Method for biocatalytic synthesis of optically pure 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids

By modifying mutants of fluoroacetic acid dehalogenase, the problem of low efficiency in the preparation of chiral compounds in the existing technology has been solved, and efficient and environmentally friendly biocatalytic synthesis of 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids has been achieved, which are suitable for the manufacture of cosmetics and pharmaceutical intermediates.

CN119752839BActive Publication Date: 2025-09-30HUNAN NORMAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411714030.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-27
Publication Date
2025-09-30
Estimated Expiration
2044-11-27

AI Technical Summary

Technical Problem

Existing chemical methods for preparing chiral compounds have problems such as a shortage of raw materials, low optical purity, low reaction efficiency, expensive reagents and serious environmental pollution. The chiral resolution of α-fluorocarboxylic acids catalyzed by fluoroacetate dehalogenase is not efficient, especially for fatty chain carboxylic acid substrates that do not contain benzene rings.

Method used

By performing single or combined mutations on the W185 and K181 sites of fluoroacetate dehalogenase, fluoroacetate dehalogenase mutants, including K181M, K181S, K181M-W185Y, etc., were developed to improve their catalytic activity towards α-fluorocarboxylic acids, and the reactions were carried out in combination with recombinant microbial cells and biocatalysts.

Benefits of technology

Efficient biocatalytic synthesis of optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids has been achieved, with the advantages of strong selectivity, mild reaction conditions, and environmental friendliness. The substrate conversion rate can reach 50%, the optical purity is greater than 99%, and the cost is low.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752839B_ABST
    Figure CN119752839B_ABST
Patent Text Reader

Abstract

The invention discloses a method for biocatalytically synthesizing optically pure 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids, and belongs to the field of bioengineering technology. Using α-fluoro acid and / or α-fluoro acid derivatives as substrates, using fluoroacetic acid dehalogenase mutants K181M, K181S, W185G, K181M-W185Y, K181S-W185A, K181S-W185C, K181S-W185G, K181S-W185V as biocatalysts, hydrolysis and defluorination obtain chirally pure 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids and derivatives thereof. The present invention has strong stereoselectivity and simple steps, and solves the problems of low optical purity, low yield and environmental pollution that are widely present in the synthesis of chiral compounds. In addition, the inventive method amplifies the reaction system to gram-level experiments using whole cells as catalysts, obtains products with higher yields and ee values, has low cost, low energy consumption, and is suitable for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a method for biocatalytically synthesizing optically pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid, and belongs to the technical field of bioengineering. Background Art

[0002] Due to their unique stereostructures, chiral compounds often exhibit distinct physicochemical properties and physiological activities. In recent years, they have played a crucial role in new material development, drug design, and fine chemical synthesis. Enzyme catalysis, due to the asymmetric structure of the enzyme's active center, facilitates the recognition of racemates. Under certain conditions, the enzyme can only catalyze the reaction of one enantiomer of the racemate into a different compound, thereby separating the two enantiomers. Fluoroacetate dehalogenase, isolated from microorganisms such as Pseudomonas, Moraxella, Fusarium, and Burkholderia, is primarily used to degrade fluorinated organic compounds.

[0003] 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids are important intermediates in pharmaceuticals, pesticides, and optical materials. Due to their unique optical activity and their role as chiral synthons, they are often used to synthesize more complex compounds. Chirally pure α-hydroxycarboxylic acids can induce exfoliation, significantly improving dry skin, fine wrinkles, and blemishes, leading to their widespread use in the cosmetics industry. Furthermore, chirally pure hydroxycarboxylic acids are also intermediates in the synthesis of chiral pharmaceuticals and pesticides.

[0004] Currently, chemical methods for preparing chiral compounds—that is, using chiral ligands and chemical catalysts (often transition metals) to obtain chirally pure compounds through asymmetric synthesis—are plagued by raw material shortages, low optical purity, and inefficient reactions. Furthermore, these methods face challenges such as expensive reagents, demanding reaction conditions (high temperature, high pressure, and strong acids and bases), and environmental pollution, posing significant challenges to practical industrial production operations and requirements.

[0005] Although previous studies have reported that fluoroacetate dehalogenase can efficiently catalyze the chiral resolution of α-fluorocarboxylic acids, the reported substrates mostly contain benzene rings, and the highest turnover number is 1.4 million, and the efficiency for α-fluorophenylpropionic acid is not high. Mutants that can improve the efficiency of fluoroacetate dehalogenase in the chiral resolution of α-fluorocarboxylic acids are urgently needed. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the above-mentioned shortcomings of the prior art and provide a fluoroacetic acid dehalogenase mutant. By performing single or combined mutations at sites W185 and K181, the fluoroacetic acid dehalogenase mutant effectively improves its activity against various α-fluorocarboxylic acids (including fatty chain carboxylic acid substrates without a benzene ring), further promoting its expansion in applications. The fluoroacetic acid dehalogenase mutant of the present invention is used for the efficient biocatalytic synthesis of optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids, and has the advantages of strong selectivity, mild reaction conditions, and environmental friendliness. It is particularly suitable for the production of chemicals such as high-optical-purity 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids.

[0007] The present invention provides a fluoroacetate dehalogenase mutant, wherein the mutant has any of the following mutations based on the fluoroacetate dehalogenase shown in SEQ ID NO. 2:

[0008] (1) Lysine 181 was mutated to methionine to obtain mutant K181M;

[0009] (2) mutating lysine at position 181 to serine to obtain mutant K181S;

[0010] (3) mutating lysine at position 181 to methionine and tryptophan at position 185 to tyrosine to obtain the mutant K181M-W185Y;

[0011] (4) mutating lysine at position 181 to serine and tryptophan at position 185 to alanine to obtain the mutant K181S-W185A;

[0012] (5) Lysine at position 181 was mutated to serine, and tryptophan at position 185 was mutated to cysteine ​​to obtain the mutant K181S-W185C;

[0013] (6) Lysine at position 181 was mutated to serine, and tryptophan at position 185 was mutated to glycine to obtain the mutant K181S-W185G;

[0014] (7) Lysine at position 181 was mutated to serine, and tryptophan at position 185 was mutated to valine to obtain the mutant K181S-W185V.

[0015] The present invention also provides a gene encoding the fluoroacetate dehalogenase mutant.

[0016] The present invention also provides an expression vector containing the gene.

[0017] In one embodiment, the expression vector of the fluoroacetate dehalogenase includes but is not limited to pET28a, pET30a or pBAD containing a sumo tag.

[0018] The present invention also provides a recombinant microbial cell expressing the fluoroacetate dehalogenase mutant.

[0019] The present invention also provides a recombinant Escherichia coli expressing the fluoroacetate dehalogenase mutant, wherein the host of the recombinant Escherichia coli includes but is not limited to BL21 (DE3), Top10 or Rosetta.

[0020] The present invention also provides a method for biocatalytically synthesizing optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids, comprising the following steps: (1) transferring a gene containing a target fluoroacetic acid dehalogenase mutant into an expression strain and culturing the strain for expression; (2) collecting the expressed whole cells or cell-free extracts or pure enzymes (which can be directly in the form of wet cells or freeze-dried powder) as biocatalysts; (3) using α-fluorocarboxylic acid or an α-fluorocarboxylic acid derivative as a substrate, directly adding the biocatalyst, and reacting in a tris(hydroxymethyl)aminomethane-sulfuric acid buffer or other buffers with a similar pH value to obtain a reaction solution; (4) acidifying the reaction solution, adding an extractant to extract the solution, and obtaining an extract solution; and (5) subjecting the extract solution to chromatographic separation to obtain chirally pure 2R-hydroxycarboxylic acids and 2R-fluorocarboxylic acids.

[0021] In one embodiment, when α-fluorocarboxylic acid is used as a substrate, the reaction formula is as shown in formula (I).

[0022]

[0023] Furthermore, the biocatalyst in step (1) is a double mutant of the K181 and W185 sites in the defluorinase RPA1163 or a similar protease having the amino acid sequence of fluoroacetate dehalogenase.

[0024] Furthermore, the biocatalytic synthesis reaction system in step (3) is: pH = 6.5-8.7, 30-100° C., in a 30-100 mM tris(hydroxymethyl)aminomethane-sulfuric acid buffer system, the mass ratio of substrate to biocatalyst is 50-10000:1, the stirring speed is controlled at 100-1200 rpm, and the reaction time is 1-24 h.

[0025] Furthermore, when the RPA1163 mutant is used as a biocatalyst, the amount of the biocatalyst used per liter of reaction solution is 10 to 50 g.

[0026] Furthermore, the extract in step (5) is separated by column chromatography to obtain chirally pure 2R-hydroxycarboxylic acid and 2R-fluorocarboxylic acid.

[0027] Furthermore, the α-fluorocarboxylic acid derivatives in step (3) include benzene rings, naphthalene rings and fatty chain compounds.

[0028] The biocatalyst fluoroacetate dehalogenase used in the present invention is an enzyme isolated from Pseudomonas, Moraxella, Fusarium, Burkholderia, etc. The fluoroacetate dehalogenase is responsible for cleaving the carbon-fluorine bond during the reaction process, and can stereoselectively convert (S)-α-fluorocarboxylic acid, remove the fluorine atom to form 2R-hydroxycarboxylic acid, thereby achieving chiral resolution of α-fluorocarboxylic acid and obtaining chirally pure 2R-hydroxycarboxylic acid and 2R-fluorocarboxylic acid.

[0029] The present invention also provides use of the fluoroacetic acid dehalogenase mutant, the recombinant microbial cell, or the recombinant Escherichia coli in catalyzing α-fluorocarboxylic acids and their derivatives.

[0030] Beneficial effects:

[0031] The present invention provides a fluoroacetate dehalogenase mutant, wherein the activity of the mutant is more than 50 times that of the wild type.

[0032] The present invention also provides a method for biocatalytically synthesizing optically pure 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids using the mutant. The method uses α-fluoroacetic acid or its derivatives as a substrate. Not only is the process route simple, the reaction conditions are mild, and there is no pollution, but within a certain range, high-concentration accumulation of optically active 2R-fluorocarboxylic acids and 2R-hydroxycarboxylic acids can be achieved by continuously controlling the addition of fluoroacetic acid dehalogenase. The substrate conversion rate can be as high as 50%, and the ee value is greater than 99%. The method is low in cost and low in energy consumption. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a protein gel comparison of fluoroacetate dehalogenase (lane 1: protein marker, lane 2: RPA1163-WT, lane 3: K181M-W185Y; lane 4: K181S-W185A; lane 5: K181S-W185C; lane 6: K181S-W185G; lane 7: K181S-W185V;

[0034] Figure 2 This is the gas chromatogram after esterification of substrate 1a with enzyme reaction solution (from bottom to top are pure enzyme, reaction solution, pure substrate, pure S-configuration product, and pure product chromatogram);

