New ganoderma huoshanense strain and cultivation method thereof

Abstract

The invention relates to edible and medicinal fungi, in particular to a novel ganoderma huoshanense strain and a cultivation method thereof. The preservation number of the novel ganoderma huoshanense strain disclosed by the invention is CCTCC (China Center For Type Culture Collection) NO: M2021661. The new strain of ganoderma huoshanense has the advantages of short growth cycle, high biotransformation rate (high yield), high content of effective components (ergosterol) and the like, has high commodity value and is suitable for cultivation.

Description

Technical Field

[0001] The invention relates to edible and medicinal fungi, and in particular to a new strain of Huoshan red ganoderma and a cultivation method thereof. Background Art

[0002] Ganoderma lucidum, also known as red ganoderma, red ganoderma, wood ganoderma, fungus ganoderma, Wannian mushroom, and ganoderma grass, belongs to the phylum Basidiomycetes, class Basidiomycetes, and family Polyporaceae, and has extremely high medicinal value. The effects of Ganoderma lucidum are recorded in both "Shennong's Herbal Classic" and "Compendium of Materia Medica". Modern research shows that Ganoderma lucidum has the effects of anti-tumor, improving eyesight and calming the mind, nourishing the liver and replenishing qi, and anti-aging. Traditional Ganoderma lucidum strains are prone to degeneration during use, such as slower growth rate, lower bioconversion rate, weakened stress resistance, lower content of active ingredients, and reduced yield. Therefore, it is necessary to provide more new strains of Ganoderma lucidum. Summary of the invention

[0003] The invention provides a new strain of Huoshan red ganoderma and a cultivation method thereof.

[0004] The new strain of Huoshan Ganoderma lucidum provided by the present invention is named Huoshan Ganoderma No. 1 (Ganoderma lucidum), which was deposited in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Wuhan, China, postal code 430072) on June 2, 2021, and its preservation number is: CCTCC NO: M2021661.

[0005] The Huoshan Ganoderma lucidum No. 1 provided by the present invention is obtained by separating wild Ganoderma lucidum from bamboo forests in Wangjiadian Town, Huoshan County, Anhui Province, and is cultivated through domestication. The new strain of Huoshan Ganoderma lucidum has the advantages of short growth cycle, high bioconversion rate (high yield), high content of effective ingredients (ergosterol), high commodity value, and is suitable for cultivation. The cultivation and cultivation conditions of the new strain of Huoshan Ganoderma lucidum are as follows: the mycelium growth temperature is 25-32°C.

[0006] In particular, the ergosterol content of the new strain (fruiting body) of Huoshan Ganoderma lucidum of the present invention is particularly high, reaching 0.362%.

[0007] The invention also provides application of the Huoshan Ganoderma Lucidum No. 1 (CCTCC NO: M2021661) in cultivation.

[0008] The present invention also provides Huoshan Ganoderma lucidum fruiting bodies obtained by cultivating the Huoshan Ganoderma lucidum No. 1 (CCTCC NO: M2021661).

[0009] The present invention also provides the use of Huoshan Ganoderma Lucidum No. 1 (CCTCC NO: M2021661) in the preparation of ergosterol.

[0010] The new strain of Huoshan red ganoderma lucidum of the present invention can adopt a modified PDA culture medium (mother strain), the formula of which is: 300g potato, 50g wheat bran, 20g glucose, 1g citric acid, 15g agar, 2000ml water, and the pH value is 6-7.

[0011] The original culture medium of the new strain of Huoshan Ganoderma lucidum of the present invention comprises: 78% bamboo scraps, 18% bran, 2% glucose, 1% lime, 1% gypsum, and a water content of 55%±3%, all in weight percentage.

[0012] The cultivation medium of the new strain of Huoshan Ganoderma lucidum of the present invention comprises: 85-90% bamboo scraps, 6-11% bran, 2% glucose, 1% lime, 1% gypsum, and a water content of 55%±3%. Preferably, the cultivation medium comprises: 88% bamboo scraps, 8% bran, 2% glucose, 1% lime, 1% gypsum, and a water content of 55%±3%. All are weight percentages.

