Bacillus subtilis with high yield of specific surfactin as well as preparation method and application of bacillus subtilis

Abstract

The invention discloses bacillus subtilis with high yield of specific surfactin and a preparation method and application thereof, the bacillus subtilis is obtained by a gene modification method and can produce high yield of C15 component surfactin, and the highest yield can reach 72.5%; the invention also provides an enzyme mutant participating in the production of the surfactin from the bacillus subtilis, wherein the enzyme mutant comprises carboxyl transferase accAD, biotin carboxylase IdeHA, biotin carboxylase accBC and fatty acid peroxygenase cypC; in addition, the invention also provides a preparation method and application of the bacillus subtilis. The bacillus subtilis for high-yield production of specific surfactin and the preparation method thereof provided by the invention are beneficial to increase of the yield of surfactin, especially industrial production and commercial application of C15 component surfactin.

Description

Technical Field

[0001] The invention relates to a microorganism and a preparation method and application thereof, in particular to a Bacillus subtilis and a preparation method and application thereof, belonging to the field of genetic engineering. Background Art

[0002] Biosurfactants are surface-active substances synthesized by microorganisms, which have the advantages of low toxicity, biodegradability, and environmental friendliness. Surfactants are a class of biosurfactants with fatty acid chain and peptide chain structures. They are widely found in nature and are mainly synthesized by Bacillus, such as Bacillus subtilis. Surfactants are composed of a cyclic heptapeptide and a β-hydroxy fatty acid chain (the chain length is usually 13-15 carbon atoms). The hydrophilic peptide chain part and the hydrophobic fatty acid part make surfactants have both biological activity and surface activity, so they are regarded as green alternatives to traditional chemical surfactants. Surfactants can be used to improve the recovery rate of crude oil, and can also be used in emulsions, pharmaceutical preparations, and food. They are particularly suitable for cleaning up oil spills or harmful compound pollution in soil or water bodies. They have antibacterial, antiviral, and anti-tumor capabilities, which also enable them to be used in the pharmaceutical industry and agricultural fields. At present, the production of surfactants mainly depends on microbial fermentation, but the existing production of surfactants is limited, and the proportion of specific surfactants is not high. The low production efficiency greatly limits the promotion and application of surfactants.

[0003] Methods to improve the ability of microorganisms to produce surfactin include strain screening, genetic modification, optimization of culture media and fermentation conditions, etc. Among them, genetic modification methods mainly include promoter engineering, enhanced efflux secretion, modification of NRPS domains and fatty acid chain synthase system and other targeted modification strategies. The fatty acid chain synthase system includes a variety of enzymes, among which carboxyl transferase (accAD) and biotin carboxylase (IdeHA and accBC) are components of the acetyl-CoA carboxylase complex, which catalyzes the reaction of acetyl CoA to malonyl CoA; fatty acid peroxygenase (cypC) is involved in the formation of 3-hydroxy fatty acids, which are used for lipopeptide biosynthesis. These four enzymes are all involved in the synthesis of surfactin in Bacillus subtilis. Wang Miaomiao et al. constructed a high-yield surfactin Bacillus subtilis by strengthening the key genes of fatty acid biosynthesis and all genes of this pathway, and optimized the conditions such as the types and addition amounts of amino acids during the fermentation process, achieving high-level production of surfactin in a 30L fermenter (Construction and Culture Optimization of High-yield Surfactant Recombinant Bacillus subtilis. Journal of Biotechnology, 2020, 36(11): 2377-2386). It can be seen that genetic modification methods can improve the current situation of low surfactin production and low proportion of specific surfactins, thereby promoting the industrial production and commercial application of surfactin. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a Bacillus subtilis obtained by a genetic modification method and capable of producing a high amount of C15 component surfactin. The present invention also provides an enzyme mutant involved in the production of surfactin by the Bacillus subtilis, as well as a preparation method and application of the Bacillus subtilis.

