A HDR-mediated gene editing screening system

Abstract

The present invention provides a screening tag reporter system based on HDR. The screening tag system of the present invention comprises a CRISPR / Cas9 single guide RNA (gRNA) target site located in a direct repeat sequence of a non-functional selection gene. In the present invention, the CRISPR / Cas9 complex simultaneously targets the target gene site to be edited in the genome and the target site in the screening tag precursor, repairs the screening tag precursor into a complete screening gene and generates screening resistance. The reporter system of the present invention exhibits a wider adaptability and higher screening efficiency for DSB-mediated biological editing events.

Description

Technical Field

[0001] The present invention relates to the field of gene editing. Specifically, the present invention relates to an HDR-mediated gene editing screening system. Background Art

[0002] In recent years, genome editing technology has made significant progress in the field of plant biotechnology. Engineered sequence-specific nucleases (SSNs) generate double-strand breaks (DSBs) at the target DNA site. The repair mechanism of DSBs in eukaryotes is highly conserved. DSBs are repaired through the non-homologous end joining (NHEJ) pathway and the homology-directed repair (HDR) pathway, but the latter is very inefficient in cells, and only when a repair template specific to the broken sequence is provided can DSBs be repaired to the expected sequence through the HDR pathway based on the template sequence. NHEJ repair does not rely on the repair template and directly splices the two DNA ends, but base insertions or deletions (indels) will be generated during the splicing process, and precise editing cannot be achieved. Compared with the NHEJ pathway, HDR-mediated DSBs repair is accurate and can achieve precise fragment knock-in and sequence replacement.

[0003] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / Cas9-associated protein (CRISPR / Cas9) technology has become a versatile, adaptable, and target-specific genome editing tool. It can be programmed to induce DSBs in any targeted genome, thereby achieving various genome modification events such as deletions, insertions, and substitutions. However, due to the low frequency of HDR, gene targeting (GT) remains challenging, especially in higher plants. