Salmonella abortus crp gene deleted strain, construction method thereof and application thereof as attenuated vaccine candidate strain

Abstract

The invention belongs to the field of veterinary biological products, and particularly relates to a donkey source horse salmonella abortus crp gene deleted strain YZUSAL01 delta crp as well as a construction method and application of the donkey source horse salmonella abortus crp gene deleted strain YZUSAL01 delta crp gene deleted strain. The gene deletion strain disclosed by the invention is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20241741. The deletion strain is obtained by knocking out the crp gene of the horse abortion salmonella by utilizing a lambda-Red homologous recombination technology. The virulence of the gene-deleted strain prepared by the invention is obviously reduced, and the gene-deleted strain has good safety. The vaccine has a good challenge immune protection effect on mice, and lays a foundation for attenuated live vaccines of horse salmonella abortus.

Description

Technical Field

[0001] The invention belongs to the field of veterinary biological products, and specifically relates to a crp gene deleted strain of equine Salmonella abortus and a construction method thereof, and an application thereof as a candidate strain of an attenuated vaccine. Background Art

[0002] Salmonella enterica serovar Abortusequi is a Gram-negative bacillus that can cause infectious diseases characterized by abortion in equine animals. Horses and donkeys are the main susceptible animals. The disease in horses is also known as equine paratyphoid. Most pregnant mares do not show obvious clinical symptoms before the onset of the disease. They show symptoms such as mental restlessness, refusal to eat, frequent urination, and bloody fluid from the vagina when they suddenly have abortion. The body temperature of a mare after abortion rises. If a secondary infection occurs, the body temperature reaches about 40 ℃ and systemic symptoms appear. When a pregnant mare aborts, the pathogen is excreted with the aborted fetus, placenta, amniotic fluid and vaginal secretions. The infected male horse can excrete the bacteria with the semen. Foals are often born with pneumonia and enteritis. Horses infected with Salmonella enterica serovar Abortusequi often become pathogen carriers of the bacteria and are usually considered to be the original source of infection in non-epidemic areas. Therefore, horse abortion caused by Salmonella enterica serovar Abortusequi is less and less concerned, and related research at home and abroad is rare, let alone in-depth. It is a neglected infectious disease. Salmonella abortus is mainly spread through contaminated water and food as well as mating. When a mare aborts, it causes environmental pollution, which is difficult to eradicate and will continue to spread among horses. The occurrence of this disease directly affects the number of horses in stock, so it is very necessary to carry out prevention and control of this disease.

[0003] Live attenuated vaccines have the advantages of being easy to use and having good immunogenicity. They also have strong immune effects and a long duration of immunity. They can induce both humoral immunity and cellular immunity in the host. Many studies have shown that live attenuated Salmonella vaccines have a good effect on preventing Salmonella colonization in the host intestine and systemic infection. Due to its many advantages, live attenuated vaccines have become a hot topic in the research of vaccines for various pathogenic bacteria. At present, many domestic institutions have constructed attenuated strains by knocking out virulence genes and applied them in clinical practice, with good results. However, there are few studies on attenuated strains of equine abortion Salmonella. Therefore, it is urgent to provide an attenuated strain of equine abortion Salmonella to prevent equine abortion Salmonella infection. Summary of the invention

[0004] The invention aims to provide a crp gene deleted strain of equine Salmonella abortus and a construction method thereof and an application thereof as a candidate strain of attenuated live vaccine, so as to prevent infection of equine Salmonella abortus.

[0005] In order to achieve the above objectives, the technical solution provided by the present invention is as follows:

[0006] The present invention first provides a crp gene deleted strain of equine abortion Salmonella YZUSAL01Δcrp, characterized in that the gene deleted strain does not contain the crp gene, is deposited in the China Center for Type Culture Collection, has a deposit number of CCTCCNO: M 20241741, a deposit date of August 5, 2024, a deposit location of Wuhan, China, and is classified and named as Salmonella enterica YZUSAL01Δcrp Salmonella enterica YZUSAL01Δcrp.

[0007] Furthermore, the deleted crp gene sequence is shown in SEQ ID NO:1.

[0008] Furthermore, the attenuated strain may also undergo other genetic modifications.

