than half of the plants withered and died, and the remaining plants were severely stunted and on the verge of death. 9 All plants died.

[0067] Changes in oviposition, nymph mortality, survival rate, and honeydew volume in rice plants after brown planthoppers fed on OsPYL5 overexpression and knockout mutants.

[0068] Fourth instar nymphs of the brown planthopper were released onto OsPYL5 knockout mutant and overexpressing rice plants for rearing. A pair of adult brown planthoppers reared on transgenic rice were paired, and the paired adults were then individually placed onto overexpressing and knockout mutant plants for experiments. Survival rate, mortality rate, and oviposition were recorded (one pair of adult females constituted one replicate, with 15 replicates per treatment). Oviposition was observed continuously for 14 days using an optical microscope. Honeydew levels were recorded using the methods employed by Wu et al.

[0069] Example 5: Determination of the content of defense-related molecules and antibiotic substances in rice

[0070] For flavonoid content detection, samples were taken after brown planthopper infestation and dried to constant weight. The supernatant was collected according to the method described in the rice flavonoid extraction kit. The sample was zeroed with distilled water. The reagents listed in Table 2 were added sequentially.

[0071] Table 2

[0072]

[0073] For the detection of hydrogen peroxide (H2O2) content, tissue samples were taken after brown planthopper infestation. The supernatant was collected and placed on ice for testing according to the method of the hydrogen peroxide extraction kit for rice.

[0074] Table 3

[0075]

[0076] For the detection of malondialdehyde (MDA) content, tissue samples were taken after brown planthopper infestation. Following the method described in the rice MDA content extraction kit, the supernatant was collected and placed on ice for testing. The absorbance values ​​at 532 nm and 600 nm were measured, ΔA = A532 - A600. The results were then calculated using the appropriate formula.

[0077] For the determination of total phenols, the supernatant was collected and diluted to 2 mL with extraction buffer according to the instructions of the Total Phenols Extraction Kit from Suzhou Keming Biotechnology Co., Ltd. Three biological replicates were performed for each group.

[0078] Table 4

[0079]

[0080] For the detection of catalase (CAT) content, tissue samples were taken after brown planthopper infestation. The supernatant was collected according to the method of the CAT content extraction kit for rice and placed on ice for testing.

[0081] Preheat the spectrophotometer for at least 30 minutes and adjust the wavelength to 405 nm. Add the following reagents to the EP tube.

[0082] Table 5

[0083]

[0084] For the detection of superoxide dismutase (SOD) content, tissue samples were taken after brown planthopper infestation. The supernatant was collected according to the method of the rice MDA content extraction kit and placed on ice for testing.

[0085] Table 6

[0086] Reagent Name (μL) Measurement tube control tube Reagent 1 240 240 Reagent 2 6 6 sample 90 distilled water 90 Reagent 3 180 180 Reagent 4 510 510

[0087] For the detection of polyphenol oxidase (PPO) content, tissue samples were taken after brown planthopper infestation, and the supernatant was collected for testing according to the method of the rice PPO content extraction kit.

[0088] Table 7

[0089] Reagent Name (μL) Measurement tube control tube sample 180 Boiled sample 180 Reagent 1 720 720 Reagent 2 180 distilled water 180

[0090] Peroxidase (POD) was extracted from tissue samples after brown planthopper infestation. The absorbance values ​​A1 at 470 nm for 1 minute and A2 at 2 minutes were recorded according to the method described in the rice POD extraction kit. (The time interval between A2 and A1 was 1 minute). ΔA = A2 - A1 was calculated.

[0091] Example 6 Data Analysis

[0092] Data analysis was performed using one-way ANOVA. All data are expressed as mean ± SEM. P ≤ 0.05 indicated statistical significance (*), and P ≤ 0.01 indicated statistical significance (**). The results clearly show that ospyl5 reduces rice's insect resistance, making it more susceptible to brown planthopper infestation. Overexpression of OsPYL5 improves rice's insect resistance, indicating that OsPYL5 is a key gene regulating rice's resistance to brown planthopper.

[0093] The above embodiments are preferred embodiments of the present invention and are not intended to limit the present invention. Any technical improvements and equivalent substitutions made to the present invention by those skilled in the art without departing from the spirit or scope of the present invention are within the protection scope of the present invention.

Claims

1. Application of the gene with the nucleic acid sequence shown in SEQ ID NO:1 as a positive regulator in regulating rice resistance to brown planthopper.

2. A method for improving rice resistance to brown planthopper, characterized in that, The method includes steps to enhance protein expression with an amino acid sequence as shown in SEQ ID NO:

2.

3. A method for breeding rice varieties resistant to brown planthoppers, characterized in that, This method involves screening for plants with enhanced gene expression, as shown in SEQ ID NO:

1.

4. The application of a protein with the amino acid sequence shown in SEQ ID NO:2 as a detection marker in the preparation of a biological agent for detecting the resistance of rice to brown planthopper.

5. Application of the gene with the nucleic acid sequence shown in SEQ ID NO:1 as a detection marker in the preparation of a biological agent for detecting the resistance of rice to brown planthopper.

Citation Information

Patent Citations

  • Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof

    CN103215237A

  • Rice insect-resistant key gene OsMYC2 and application thereof

    CN114480428A