[0005] Technical solution: The present invention provides a Bacillus subtilis with high production of specific surfactin, comprising carboxyl transferase accAD, biotin carboxylase IdeHA, biotin carboxylase accBC and fatty acid peroxygenase cypC, and the amino acid sequences thereof are shown in SEQ ID NO.1-4 in sequence;

[0006] The 16th amino acid threonine of the carboxyl transferase accAD is mutated to serine;

[0007] or the 16th amino acid threonine of the carboxyltransferase accAD mutates to serine, the 74th amino acid lysine of the biotin carboxylase IdeHA mutates to asparagine and the 125th amino acid alanine mutates to threonine and the 394th amino acid threonine mutates to asparagine, and the 409th amino acid serine of the biotin carboxylase accBC mutates to glycine;

[0008] Or the 16th amino acid threonine of the carboxyltransferase accAD mutates to serine, the 74th amino acid lysine of the biotin carboxylase IdeHA mutates to asparagine and the 125th amino acid alanine mutates to threonine and the 394th amino acid threonine mutates to asparagine, the 409th amino acid serine of the biotin carboxylase accBC mutates to glycine, the 162th amino acid serine of the fatty acid peroxygenase cypC mutates to proline and the 270th amino acid leucine mutates to valine and the 298th amino acid leucine mutates to proline.

[0009] The present invention uses Bacillus subtilis as a chassis cell for gene editing. Site-directed mutation is performed on the amino acid sequence of the carboxyl transferase accAD with a sequence of SEQ ID No.1, the biotin carboxylase IdeHA with a sequence of SEQ ID No.2, the biotin carboxylase accBC with a sequence of SEQ ID No.3, and the fatty acid peroxygenase cypC with a sequence of SEQ ID No.4 in its genome. Since the above four enzymes are all involved in the synthesis of surfactin in Bacillus subtilis, the present invention improves the efficiency of fatty acid synthesis by site-directed modification of carboxyl transferase accAD, biotin carboxylase IdeHA and accBC; by mutating the fatty acid peroxygenase cypC, its specificity for long-chain fatty acids can be changed, thereby providing a new way to produce biological surfactin with specific functions and activities.

[0010] The present invention performs 3D modeling on the above-mentioned carboxyl transferase accAD, biotin carboxylase IdeHA and accBC, and fatty acid peroxygenase cypC, and selects key amino acids around the active center or at the loop position on the protein surface for site-directed mutation. The above-mentioned enzymes in Bacillus subtilis are gene-edited using CRISPR technology: a crRNA sequence is inserted into the pcrF19NM plasmid, which contains mutation site information of Bacillus subtilis acetyl-CoA carboxylase carboxyl transferase accAD, acetyl-CoA carboxylase biotin carboxylase IdeHA and accBC, and fatty acid peroxygenase cypC. The pHT-XCR6 plasmid with Cpf1 gene and the constructed pcrF19NM plasmid, as well as the homologous sequence of the gene recombination template, are sequentially transformed into Bacillus subtilis competent cells. After eliminating the plasmid, after fermentation and high-performance liquid chromatography product detection screening, Bacillus subtilis with improved surfactin production of C15 component is finally obtained. Through gene sequencing, the 16th amino acid threonine of carboxyltransferase accAD mutated to serine; the 74th amino acid lysine of biotin carboxylase IdeHA mutated to asparagine, and the 125th amino acid alanine mutated to threonine, and the 394th amino acid threonine mutated to asparagine; the 409th amino acid serine of biotin carboxylase accBC mutated to glycine; the 162th amino acid serine of fatty acid peroxygenase cypC mutated to proline, and the 270th amino acid leucine mutated to valine, and the 298th amino acid leucine mutated to proline.

[0011] The present invention also provides a method for preparing the Bacillus subtilis, comprising the following steps:

[0012] Step 1: Prepare Bacillus subtilis competent cells;

[0013] Step 2: transforming the first recombinant plasmid into the competent cells obtained in step 1 to obtain recombinant cells; the first recombinant plasmid can express a protein with DNA double-strand excision activity;

[0014] Step 3: constructing a second recombinant plasmid; the second recombinant plasmid contains the information of the mutation;

[0015] Step 4: constructing homologous fragments; the homologous fragments contain primer sequences;

[0016] Step 5: transforming the second recombinant plasmid and the homologous fragment into the recombinant cell obtained in step 2 to obtain the Bacillus subtilis.

[0017] Preferably, in step 2, the first recombinant plasmid is a pHT-XCR6 plasmid.

[0018] Furthermore, in step 2, the protein having DNA double-strand resection activity is Cpf1.

[0019] Preferably, in step 3, the second recombinant plasmid is pcrF19NM plasmid.