[0009] The other genetic modifications described refer to genetic modifications other than the deletion of the crp gene, which may be modifications of a single target gene or multiple target genes. The target gene is not specific and can be set and modified according to research needs. In theory, it can be genetically modified continuously, and the number of modifications to the target gene can be operated as needed without special restrictions. Genetic modification methods include, but are not limited to, insertion and deletion of target genes.

[0010] The present invention also provides a method for constructing the above-mentioned Salmonella abortus crp gene deleted strain, using PCR technology to amplify a DNA fragment with both ends homologous to the upstream and downstream sequences of the Salmonella abortus crp gene and a chloramphenicol resistance gene in the middle, and electroporating it into YZUSAL01 competent cells containing plasmid pKD46, and after screening, a positive clone YZUSAL01Δcrp::cat replacing crp is obtained, and then electroporating it into a temperature-sensitive plasmid PCP20 to eliminate the chloramphenicol resistance gene, so as to construct the Salmonella abortus gene deleted strain YZUSAL01Δcrp.

[0011] Furthermore, the amplification primers are P1 and P2, the nucleotide sequence of P1 is shown in SEQ ID NO:2, and the nucleotide sequence of P2 is shown in SEQ ID NO:3.

[0012] Furthermore, the identification primers of YZUSAL01Δcrp include crp-F and crp-R; the nucleotide sequence of crp-F is shown in SEQ ID NO:4, and the nucleotide sequence of crp-R is shown in SEQ ID NO:5.

[0013] The present invention also provides the use of the crp gene deleted strain of equine Salmonella abortus in preparing a live attenuated equine Salmonella abortus vaccine or a drug for preventing and treating equine Salmonella abortus infection.

[0014] Furthermore, the equine animal is a horse or a donkey.

[0015] Furthermore, the concentration of the crp gene-deficient strain of Salmonella abortus was 1×10 8 CFU / mL.

[0016] The present invention also provides the use of the above-mentioned equine abortion Salmonella crp gene deletion strain in the preparation of a reagent for enhancing equine abortion Salmonella antibodies.

[0017] The invention also provides a live attenuated vaccine for equine abortion Salmonella infection, comprising the above-mentioned equine abortion Salmonella crp gene deletion strain.

[0018] Beneficial Effects

[0019] The present invention constructs a Salmonella abortus crp gene-deficient attenuated strain YZUSAL01Δcrp, and through animal infection experiments, it is found that the crp deficiency leads to a significant decrease in the bacterial load of Salmonella abortus in the organs. The virulence of YZUSAL01Δcrp is significantly reduced, and mice have no adverse reactions after inoculation, and the safety is excellent.

[0020] The equine Salmonella abortus live vaccine prepared by using the attenuated strain has significantly lower virulence than wild-type equine Salmonella abortus. After vaccination with the equine Salmonella abortus live attenuated vaccine of the present invention, the vaccine has good immunogenicity and immune protection, has no effect on the daily weight gain of pregnant mice after immunization, does not affect the normal growth and development of the mouse group, and can provide 100% protection rate for non-pregnant mice and pregnant mice after immunization. The present invention can be applied to the preparation of commercial attenuated live vaccines against equine Salmonella abortus and the prevention and control of equine Salmonellosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 PCR verification of the Δcrp gene deletion strain of Salmonella abortus YZUSAL01;

[0022] Figure 2 is the growth curve;

[0023] Figure 3 To test the ability of bacteria to colonize the spleen;

[0024] Figure 4 To test the ability of bacteria to colonize in the uterus;

[0025] Figure 5 To test the weight gain of pregnant mice in different immunization groups;

[0026] Figure 6 The figure shows the changes in serum antibody IgG levels after immunization with the gene-deficient strain. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific implementation cases and the accompanying drawings. This implementation case is implemented based on the technology of the present invention, and a detailed implementation method and specific operation process are now given to illustrate that the present invention is creative, but the protection scope of the present invention is not limited to the following embodiments.

[0028] The experimental methods used in the examples, such as molecular biology techniques, antibody level detection, etc., are all conventional methods unless otherwise specified.