[0035] Figure 3 This is the gas chromatogram after esterification of substrate 1b with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0036] Figure 4 This is the gas chromatogram after esterification of substrate 1c with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0037] Figure 5 This is the gas chromatogram after esterification of substrate 1d with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0038] Figure 6 This is the gas chromatogram after esterification of substrate 1e with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0039] Figure 7 This is the gas chromatogram after the esterification of substrate 1f with the enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0040] Figure 8 This is the gas chromatogram after esterification of 1g of substrate with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0041] Figure 9 This is the gas chromatogram after the substrate is esterified with the enzyme reaction solution for 1 hour (from bottom to top, the chromatograms are pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0042] Figure 10 This is the gas chromatogram after esterification of substrate 1i with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0043] Figure 11 This is the gas chromatogram after esterification of substrate 1j with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0044] Figure 12 This is the gas chromatogram after the esterification of substrate 1k with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0045] Figure 13 This is the gas chromatogram after esterification of substrate 1l with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0046] Figure 14 This is the gas chromatogram after the esterification of substrate 1m with the enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0047] Figure 15This is the gas chromatogram after the substrate 1n is esterified with the enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0048] Figure 16 This is the gas chromatogram after the esterification of substrate 1o with the enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0049] Figure 17 This is the gas chromatogram after the esterification of substrate 1p with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0050] Figure 18 This is the gas chromatogram after esterification of substrate 1q with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure product, and pure S-configuration product);

[0051] Figure 19 This is the gas chromatogram after esterification of substrate 1r with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, and pure R-configuration product);

[0052] Figure 20 This is the gas chromatogram after the esterification of substrate 1s with the enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0053] Figure 21 This is the gas chromatogram after esterification of substrate 1t with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, pure product, and pure R-configuration product);

[0054] Figure 22 This is the gas chromatogram after the esterification of substrate 1u with enzyme reaction solution (from bottom to top are the chromatograms of pure enzyme, reaction solution, pure substrate, pure R-configuration substrate, and pure R-configuration product);

[0055] Figure 23 is the H NMR spectrum of substrate 1a;

[0056] Figure 24 is the C NMR spectrum of substrate 1a;

[0057] Figure 25 is the NMR fluorine spectrum of substrate 1a;

[0058] Figure 26 is the H NMR spectrum of substrate 1q;

[0059] Figure 27 is the C NMR spectrum of substrate 1q;

[0060] Figure 28This is the NMR fluorine spectrum of substrate 1q;

[0061] Figure 29 is the H NMR spectrum of substrate 4q;

[0062] Figure 30 This is the C NMR spectrum of substrate 4q;

[0063] Figure 31 is the H NMR spectrum of substrate 1r;

[0064] Figure 32 is the C NMR spectrum of substrate 1r;

[0065] Figure 33 is the NMR fluorine spectrum of substrate 1r;

[0066] Figure 34 is the substrate spectrum of the fluoroacetate dehalogenase mutant. DETAILED DESCRIPTION

[0067] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0068] Unless otherwise specified, the chemical reagents used in the embodiments of the present invention were obtained through conventional commercial channels.

[0069] The culture medium and buffer solution formula used in the examples are:

[0070] LB broth solid medium formula (1 L): yeast powder (Sangon Biotechnology Co., Ltd.) 5 g, peptone (Sangon Biotechnology Co., Ltd.) 10 g, sodium chloride (Shanghai Zhanyun Chemical Co., Ltd.) 10 g, agar (Sangon Biotechnology Co., Ltd.) 15 g.

[0071] Super broth medium formula (1 L): yeast powder (Sangon Biotechnology Co., Ltd.) 24 g, peptone (Sangon Biotechnology Co., Ltd.) 12 g, glycerol (Sangon Biotechnology Co., Ltd.) 4 mL.

[0072] Example 1 Construction and expression of fluoroacetate dehalogenase recombinant Escherichia coli

[0073] (1) Construction of expression plasmid for fluoroacetic acid dehalogenase gene

[0074] The nucleotide sequence encoding the fluoroacetate dehalogenase (shown in SEQ ID No. 1) was cloned or directly synthesized from a plasmid or microorganism containing the gene. The resulting gene was inserted into the NheI restriction site of the pBAD plasmid containing a SUMO tag (the expression vector can also be substituted with a pET series vector, such as pET28a or pET30a), resulting in a recombinant plasmid expressing the wild-type fluoroacetate dehalogenase. The mutation site was introduced by polymerase chain reaction (primers are shown in Table 1) to obtain a recombinant plasmid expressing the mutant.