[0020] Furthermore, in step 3, the second recombinant plasmid contains a crRNA sequence.

[0021] Furthermore, the crRNA sequence is:

[0022] crRNA name Sequence (5'-3') accAD-T16 GGCGATTTTGGTTTGCAGTTCAATC IdeHA-K74 CGCGTCGGCTTTTGCTTTTTTC IdeHA-A125 GACACCTGCAGCCTCCATTGC IdeHA-T394 CTGTTCTGGTTTGGCCTTTG accBC-S409 CGAATTCGCTCAATGCGCGC cypC-S162 GAAAACGACTTCCGGAACAGCGCTG cypC-L270 GCTTGATTTATATGGAACGAAC cypC-L298 GGAAGAAAATCTGTTTGATATG

[0023] Further, in step 4, the primer sequence is:

[0024]

[0025]

[0026] The present invention also provides a carboxyl transferase accAD mutant of the Bacillus subtilis, and its amino acid sequence is shown in SEQ ID NO.5.

[0027] The present invention also provides a biotin carboxylase IdeHA mutant of the Bacillus subtilis, and its amino acid sequence is shown in SEQ ID NO.6.

[0028] The present invention also provides a biotin carboxylase accBC mutant of the Bacillus subtilis, and its amino acid sequence is shown in SEQ ID NO.7.

[0029] The present invention also provides a fatty acid peroxygenase cypC mutant of the Bacillus subtilis, and its amino acid sequence is shown in SEQ ID NO.8.

[0030] The invention also provides an application of the Bacillus subtilis in producing surfactin.

[0031] Preferably, the surfactin is C15 component surfactin.

[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The Bacillus subtilis provided by the present invention has a high surfactin yield, and the proportion of the C15 component surfactin is greatly increased; 2. The present invention screens out carboxyltransferase accAD, biotin carboxylase IdeHA and accBC mutants, and fatty acid peroxygenase cypC mutant that assist Bacillus subtilis in high surfactin production through site-directed mutagenesis of key enzymes involved in the synthesis of surfactin by Bacillus subtilis; 3. The present invention also provides a preparation method and application of the Bacillus subtilis, which is helpful to realize the industrial production and commercial application of surfactin. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is a schematic diagram of the protein structure of carboxyl transferase accAD;

[0034] Figure 2 Schematic diagram of the protein structure of biotin carboxylase IdeHA;

[0035] Figure 3 The schematic diagram of the protein structure of biotin carboxylase accBC;

[0036] Figure 4 This is a schematic diagram of the protein structure of fatty acid peroxygenase cypC;

[0037] Figure 5 is the chromatogram of surfactin in the fermentation broth of wild-type Bacillus subtilis;

[0038] Figure 6 This is a chromatogram of surfactin in the fermentation broth of Bacillus subtilis ZT-3 with high production of specific surfactin provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0039] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0040] Example 1: A Bacillus subtilis strain that produces high levels of specific surfactant

[0041] In this example, Bacillus subtilis carrying a carboxyltransferase accAD mutant is first constructed through steps 1-5, and then a strain with high production of specific surfactin is screened out through steps 6-8.

[0042] Step 1. Make competent cells of Bacillus subtilis

[0043] Spread wild-type Bacillus subtilis on LB solid medium and culture at 37°C overnight. Pick a single colony and inoculate it into 4 mL LB liquid medium, culture it at 37°C and 140 rpm for 6 h, wash the cells three times with sterile 10% glycerol solution, and finally resuspend the cells with 0.2 mL 10% glycerol and store them in a -80°C refrigerator for use.

[0044] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0045] Add about 10 ng of plasmid pHT-XCR6 to 0.1 mL of Bacillus subtilis competent cells and place in a pre-cooled electroporation cup for 5 minutes. Electroporate once at 2.0 kV, resuscitate with 1 ml of LB medium for 2 hours, spread on LB solid medium containing 50 ug / mL chloramphenicol, and culture overnight at 37°C. Prepare competent cells in the above manner to obtain Bacillus subtilis competent cells carrying plasmid pHT-XCR6, and store in a -80°C refrigerator for use.

[0046] Step 3. Construction of pcrF19NM plasmid

[0047] The pcrF19NM plasmid contains the mutation site information of carboxyl transferase accAD and is inserted between the DR2 elements. The crRNA sequence with targeting function is shown in Table 1.