[0029] The Salmonella abortus used in the following examples was isolated, identified and preserved in the Department of Surgery, College of Veterinary Medicine, Yangzhou University. The following steps are specific steps for knocking out the crp gene, and the nucleotide sequence of the crp gene is shown in SEQ ID NO.1.

[0030] Example 1

[0031] Construction of a gene-deficient strain of equine Salmonella abortus YZUSAL01Δcrp

[0032] The crp gene deletion strain of Salmonella abortus provided by the present invention is constructed by using Red homologous recombination technology, and specifically comprises the following steps:

[0033] 1.1 PCR primer design

[0034] PCR technology was used to amplify a DNA fragment with homology to the upstream and downstream sequences of the crp gene of Salmonella abortus and a chloramphenicol resistance gene in the middle. Primers P1 and P2 were used for amplification, and primers crp-F and crp-R were used for identification.

[0035] Table 1 Primers for amplification and identification of homology arm fragments of crp gene

[0036]

[0037] 1.2 Amplification and purification of PCR fragments

[0038] Using the auxiliary plasmid pKD3 of λ-Red homologous recombination as a template, P1 and P2 as upstream and downstream primers to amplify the chloramphenicol gene fragment containing the crp homology arm, the reaction system is shown in Table 2:

[0039] Table 2 PCR reaction system

[0040]

[0041] The PCR reaction conditions are as follows:

[0042] Pre-denaturation at 94°C for 4 min; 94°C for 30 s, 52°C for 1 min, 72°C for 1 min, 10 cycles; 94°C for 30 s, 63°C for 1 min, 72°C for 1 min, 25 cycles; extension at 72°C for 10 min. After the reaction, the PCR product size was 1117 bp ( Figure 1 ), and the PCR product was purified using an agarose gel DNA recovery kit.

[0043] 1.3 Preparation of competent cells and transformation of pKD46

[0044] Pick the activated equine abortion Salmonella YZUSAL01 from the LB plate and culture it overnight at 37°C and 160 rpm for 8-12 h. The next day, transfer the overnight cultured strain to fresh LB medium at a ratio of 1:100 and culture it at 30°C and 160 rpm until the OD 600 When the value is 0.4-0.6, dispense the bacterial solution into 50 mL centrifuge tubes, precool on ice for 10 min, centrifuge at 4500 rpm at 4°C for 7 min, collect the precipitate, resuspend with 45 mL of 10% glycerol precooled on ice, centrifuge at 4500 rpm at 4°C for 10 min, resuspend the bacteria with 20 mL of 10% glycerol three times, and finally resuspend with 500 µL of 10% glycerol, dispense 100 µL / tube and freeze at -70°C.

[0045] The next day, 2 µL of the temperature-sensitive plasmid pKD46 was mixed with 100 µL of YZUSAL01 competent cells, and the mixture was added to a 0.1 cm Bio-Rad electrode cup for transformation, with parameters of 2.2 KV, 25 µF pulse, and 200 ohm resistance. Immediately after the electric shock, 1 mL of LB medium was added, and the culture was cultured at 30 °C and 150 rpm for 10 min, then taken out, centrifuged at 4000 rpm for 5 min at room temperature, and spread on an LB plate containing ampicillin resistance (100 µg / mL), and cultured overnight at 30 °C to screen the correct positive transformants.

[0046] 1.4 Red recombinase induction and electroporation of chloramphenicol-resistant PCR product fragments

[0047] The correctly identified pKD46 transformation positive colony was inoculated into 4 mL LB liquid medium (containing ampicillin 100 µg / mL) and cultured overnight at 30°C 160 rpm as seed solution. The next day, it was transferred into fresh 45 mL LB liquid medium (containing ampicillin 100 µg / mL) at a ratio of 1:100 and cultured at 30°C 160 rpm until OD 600When the value is 0.2-0.3, add L-arabinose to a final concentration of 30 mmol / L and induce for 1 h to allow pKD46 to fully express the three recombinant enzymes Exo, Bet, and Gam. After the induction, the bacterial solution was dispensed into 50 mL centrifuge tubes, precooled on ice for 10 min, centrifuged at 4500 rpm at 4 ℃ for 7 min, and the precipitate was collected. Resuspend with 45 mL of 10% glycerol precooled on ice, centrifuged at 4500 rpm at 4 ℃ for 10 min, and resuspend the bacteria with 20 mL and 10% glycerol three times in turn, and finally add 500 µL of 10% glycerol to resuspend, and 100 µL / tube was dispensed and frozen at -70 ℃.