[0075] Table 1

[0076] Primer name Primer sequences K181S-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCTGGACCCGTGCCGG K181S-R CGGGTCCAGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181M-F GATTTTTATGTTAAAGCAATGCTGGCAAGCTGGACCCGTG K181M-R GTCCAGCTTGCCAGCATTGCTTTAACATAAAAATCCG K181M-W185Y-F GATTTTTATGTTAAAGCAATGCTGGCAAGCTATACCCGTGCCGGTGATCTGAG K181M-W185Y-R CACCGGCACGGGTATAGCTTGCCAGCATTGCTTTAACATAAAAATCCGGATC K181S-W185A-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCGCGACCCGTGCCGGTGATCTGAG K181S-W185A-R CACCGGCACGGGTCGCGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181S-W185C-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCTGCACCCGTGCCGGTGATCTGAG K181S-W185C-R CACCGGCACGGGTGCAGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181S-W185G-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCGGCACCCGTGCCGGTGATCTGAG K181S-W185G-G CACCGGCACGGGTGCCGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC K181S-W185V-F GATTTTTATGTTAAAGCAAGCCTGGCAAGCGTGACCCGTGCCGGTGATCTGAG K181S-W185V-G CACCGGCACGGGTCACGCTTGCCAGGCTTGCTTTAACATAAAAATCCGGATC

[0077] (2) Construction and expression of recombinant Escherichia coli fluoroacetate dehalogenase

[0078] The above recombinant plasmids were transformed into Escherichia coli expression strain Top10, and the bacterial solution was spread on LB broth solid medium containing ampicillin and cultured overnight. Single colonies were selected and transferred to super broth medium, and a final concentration of 100 μg mL -1 Ampicillin was added to a final concentration of 100 μg mL -1 Protein expression was induced by L-arabinose and the cells were collected by centrifuge 18 hours later. They were then washed twice with 50 mM tris(hydroxymethyl)aminomethane-sulfuric acid (pH=7.0) buffer solution and freeze-dried.

[0079] The above method was used to construct recombinant Escherichia coli expressing wild-type fluoroacetate dehalogenase WT and recombinant Escherichia coli expressing mutants K181S, K181M, K181M-W185Y, K181S-W185A, K181S-W185C, K181S-W185G, and K181S-W185V.

[0080] Example 2 Purification and Enzymatic Characterization of Fluoroacetate Dehalogenase

[0081] The corresponding enzyme was purified by nucleophilic chromatography. The protein gel comparison of fluoroacetate dehalogenase is shown in the figure below. Figure 1 shown.

[0082] The enzyme's turnover number (TON) is the ratio of the product concentration to the enzyme concentration after the reaction is complete. In this patent, this number is determined by measuring the concentration of the converted S-configuration substrate and comparing it to the concentration of the enzyme used. The assay method involves fixing the enzyme concentration and adjusting the substrate concentration. When the S-configuration substrate conversion rate is approximately 80%, the assay can be used. Three or more parallel experiments are performed, and the data are averaged. Wild-type and mutant reactions are performed simultaneously. For some substrates, the wild-type is inhibited in the presence of high substrate concentrations, resulting in slight differences in the corresponding substrate concentrations. The reaction is carried out in 50 mM tris-H2SO4 (pH = 7.0), at a temperature of 60°C, for 7 hours. After the reaction is complete, 100 μL of the reaction solution is added, 10 μL of concentrated hydrochloric acid is added, 300 μL of ethyl acetate is added, and after mixing, 150 μL of the organic phase is taken, 30 μL of (trimethylsilyl)diazomethane and 240 μL of methanol are added. After derivatization at 30°C for 30 minutes, the reaction is monitored by gas chromatography.