[0013] Based on a large number of studies, the present invention also optimizes the cultivation method of the new strain of Huoshan Ganoderma lucidum. Experiments have shown that the method, especially the use of the above-mentioned cultivation medium, can significantly increase the yield and ergosterol content of the new strain of Huoshan Ganoderma lucidum.

[0014] Specifically, the cultivation method of the Huoshan Ganoderma Lucidum No. 1 (CCTCC NO: M2021661) includes:

[0015] Preparation of mother seeds, stock seeds and cultivars;

[0016] The cultivar is cultured at 25-30°C to produce shiitake mushrooms.

[0017] In some specific embodiments, each raw material of the culture medium is accurately weighed and stirred in proportion. A polypropylene or polyethylene tube bag with a length of 37 cm, a folded width of 18 cm, and a thickness of 0.05 mm is used, and the tightness is uniform and the height of the culture medium is 20±1 cm. Sterilization should be carried out quickly after the loading is completed. The center temperature of the culture medium is cooled to 30°C and inoculated. The culture temperature is controlled at 25-30°C during the mycelium growth stage. The wall-type ganoderma is used. When the color of the bottom of the ganoderma changes from golden yellow to light gray, and the culture medium of the fungus bag changes from solid to soft, the ganoderma fruiting body can be harvested.

[0018] In the present invention, the mother seed, original seed and cultivar can be prepared according to conventional methods in the art.

[0019] According to cultivation experiments, compared with the traditional Ganoderma lucidum cultivation method, the fruiting body yield of the new strain of Huoshan Ganoderma lucidum cultivated by the above method can be increased by 31%; the ergosterol content can reach 0.362%.

[0020] The present invention also provides the use of the Huoshan Ganoderma Lucidum No. 1 (CCTCC NO: M2021661) or the Ganoderma Lucidum mycelium obtained by culture or the Ganoderma Lucidum fruiting body obtained by cultivation in preparing food, health food or medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The antagonism test results of the strains in the examples of the present invention are shown in FIG. DETAILED DESCRIPTION

[0022] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0023] Mother culture medium: modified PDA medium (300 g potato, 50 g wheat bran, 20 g glucose, 1 g citric acid, 15 g agar, 2000 ml water, pH 6-7).

[0024] Original seed culture medium: bamboo scraps 78%, bran 18%, glucose 2%, lime 1%, gypsum 1%; water content 55%±3%. All are weight percentages.

[0025] Cultivation medium: bamboo scraps 88%, bran 8%, glucose 2%, lime 1%, gypsum 1%; water content 55%±3%. All are weight percentages.

[0026] The bamboo scraps are first broken and then pulverized into bamboo chips.

[0027] Example 1

[0028] 1. Strain Acquisition

[0029] In July 2018, wild Ganoderma lucidum was collected in Wangjiadian Town, Huoshan County, Anhui Province, and pure strains were isolated.

[0030] After years of cultivation and domestication, a strain with relatively stable genetic traits, high yield and high content of effective ingredients, especially ergosterol, was obtained. It was named Huoshan Ganoderma No. 1 and was preserved in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Wuhan, China, Postal Code 430072) on June 2, 2021. Its preservation number is: CCTCC NO: M2021661.

[0031] 2. Identification of bacterial species

[0032] 2.1 Morphological identification of Huoshan Ganoderma lucidum

[0033] Fruiting body characteristics: The cap is nearly circular, corky, 12 - 15 cm wide and 1.2 - 1.8 cm thick. The upper surface is red with a varnish-like luster, radially longitudinally ridged, with multiple concentric rings, and the lower surface is yellow. The flesh is light brown. The pores are initially white and later turn light brown, with an average of 3 - 5 per millimeter. The stipe is laterally attached, almost perpendicular to the cap, 5 - 12 cm long, 0.9 - 1.9 cm thick, purplish-brown, with luster. The spores are ovoid, truncate at one end, 9.5 - 10.1um × (4.8 - 5.8)um, with a double wall. The outer wall is transparent and smooth, the inner wall is nearly brown, with small spines, and there are oil droplets in the middle.