[0048] Take 100 µL competent cells, mix with 5 µL (100-300 µg) purified chloramphenicol resistance PCR product fragments containing homology arms, add the mixture to a 0.1 cm Bio-Rad electrode cup for transformation, the parameters are 2.2 KV, pulse 25 µF, resistance 200 ohms. After electroporation, quickly add to 1 mL of LB medium, culture at 30 ℃ 160 rpm for 1 hour, centrifuge at room temperature 4000 rpm for 5 min, spread on LB plates containing chloramphenicol resistance (34 µg / mL) and ampicillin resistance (100 µg / mL), and culture at 30 ℃ overnight to screen the correct positive transformants.

[0049] 1.5 PCR identification of the primary homologous recombinant strain YZUSAL01Δcrp::cat

[0050] The above positive transformants were inoculated into LB liquid medium and cultured overnight at 30 ℃ and 160 rpm. The next day, the template was prepared by boiling method (1 mL of bacterial culture was collected, centrifuged to remove the supernatant, and washed 2-3 times with 1 mL of ultrapure water, and finally resuspended in 200 µL ultrapure water, boiled in boiling water for 10 min, cooled, centrifuged at 12000 rpm for 10 min, and the supernatant was used as the PCR reaction template) for PCR amplification and identification.

[0051] PCR identification was performed using crp-F and crp-R as primers. The PCR reaction conditions were: 95 ℃ pre-denaturation for 3 min; 95 ℃ 1 min, 57.5 ℃ 1 min, 72 ℃ 1 min, 30 cycles; 72 ℃ extension for 10 min; PCR amplification conditions were referred to Table 3. 5 μL of PCR reaction product was taken to detect the amplification result by agarose gel electrophoresis. The size of the amplified product of the correct positive transformant detected by agarose gel electrophoresis was 1340 bp ( Figure 1 The correct positive transformant was identified and named pKD46 to YZUSAL01Δcrp::cat.

[0052] Table 3 PCR amplification reaction system

[0053]

[0054] 1.6 Elimination of plasmid pKD46

[0055] The correctly identified transformant pKD46 to YZUSAL01Δcrp::cat was inoculated into LB liquid culture medium, cultured at 42 ℃ 150 rpm for 6~8 h, and transferred into fresh LB liquid culture medium at 1:100. This step was repeated 2~3 times. The obtained bacteria were streaked on LB plates, and single colonies were picked for chloramphenicol resistance and ampicillin resistance tests. The single clone that was stably resistant to chloramphenicol and sensitive to ampicillin was picked, which was the primary homologous recombinant bacteria that eliminated the pKD46 plasmid and was named YZUSAL01Δcrp::cat.

[0056] 1.7 FLP site-specific recombination

[0057] Prepare electroporation competent cells of YZUSAL01Δcrp::cat, electroporation into plasmid pCP20 encoding FLP site-specific recombinase, and plate on LB plates containing chloramphenicol resistance (34 µg / mL) and ampicillin resistance (100 µg / mL), culture overnight at 30°C, and screen positive transformants. Then transfer the obtained positive transformants to LB without any resistance, culture at 42°C for several hours to eliminate the temperature-sensitive plasmid pCP20, transfer to ordinary LB liquid culture medium, repeat this twice, and then streak culture at 37°C to isolate single colonies, test each single colony for ampicillin and chloramphenicol resistance, screen mutants sensitive to both antibiotics, and name the gene-deficient strain YZUSAL01Δcrp.

[0058] 1.8 PCR identification of secondary homologous recombinant bacteria

[0059] The YZUSAL01Δcrp genomic template was prepared and PCR amplification was performed using the identification primers crp-F and crp-R. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 5 min; 25 cycles of 94°C for 30 s, 57.5°C for 30 s, and 72°C for 1 min; and extension at 72°C for 10 min.

[0060] 5 μL of PCR reaction product was subjected to agarose gel electrophoresis, and the band size was 323 bp ( Figure 1 ). This indicates that the deletion strain was identified correctly.