[0083] The reaction solution derivatization reaction formula is shown in formula (II)

[0084]

[0085] The substrates involved in this embodiment include 1a-1u ( Figure 34 ), and the corresponding α-fluorocarboxylic acid activity was detected using the above method.

[0086] The results, shown in Table 2, show that the single mutant K181S achieved a TON of over 110,000 for 1n, a 21.9-fold increase compared to the wild type. The single mutant K181M achieved a TON of over 150,000 for 1a, a 2-fold increase compared to the wild type. The double mutants involved showed 4-100-fold increases in activity against the same substrates compared to the wild type, and the substrates involved also included aliphatic chains. The mutant K181M-W185Y achieved a TON of over 210,000 for 1a, over 2.8 million for 1q, and over 70,000 for 1r, significantly higher than those reported for the mutants W185N and W185T. Other substrates have not been reported.

[0087] Table 2

[0088]

[0089]

[0090] Note: Bold font represents the mutant with the highest TON number for the same substrate, “nd” represents no activity detected, and “—” represents not tested.

[0091] Example 3 Whole-cell catalysis of α-fluorocarboxylic acid to synthesize optically active 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid

[0092] Using 1a-1u as a substrate and recombinant Escherichia coli whole cells expressing a fluoroacetic acid dehalogenase mutant as a biocatalyst, chiral resolution is performed to obtain chirally pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid, comprising the following steps:

[0093] (1) The whole cells expressing the fluoroacetate dehalogenase mutant in Example 1 were collected and freeze-dried using a freeze dryer.

[0094] (2) Using α-fluorocarboxylic acid as the substrate and the collected whole-cell lyophilized powder as the biocatalyst, the substrate was added to a tris(hydroxymethyl)aminomethane-sulfuric acid buffer at a final concentration of 30 g / L, the pH was adjusted to 7.0, and then lyophilized powder of fluoroacetate dehalogenase mutant cells was added at a final concentration of 10 g / L-20 g / L. The reaction was carried out at 60°C and 220 rpm for 2 h.

[0095] When 1a, 1b, 1g, 1h, 1k, 1p, 1q, 1r or 1t is used as a substrate, the biocatalyst used is the fluoroacetate dehalogenase mutant K181M-W185Y; when 1d is used as a substrate, the biocatalyst used is the fluoroacetate dehalogenase mutant K181S-W185A; when 1d, 1h, 1i, 1j, 1l, 1s or 1u is used as a substrate, the biocatalyst used is the fluoroacetate dehalogenase mutant K181S-W185C; when 1c, 1e, 1l, 1m, 1n or 1o is used as a substrate, the biocatalyst used is the fluoroacetate dehalogenase mutant K181S-W185G; when 1f or 1s is used as a substrate, the biocatalyst used is the fluoroacetate dehalogenase mutant K181S-W185V.

[0096] (3) After the reaction, the system was acidified by adding hydrochloric acid, and then extracted with ethyl acetate. The extracts of 1a-1r and 1t-1u were derivatized and then subjected to gas phase detection. The GC spectrum is shown in the attached Figure 2-19 and Figure 21-22 , 1s is used for liquid phase detection, LC spectrum is attached Figure 20 , the substrate conversion rate is 50% and the ee value is greater than 99%.

[0097] The gas phase detection conditions in the embodiment are:

[0098] 1a-1n / 1t-1u: 100°C–120°C, 5°C / min, 120°C: 3 min, 120°C–220°C, 10°C / min, 220°C: 5 min. Column used: CYCLOSIL-B, 30 m × 0.25 mm ID;

[0099] 1o / 1p / 1r: 100℃: 2min, 100℃~150℃, 3℃ / min, 150℃: 2min, 150℃~200℃, 20℃ / min, 200℃: 2min. Column used: E, 25m×0.25mm ID;

[0100] 1q: 100°C: 2 min, 100°C–160°C, 2°C / min, 160°C: 3 min, 160°C–220°C, 20°C / min, 220°C: 2 min. Column used: CP-Chirasil Dex CB, 25 m × 0.25 mm ID;

[0101] Liquid phase detection conditions in the embodiment:

[0102] 1s: 0-40min, 1mL / min, 14% ethanol / 76% isopropanol (containing 0.1% acetic acid), 254nm. Column used: OJ-H, 4.6Φmm×250m mL.