[0034] After morphological identification, Ganoderma lucidum No. 1 from Huoshan belongs to Ganoderma lucidum.

[0035] 2.2 Antagonism test

[0036] According to "NY / T1845 - 2010 Identification of antagonistic reactions for differentiating edible mushroom strains (cultivars)", the differentiating identification of strains (cultivars) was carried out.

[0037] Compare the mainstream varieties in the existing market. Ganoderma lucidum No. 1 from Huoshan and the mycelia of other strains were inoculated in a "pin" shape on the same plate, and cultured at a constant temperature of 30℃ on PDA medium for confrontation, and the antagonistic reaction was observed.

[0038] The results are shown in Figure 1 , where A is Ganoderma lucidum from Korea, B is Ganoderma lucidum from Taishan, and C is Ganoderma lucidum No. 1 from Huoshan.

[0039] After domestication, Ganoderma lucidum No. 1 from Huoshan obtained stable genetic traits, with a significantly accelerated growth rate and vigorous growth. The results showed that there were differences between Ganoderma lucidum No. 1 from Huoshan and the mainstream varieties in the existing market, confirming that Ganoderma lucidum No. 1 from Huoshan is different from the existing Ganoderma lucidum strains.

[0040] 2.3 Molecular identification

[0041] Experimental instruments: MG96 + type PCR amplifier (Hangzhou Langji Scientific Instruments Co., Ltd.), BIO - RAD gel imaging system (Bio - Rad Laboratories, USA), BIO - RAD electrophoresis apparatus (Bio - Rad Laboratories, USA), TG16G type high - speed centrifuge (Tianjin Guangfeng Technology Co., Ltd.), Eppendorf BioSpectrometer fluorescence spectrophotometer (EppendorfBioSpectrometer, Germany), TG16G type high - speed centrifuge (Tianjin Guangfeng Technology Co., Ltd.), constant temperature water bath, vortex mixer.

[0042] Experimental reagents: potassium dihydrogen phosphate, magnesium sulfate, glucose, agar and other reagents were used to prepare culture medium; 2×Taq PCRMix; ALD 2000; 10000×AidRed; ampicillin (50 mg·mL-1); 50×TAE; agarose; plant genomic DNA rapid extraction kit (Tiangen, Beijing); agarose gel purification and recovery kit (Aidelai, Beijing); zero background pTOPO-TA cloning kit (Aidelai, Beijing); Escherichia coli DH5α competent cells (Aidelai, Beijing) and other reagents were used for molecular identification.

[0043] Culture medium: 200g potato, 34g wheat bran, 20g glucose, 3g potassium dihydrogen phosphate, 1.5g magnesium sulfate, 0.1g Vb1, 12.5g agar, distilled water to 1L, pH natural. Sterilize at 121℃ for 20min before use.

[0044] Experimental methods

[0045] Mycelium preparation and mycelium DNA extraction: The Huoshan Ganoderma lucidum No. 1 strain was inoculated on a solid culture medium and cultured at 25°C for about 7 days.

[0046] Template DNA preparation: After the mycelium has grown all over the plate, the mycelium is collected, placed in a mortar, and ground into powder by adding liquid nitrogen. Subsequently, the sample DNA is extracted according to the DNA extraction kit. The extracted sample DNA is electrophoresed on a 1% agarose gel stained with nucleic acid dye, and the DNA electrophoresis bands are observed under a gel imaging system.