[0048] Table 1 crRNA sequences for carboxyltransferase accAD gene editing

[0049] crRNA name Sequence (5'-3') accAD-T16 GGCGATTTTGGTTTGCAGTTCAATC

[0050] Step 4. Construction of homologous fragments

[0051] The homologous fragments were constructed using a complementary primer annealing procedure, and the primer sequences used are shown in Table 2.

[0052] Table 2 Primer sequences for constructing homologous fragments of carboxyltransferase accAD gene editing

[0053]

[0054] Among them, "F" represents the upstream primer, "R" represents the downstream primer, and the underlined sequence is the mutation site.

[0055] The system of annealing PCR is shown in Table 3, and the procedure is shown in Table 4.

[0056] Table 3 Annealing PCR system

[0057] Composition volume 10pmol / μL upstream primer 5μL 10pmol / μL downstream primer 5μL

[0058] Table 4 Annealing PCR program

[0059]

[0060] The resulting PCR product is the homologous fragment.

[0061] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0062] According to the above second step experimental steps, the pcrF19NM plasmid and homologous fragments were transformed into Bacillus subtilis competent cells carrying the plasmid pHT-XCR6, and spread on LB solid medium supplemented with 50ug / mL chloramphenicol, 50ug / mL kanamycin and 3% xylose, and cultured overnight at 30°C. The grown single colonies can be used for liquid culture and fermentation verification.

[0063] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0064] Pick 48 single colonies of Bacillus subtilis from the plate and inoculate them into 10mL test tubes containing 3ml LB liquid medium, and culture them overnight at 37℃ and 200rpm in a shaking incubator as seed liquid. Add 1ml of seed liquid to 30ml fermentation medium (20g / L glucose, 3g / L tryptone, 3g / L K2HPO4, 10g / L NaH2PO4, 0.02g / LMgSO4, 1g / L L-leucine) and culture them at 37℃ and 200rpm in a shaking incubator for 48h.

[0065] Step 7. Detection of the content and composition of surfactant produced by Bacillus subtilis fermentation.

[0066] Centrifuge the Bacillus subtilis fermentation broth, take 1ml of supernatant, and centrifuge at 12000rpm for 3min. Take 200uL of supernatant, add methanol 3-10 times appropriately, shake thoroughly and centrifuge at 12000rpm for 10min, and the supernatant is the sample to be tested. Use Agilent 1260 high performance liquid chromatography as the detection tool, and the chromatographic column used is Amethyst C18-Hcolumn (5μm, 250×4.6mm). The mobile phase used is 90% methanol and 10% water, and 0.05% trifluoroacetic acid is added, with a flow rate of 0.8mL / min. The injection volume is 20ul. The detection wavelength is 214nm. The surfactin standard is prepared as a gradient concentration and a standard curve is prepared to calculate the surfactin content and composition ratio in the fermentation broth sample. Among the 48 strains of Bacillus subtilis selected in step 6, the strain with the most increased surfactin production in the C15 component is recorded as ZT-1. Figure 5 is the chromatogram of surfactin in the fermentation broth of wild-type Bacillus subtilis, and Table 5 is the content and component ratio of surfactin in the fermentation broth of wild-type Bacillus subtilis and ZT-1.

[0067] Table 5 Surfactant content and component ratio in fermentation broth of wild-type Bacillus subtilis and ZT-1

[0068] Wild-type Bacillus subtilis ZT-1 C13 component 35.2％ 28.2％ C14 component 20.8％ 20.5％ C15 component 44.0％ 51.3％ Total production 0.6g / L 1.1g / L

[0069] Step 8. Genome sequencing of dominant strains

[0070] The genomic DNA of ZT-1 was extracted using a genomic DNA extraction kit for Gram-positive bacteria (Beijing Solebow), and the carboxyl transferase accAD gene on the genome was sequenced. The sequence of the carboxyl transferase accAD mutant of ZT-1 is shown in SEQ ID No. 5, and the 16th amino acid threonine is mutated to serine. The position of the mutation site in the 3D structure of the protein is shown in Figure 1 shown.

[0071] Example 2: A Bacillus subtilis strain that produces high levels of specific surfactant

[0072] Similar to Example 1, in this example, Bacillus subtilis carrying a carboxyltransferase accAD mutant and biotin carboxylase IdeHA and accBC mutants is first constructed through steps 1-5, and then a strain with high production of specific surfactin is screened through steps 6-8.