[0103] (4) 1 / 10 hydrochloric acid was added to the reaction solution of 1b-1p and 1s, and the mixture was extracted three times with ethyl acetate. After being spin-dried, the mixture was dissolved in methanol, 0.1% sulfuric acid was added, and the mixture was stirred in an 80°C oil bath until the reaction was complete. After removing the solvent, the mixture was separated by silica gel column chromatography (PE:EA=10:1) to obtain chirally pure 2R-fluorocarboxylic acid methyl ester and 2R-hydroxycarboxylic acid methyl ester. The separation yield of both products was above 80%, and the enantioselectivity was greater than 99%. 1 / 10 hydrochloric acid was added to the reaction solution of 1t-1u, and the mixture was extracted three times with ethyl acetate. After being spin-dried, the mixture was separated by silica gel column chromatography (PE:EA=3:1) to obtain chirally pure 2R-fluorocarboxylic acid and 2R-hydroxycarboxylic acid. The separation yield of both products was above 80%, and the enantioselectivity was greater than 99%.

[0104] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A fluoroacetate dehalogenase mutant, characterized in that The mutant is selected from the following mutations based on the fluoroacetate dehalogenase shown in SEQ ID NO. 2: (1) Mutate lysine 181 to methionine; (2) mutating lysine 181 to serine; (3) mutating lysine at position 181 to methionine and tryptophan at position 185 to tyrosine; (4) mutating lysine at position 181 to serine and tryptophan at position 185 to alanine; (5) mutating lysine at position 181 to serine and tryptophan at position 185 to cysteine; (6) mutating lysine at position 181 to serine and tryptophan at position 185 to glycine; (7) Lysine at position 181 was mutated to serine, and tryptophan at position 185 was mutated to valine.

2. A gene encoding the fluoroacetate dehalogenase mutant according to claim 1.

3. An expression vector containing the gene according to claim 2.

4. The expression vector according to claim 3, characterized in that The expression vector is selected from pET28a, pET30a or pBAD containing a sumo tag.

5. A recombinant microbial cell expressing the fluoroacetate dehalogenase mutant according to claim 1.

6. A recombinant Escherichia coli expressing the fluoroacetate dehalogenase mutant according to claim 1, characterized in that: The host of the recombinant Escherichia coli is selected from Escherichia coli BL21 (DE3), Top10 or Rosetta.

7. A biocatalytic synthesis of optically pure 2 R -Fluorocarboxylic acid and 2 R -hydroxycarboxylic acid method, characterized in that, α-fluorocarboxylic acid and / or α -fluorocarboxylic acid derivatives as substrates, and the fluoroacetic acid dehalogenase mutant according to claim 1, the recombinant microbial cell according to claim 5, or the recombinant Escherichia coli according to claim 6 as biocatalysts for the reaction.

8. The method according to claim 7, characterized in that React at pH=6.5~8.7, 30~100℃, 100~1200rpm.

9. The method according to claim 7 or 8, characterized in that The α-fluorocarboxylic acid derivatives include benzene rings, naphthalene rings and fatty chain compounds.

10. Use of the fluoroacetate dehalogenase mutant according to claim 1, or the recombinant microbial cell according to claim 5, or the recombinant Escherichia coli according to claim 6 in catalyzing α-fluorocarboxylic acids and their derivatives.

Citation Information

Patent Citations

  • Bio-catalytic method for synthesizing optical activity 2R-fluorocarboxylic acid and 2R-hydroxy carboxylic acid

    CN109468347A

  • Fluoroacetic acid dehalogenase mutant and application thereof

    CN110564706A