[0047] Sequence amplification and sequencing: Two specific primers ITS1 and ITS4 were selected to specifically amplify genomic DNA (Table 1). 25μl reaction system: 2×Taq PCR Mix 12.5μl, primer ITS1μl, primer ITS41μl, DNA 1μl, ddH2O to 25μl. ITS amplification reaction procedure: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 55s, 30 cycles, 72℃ extension for 5min, and finally kept at 4℃. After the reaction, the PCR product was electrophoresed on 1% agarose gel and photographed and recorded, and Beijing BGI Gene Testing Company was commissioned for bidirectional sequencing.

[0048] Table 1 ITS specific primers and their sequences

[0049] Primers Sequence (5'-3') Primers Sequence (5'-3') ITS1 TCCGTAGGTGAACCTGCGG ITS4 TCCTCCGCTTATTGATAGGC

[0050] Data processing: The determined sequence results were compared in NCBI, and online BLAST analysis was performed. After selecting nucleotide blast, the sequence results similar to the determined sequence were obtained. The ITS sequences were aligned using MEGA 7.0 software, and the differences at both ends were removed. The phylogenetic tree was constructed using Neighbor-Joining. The bootstrap test was run 1000 times to evaluate the reliability of the topological structure of the phylogenetic tree, and the evolutionary distance between each sequence was calculated according to the Kimura-2 method.

[0051] Results: The ITS sequence was obtained by PCR amplification using specific primers and sequencing. The ITS sequence fragment obtained in this experiment was 606 bp in size. The specific sequence can be found in Seq No. 3. After checking the literature, it was found to be consistent with the ITS sequence length of Ganoderma lucidum.

[0052] Example 2 Comparison of biological properties

[0053] After heating the modified PDA medium, quantitatively pour it into the culture dish, quantitatively inoculate 3 strains of Ganoderma lucidum, draw a line on the bottom of the culture dish every two days, and measure the colony diameter by the "cross method". After a one-way analysis of variance on the mycelial growth rate, it was found that there was no difference in the growth rate of the Hanzhi and Taishan Ganoderma lucidum strains, and the Huoshan Ganoderma lucidum No. 1 strain grew faster, with significant differences from the Hanzhi and Taishan Ganoderma lucidum strains (P<0.01). The strain growth rate and colony morphology are shown in Table 2 below.

[0054] Table 2

[0055]

[0056] Example 3 Cultivation Test

[0057] 1 Agronomic traits

[0058] Unless otherwise specified, the culture medium used is: bamboo scraps 88%, bran 8%, glucose 2%, lime 1%, gypsum 1%; water content 55%±3%. All are weight percentages.

[0059] Remove the bag and cover the soil for cultivation: set up a ridge in the cultivation shed, set up a passage in the middle, the ridge width is 90cm-110cm, the ditch between the two ridges is 40cm wide and 30cm deep, and dig drainage ditches around. Use 17cm×33cm×0.04cm polypropylene plastic bags to cultivate the fungus, and tie the two ends. Each bag contains 0.5kg of dry material and 55±3% water content. Sterilize after bagging, move the cultivation bag into the inoculation room or inoculation box, and inoculate at both ends. The light is dim during the mycelium cultivation stage, the air humidity is controlled at about 70%, and the temperature is maintained at 25-30℃. After 30-40 days of cultivation, the mycelium will fill the cultivation bag. Expand the cultivation, and the mycelium cultivation is the same as the cultivation species. Select fungus bags that are not contaminated by other bacteria, are full of growth, and have dark mycelium skin. Place the fungus bags horizontally, make three small holes, the hole size is 2cm, and the interval between bags is 3cm-5cm. After about 10 days, the primordium was formed at the punched hole. The greenhouse was managed with 70% shade and 30% sun, basically no ventilation, and the carbon dioxide concentration was controlled at 3000-5000mg / L and the temperature was 25-35℃. Ganoderma lucidum was formed and harvested from the base with a knife after about 20 days of maturity. The results are shown in Table 3 below.