[0061] Example 2: Safety evaluation of the attenuated equine Salmonella abortus vaccine candidate strain YZUSAL01Δcrp

[0062] 2.1 Determination of the growth curve of the attenuated equine Salmonella abortus vaccine candidate strain YZUSAL01Δcrp

[0063] The YZUSAL01Δcrp mutant and wild-type YZUSAL01 were cultured at 37°C until the mid-logarithmic growth phase (OD 600 =1.0), transferred into fresh LB liquid medium at a ratio of 1:100, and measured OD every hour. 600 , record the data, and draw a growth curve based on the data. Compared with the wild-type strain, the growth rate of the deletion strain is significantly reduced ( Figure 2 ).

[0064] 2.2 Determination of median lethal dose

[0065] The wild-type strain YZUSAL01 and mutant strain YZUSAL01Δcrp of Salmonella abortus were intraperitoneally injected and inoculated into 6-week-old Balb / C mice, and PBS was intraperitoneally injected as a healthy control group. Compared with Salmonella abortus YZUSAL01, the median lethal dose of the gene-deficient strain YZUSAL01Δcrp was significantly increased and the virulence was significantly reduced.

[0066] As shown in Table 4, the LD of wild strain YZUSAL01 50 is 3.36×10 5 CFU, LD of YZUSAL01Δcrp 50 7.3×10 8 CFU, the attenuation factor is 2173 times.

[0067] Table 4 Determination of median lethal dose of each strain

[0068]

[0069] 2.3 Detection of the ability of strains to colonize in vivo

[0070] The results of bacterial load in the spleen of mice after inoculation of equine abortion Salmonella strains YZUSAL01 and YZUSAL01Δcrp are as follows Figure 3 Shown: Deletion strain YZUSAL01Δcrp 10 8 The spleen bacterial load of the group was higher than that of YZUSAL01Δcrp 10 on days 7 and 14. 6 and YZUSAL01Δcrp 10 7 Compared with the 14th, 21st, and 28th days after inoculation, the bacterial load in the spleen of mice in the deletion strain group reached a peak on the 7th day after inoculation, and bacteria could still be isolated in the spleen on the 14th day after the second vaccination, indicating that the deletion strain YZUSAL01Δcrp would not be quickly cleared by the body after inoculation.

[0071] The results of bacterial load in the uterus of mice after inoculation of equine abortion Salmonella strains YZUSAL01 and YZUSAL01Δcrp are as follows: Figure 4 As shown: 7-14 days after vaccination, the bacterial load in the uterus of mice showed a downward trend, the bacterial load in the uterus of the high-dose immunization group was higher than that of the low-dose immunization group, and the bacterial load in the uterus of different immunization groups reached a peak on the 7th day. Bacteria can still be isolated in the uterus on the 14th day after the second vaccination, indicating that the deletion strain YZUSAL01Δcrp will not be quickly cleared by the body after vaccination.

[0072] 2.4 Observation of clinical symptoms in mice

[0073] Equine Salmonella abortus YZUSAL01Δcrp 10 6 CFU / 0.2 mL, 10 7 CFU / 0.2 mL, 10 8 After intraperitoneal inoculation with CFU / 0.2 mL and PBS / 0.2 mL, the mice were in good mental state, and their diet and drinking water were normal, with no significant difference compared with those with PBS.

[0074] 2.5 Effect on weight gain of pregnant mice

[0075] The pregnant mice in different immunization groups were weighed on days 1, 5, 10, and 13 after pregnancy was confirmed. The results showed that there was no significant difference in the weight of pregnant mice in the YZUSAL01Δcrp group and the healthy control group ( Figure 5 ). This indicates that YZUSAL01Δcrp inoculation has no significant effect on the weight gain of mice.

[0076] Example 3: Evaluation of immunogenicity of attenuated equine Salmonella abortus vaccine candidate strain YZUSAL01Δcrp

[0077] 3.1 Sample collection

[0078] Sixty SPF 6-week-old Balb / C female mice were randomly divided into four groups of 15 mice each. YZUSAL01Δcrp strain was used at different doses of 1×10 6 CFU / 0.2 mL, 1×10 7 CFU / 0.2 mL, 1×10 8 CFU / 0.2 mL, PBS / 0.2 mL intraperitoneal immunization. The second immunization was performed on the 14th day after the first immunization, and the immunization dose was the same as the first time. After the first immunization, 3 mice were randomly selected from each group, and blood was collected from the sterile ocular vein once every week and then every 3 days.