[0073] Step 1. Make competent cells of Bacillus subtilis

[0074] This step is the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced with the strain ZT-1 with the highest surfactin production of the C15 component screened in Example 1.

[0075] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0076] This step is the same as step 2 of Example 1.

[0077] Step 3. Construction of pcrF19NM plasmid

[0078] This step is the same as step 3 of Example 1, except that the crRNA sequence is changed to that shown in Table 6.

[0079] Table 6 crRNA sequences for biotin carboxylase IdeHA and accBC gene editing

[0080] crRNA name Sequence (5'-3') IdeHA-K74 CGCGTCGGCTTTTGCTTTTTTC IdeHA-A125 GACACCTGCAGCCTCCATTGC IdeHA-T394 CTGTTCTGGTTTGGCCTTTG accBC-S409 CGAATTCGCTCAATGCGCGC

[0081] Step 4. Construction of homologous fragments

[0082] This step is the same as step 4 of Example 1, except that the homologous fragment construction primer sequence is changed to that shown in Table 7.

[0083] Table 7 Primer sequences for constructing homologous fragments of biotin carboxylase IdeHA and accBC gene editing

[0084]

[0085] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0086] This step is the same as step 5 of Example 1, except that picking 48 single colonies is changed to picking 192 single colonies.

[0087] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0088] This step is the same as step 6 of Example 1.

[0089] Step 7. Detection of the content and composition of surfactant produced by Bacillus subtilis fermentation.

[0090] This step is the same as step 7 of Example 1. Among the 192 Bacillus subtilis strains selected in step 6, the strain with the most improved surfactin production of the C15 component was recorded as ZT-2. Table 8 shows the surfactin content and component ratio in the fermentation broth of ZT-2.

[0091] Table 8 Surfactant content and component ratio in ZT-2 fermentation broth

[0092] ZT-2 C13 component 19.8％ C14 component 11.3％ C15 component 68.9％ Total production 1.2g / L

[0093] Step 8. Genome sequencing of dominant strains

[0094] This step is the same as step 8 of Example 1, except that the biotin carboxylase IdeHA and accBC genes of the ZT-2 genome are sequenced. The mutation pattern of the biotin carboxylase IdeHA of ZT-2 is K74N / A125T / T394N, and the sequence is shown in SEQ ID No.6, and the mutation pattern of the biotin carboxylase accBC is S409G, and the sequence is shown in SEQ ID No.7. The position of the mutation site in the 3D structure of the protein is shown in Figure 2 and 3 shown.

[0095] Example 3: A Bacillus subtilis strain that produces high levels of specific surfactant

[0096] Similar to Example 1, in this example, Bacillus subtilis carrying a carboxyltransferase accAD mutant, biotin carboxylase IdeHA and accBC mutants, and a fatty acid peroxygenase cypC mutant was first constructed through steps 1-5, and then a strain with high production of specific surfactin was screened through steps 6-8.

[0097] Step 1. Make competent cells of Bacillus subtilis

[0098] This step is the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced with the strain ZT-2 with the highest surfactin production of the C15 component screened out in Example 2.

[0099] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0100] This step is the same as step 2 of Example 1.

[0101] Step 3. Construction of pcrF19NM plasmid

[0102] This step is the same as step 3 of Example 1, except that the crRNA sequence is changed to that shown in Table 9.

[0103] Table 9 crRNA sequences for fatty acid peroxygenase cypC gene editing

[0104]

[0105]

[0106] Step 4. Construction of homologous fragments

[0107] This step is the same as step 4 of Example 1, except that the homologous fragment construction primer sequence is changed to that shown in Table 10.

[0108] Table 10 Primer sequences for constructing homologous fragments of fatty acid peroxygenase cypC gene editing

[0109]

[0110] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0111] This step is the same as step 5 of Example 1, except that picking 48 single colonies is changed to picking 96 single colonies.

[0112] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0113] This step is the same as step 6 of Example 1.

[0114] Step 7. Detection of the content and composition of surfactant produced by Bacillus subtilis fermentation.