[0060] Table 3

[0061] strain Contamination rate Full bag time Bioconversion rate A(Han Zhi) 5.45％ 39.3d 503kg B(Taishan Lingzhi) 5.96％ 37.6d 537kg C(Huoshan Chizhi No.1) 4.55％ 33.5d 659kg C(Huoshan Chizhi No.1)* 4.58％ 35.1d 622kg

[0062] Note: *Use common culture medium (wood chips 60%, sawdust 28%, bran 8%, glucose 2%, lime 1%, gypsum 1%; water content 55% ± 3%; weight percentage). Other conditions are the same.

[0063] According to the results of the three Ganoderma lucidum strains, strain C has a low contamination rate of foreign bacteria, the fastest mycelium growth, good growth, and a full bag time of 33.5 days. Fast mycelium growth can shorten the production cycle. In addition, it was found that the use of a cultivation medium containing bamboo scraps is beneficial to increasing mycelium growth rate and bioconversion rate.

[0064] 2. Determination of active ingredient content

[0065] Reference for determination of ergosterol content: Liu Jingjing, Huang Wenhua, Lv Mingliang, et al. Determination of ergosterol content in fruiting bodies of Ganoderma lucidum of different varieties and log cultivation by HPLC [J]. Chinese Medicinal Materials, 2011, 34(2):4.

[0066] Chromatographic column: Diamonsil C18, mobile phase: acetonitrile, flow rate: 1.0 mL / min, column temperature: 40°C, detection wavelength: 282 nm.

[0067] The test results are shown in Table 4 below.

[0068] Table 4

[0069] strain Ergosterol content A(Han Zhi) 0.128％ B(Taishan Lingzhi) 0.098％ C(Huoshan Chizhi No.1) 0.362％ C(Huoshan Chizhi No.1)* 0.241％

[0070] The results showed that Huoshan Ganoderma No. 1 had the highest ergosterol content, 3.7 times that of Taishan Ganoderma. In particular, compared with ordinary culture medium, the use of culture medium containing bamboo chips is also conducive to increasing the ergosterol content.

[0071] With respect to the above description of the disclosed embodiments, the features described in the various embodiments in this specification may be replaced or combined with each other to enable professionals in the field to implement or use the present invention. Various modifications to these embodiments will be apparent to professionals in the field, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Ganoderma lucidum, Huoshan Ganoderma No. 1, whose preservation number is CCTCC NO: M2021661.

2. Use of the Ganoderma lucidum Huoshan Ganoderma No. 1 described in claim 1 in cultivation.

3. The Ganoderma lucidum fruiting body obtained by cultivating Huoshan Ganoderma lucidum No. 1 as claimed in claim 1.

4. Use of the Ganoderma lucidum Huoshan Ganoderma No. 1 according to claim 1 in the preparation of ergosterol.

5. Use of the Ganoderma lucidum Huoshan Ganoderma No. 1 according to claim 1 in preparing food or medicine.

6. Use of the Ganoderma lucidum Huoshan Ganoderma No. 1 according to claim 1 in preparing health food.

7. Use of the fruiting body of Ganoderma lucidum Huoshan Ganoderma No. 1 cultivated as claimed in claim 1 in preparing food or medicine.

8. Use of the fruiting body of Ganoderma lucidum Huoshan Ganoderma No. 1 cultivated as claimed in claim 1 in preparing health food.

9. The cultivation method of Ganoderma lucidum Huoshan Ganoderma No. 1 according to claim 1 comprises: Preparation of mother seeds, stock seeds and cultivars; The cultivar is cultured at 25-30°C to produce shiitake mushrooms.

10. The cultivation method according to claim 9, characterized in that: The culture medium used: bamboo scraps 85-90%, bran 6-11%, glucose 2%, lime 1%, gypsum 1%; water content 55% ± 3%; Preferably, the culture medium for the cultivated species is: 88% bamboo chips, 8% bran, 2% glucose, 1% lime, 1% gypsum; and the water content is 55%±3%.

Images