[0079] 3.2 Determination of antibody levels in mice immunized with the attenuated equine Salmonella abortus vaccine candidate strain YZUSAL01Δcrp

[0080] During the 4-week continuous immunization period, the antibody levels of all immunized groups were the highest on the third day after the second immunization, and the antibody levels of mice in each immunized group were significantly different from those in the blank group (p<0.05). After that, the antibody level gradually decreased. After the second booster immunization, the antibody level of the deletion strain YZUSAL01Δcrp increased significantly, which was significantly higher than that of the blank group (p<0.05) ( Figure 6 ), the above results indicate that the equine abortion Salmonella crp deletion strain can stimulate a high level of immune response in mice after intraperitoneal inoculation.

[0081] Example 4: Evaluation of the immune protection of the attenuated equine Salmonella abortus vaccine candidate strain YZUSAL01Δcrp

[0082] 4.1 Evaluation results of the protective efficacy of challenge in non-pregnant mice

[0083] Mice were immunized with different doses of YZUSAL01Δcrp strain for 14 days and then 5×10 6 / 0.2 mL lethal dose of YZUSAL01 strain was used for virus attack. The results of the protection experiment were: all mice in the PBS group died within seven days. All three immunization groups with different gradients survived, and no mice died in the immunization group on the fourteenth day. The experimental results showed that the virulence of Salmonella abortus was reduced after the deletion of crp. After immunization with different doses of YZUSAL01Δcrp deletion strain, mice could be provided with 100% protection rate under the lethal strong toxicity of YZUSAL01. Combined with the antibody level in the mice after immunization, 1×10 8 CFU is the optimal immune dose.

[0084] Table 5 The immune protection of candidate vaccine strains against Salmonella equi infection in non-pregnant mice

[0085]

[0086] 4.2 Evaluation results of protective efficacy of challenge in pregnant mice

[0087] Twelve SPF 6-week-old Balb / C female mice were randomly divided into two groups of 6 mice each. The YZUSAL01Δcrp strain was used at a rate of 1×10 8 CFU / 0.2mL was immunized intraperitoneally, and the control group was injected intraperitoneally with PBS. A second immunization was performed 14 days after the first immunization, with the same immunization dose as the first. On the seventh day after the second immunization, male mice were caged together, with a cage ratio of female to male of 2:1. When pregnancy was confirmed, 2×10 wild-type mice were injected subcutaneously on the back three days after the pregnancy. 8 CFU / mouse. The results showed that YZUSAL01Δcrp could provide 100% protection for pregnant mice.

[0088] According to the verification results of the above examples, the gene-knockout equine Salmonella abortus of the present invention has excellent immune protection effect and can be used as a vaccine. Further, this example provides a Salmonella abortus equine vaccine, the components of which include the Salmonella abortus equine Salmonella knockout crp gene of the present invention, and the concentration of the gene-knockout equine Salmonella abortus in the intraperitoneal vaccine can be 1×10 8 CFU / mL.

[0089] The attenuated live vaccine strain of Salmonella constructed by this method has low toxicity and high safety. After immunization, it has no effect on the normal growth and development of mice, does not affect the daily weight gain of the mouse group, and can achieve 100% immune protection against virus attack in 6-week-old mice after immunization, with a high protective effect.

[0090] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention is described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents, and these modifications or replacements should also be considered as the protection scope of the present invention. Any slight changes, equivalent modifications or changes made by those skilled in the art without departing from the spirit and technical ideas disclosed by the present invention still fall within the scope of the claims of the present invention.