[0115] This step is the same as step 7 of Example 1. Among the 96 strains of Bacillus subtilis selected in step 6, the strain with the most improved surfactin production of the C15 component is recorded as ZT-3. Figure 6is the chromatogram of surfactin in ZT-3 fermentation broth, and Table 11 is the content and component ratio of surfactin in wild-type Bacillus subtilis and ZT-3 fermentation broth.

[0116] Table 11 Surfactant content and component ratio in ZT-3 fermentation broth

[0117]

[0118]

[0119] Step 8. Genome sequencing of dominant strains

[0120] This step is the same as step 8 of Example 1, except that the sequenced gene is the fatty acid peroxygenase cypC gene of the ZT-3 genome. The fatty acid peroxygenase cypC of ZT-3 has a mutation pattern of S162P / L270V / L298P, and the sequence is shown in SEQ ID No. 8. The position of the mutation site in the 3D structure of the protein is shown in Figure 4 shown.

[0121] It can be seen from Tables 5, 8 and 11 that the surfactin production of the ZT-1, ZT-2 and ZT-3 strains constructed in Examples 1-3 is significantly improved compared to that of the wild-type Bacillus subtilis, with the highest increase being 3.5 times. The surfactin proportion of the C15 component is increased from 44.0% to 72.5%, becoming the main product, reflecting that the Bacillus subtilis provided by the present invention effectively increases the production of surfactin in the C15 component.

Claims

1. A Bacillus subtilis with high production of specific surfactant, comprising carboxyl transferase accAD, biotin carboxylase IdeHA, biotin carboxylase accBC and fatty acid peroxygenase cypC, wherein the amino acid sequences are shown in SEQ ID NO.1-4 in sequence; characterized in that: The threonine at position 16 of the carboxyl transferase accAD is mutated to serine; Or the threonine at position 16 of the carboxyltransferase accAD is mutated to serine, the lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, and the threonine at position 394 is mutated to asparagine, and the serine at position 409 of the biotin carboxylase accBC is mutated to glycine; Or the threonine at position 16 of the carboxyltransferase accAD mutates to serine, the lysine at position 74 of the biotin carboxylase IdeHA mutates to asparagine, the alanine at position 125 mutates to threonine, and the threonine at position 394 mutates to asparagine, the serine at position 409 of the biotin carboxylase accBC mutates to glycine, the serine at position 162 of the fatty acid peroxygenase cypC mutates to proline, the leucine at position 270 mutates to valine, and the leucine at position 298 mutates to proline.

2. A method for preparing Bacillus subtilis according to claim 1, characterized in that: The following steps are involved: Step 1: Prepare Bacillus subtilis competent cells; Step 2: transforming the first recombinant plasmid into the competent cells obtained in step 1 to obtain recombinant cells; the first recombinant plasmid can express a protein with DNA double-strand excision activity; Step 3: construct a second recombinant plasmid; the second recombinant plasmid contains the information of the mutation according to claim 1; Step 4: constructing homologous fragments; the homologous fragments contain primer sequences; Step 5: transforming the second recombinant plasmid and the homologous fragment into the recombinant cell obtained in step 2 to obtain the Bacillus subtilis.

3. The preparation method according to claim 2, characterized in that: In step 2, the first recombinant plasmid is pHT-XCR6 plasmid.

4. The preparation method according to claim 2, characterized in that: In step 3, the second recombinant plasmid is pcrF19NM plasmid.

5. A carboxyl transferase accAD mutant of Bacillus subtilis according to claim 1, characterized in that: The amino acid sequence of the carboxyl transferase accAD mutant is shown in SEQ ID NO.

5.

6. A biotin carboxylase IdeHA mutant of Bacillus subtilis according to claim 1, characterized in that: The amino acid sequence of the biotin carboxylase IdeHA mutant is shown in SEQ ID NO.

6.

7. A biotin carboxylase accBC mutant of Bacillus subtilis according to claim 1, characterized in that: The amino acid sequence of the biotin carboxylase accBC mutant is shown in SEQ ID NO.

7.

8. A fatty acid peroxygenase cypC mutant of Bacillus subtilis according to claim 1, characterized in that: The amino acid sequence of the fatty acid peroxygenase cypC mutant is shown in SEQ ID NO.

8.

9. Use of the Bacillus subtilis according to claim 1 in producing surfactin.

10. The use according to claim 9, characterized in that: The surfactant is C15 component surfactant.

Images