[0091] SEQ ID NO:1

[0092] TTAACGGGTGCCGTAGACGACGATGGTCTTGCCATGCGCGGAGATCAGGTTTTGATCTTCCAGCATTTTCAAAATACGACCAACGGTTTCGCGGGAGCAGCCGACGATCTGGCCAATTTCCTGACGGGTGATTTTGATCTGCATCCCATCCGGGTGCGTCATGGCATCGGGCTGTTTCGCCAGATTCAGCAGCGTCTGAGCGATACGCCCGGTGACGTCAAGGAAGGCGAGGTTACCTACTTTTTCAGAGGTGACTTGTAAGCGACGAGCCATCTGGGAAGAGAGGCGCATCAGAATATCCGGGTTGACCTGGATTAATTGGCGAAATTTTTTGTAGGAAATTTCAGCGACCTCACATGCGGTTTTCGCACGTACCCAGGCGCTGCGTTCCTGGCCTTCTTCAAACAGGCCCAGTTCACCAATAAAATCACCCTGATTCAGATAAGAAAGGATCATTTCTTTCCCTTCTTCATCTTTGATCAGCACTGCCACGGAGCCTTTAACGATGTAGTACAGCGTTTCTGCTTTTTCACCCTGGTGAATCAGCGTGCTCTTTGACGGGTACTTATGAATGTGGCAATGAGACAAGAACCATTCAAGAGTCGGGTCTGTTTGCGGTTTGCCAAGCACCAT;

[0093] SEQ ID NO:2

[0094] TGCAGAGGACATCACATTACAGGCTACAATCTATTTTCGTAGCCCCCTTCTGTGTAGGCTGGAGCTGCTTCG;

[0095] SEQ ID NO:3

[0096] TGCGCGGAGATCAGGTTTTGATCTTCCAGCATTTTCAAAATACGACCAACCATATGAATATCCTCCTTAG;

[0097] SEQ ID NO:4

[0098] ACATCACATTACAGGCTACA;

[0099] SEQ ID NO.5

[0100] TGCCGTAATTAATCTCTGGGT。

Claims

1. A strain of Salmonella abortus crp gene deletion, characterized in that: The deletion strain knocks out the crp gene of equine abortion Salmonella YZUSAL01 and is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 20241741, the deposit date is August 5, 2024, and the deposit location is Wuhan, China.

2. The equine Salmonella abortus crp gene deletion strain according to claim 1, characterized in that: The sequence of the crp gene is shown in SEQ ID NO:

1.

3. The method for constructing the crp gene deletion strain of Salmonella abortus according to claim 1, characterized in that: PCR technology was used to amplify a DNA fragment with homology to the upstream and downstream sequences of the crp gene of Salmonella abortus equi at both ends and a chloramphenicol resistance gene in the middle. The cells were transformed into YZUSAL01 competent cells containing plasmid pKD46 by electroporation, and the positive clone YZUSAL01Δcrp::cat with crp replaced was obtained after screening. The clone was then electroporated into the temperature-sensitive plasmid pCP20 to eliminate the chloramphenicol resistance gene, and the target strain Salmonella abortus crp gene deletion strain was obtained.

4. The method for constructing the crp gene deletion strain of Salmonella abortus according to claim 3, characterized in that: The amplification primers are P1 and P2, the nucleotide sequence of P1 is shown in SEQ ID NO:2, and the nucleotide sequence of P2 is shown in SEQ ID NO:

3.

5. The method for constructing the crp gene deletion strain of Salmonella abortus according to claim 3, characterized in that: The identification primers of YZUSAL01Δcrp include crp-F and crp-R; the nucleotide sequence of crp-F is shown in SEQ ID NO:4, and the nucleotide sequence of crp-R is shown in SEQ ID NO:

5.

6. Use of the crp gene-deficient strain of Salmonella abortus according to claim 1 or 2 in preparing a live Salmonella abortus vaccine for equine animals or in preparing a drug for preventing and treating Salmonella abortus infection.

7. The use according to claim 6, characterized in that: The equine animal is a horse or a donkey.

8. The use according to claim 6, characterized in that: The concentration of the crp gene-deficient strain of Salmonella abortus was 1×10 8 CFU / mL.

9. Use of the crp gene-deficient strain of equine Salmonella abortus according to claim 1 or 2 in the preparation of a reagent for enhancing antibodies against equine Salmonella abortus.

10. A live attenuated vaccine for equine abortion salmonellosis, characterized in that: It includes the crp gene deleted strain of equine abortion Salmonella according to claim 1 or 2.

Images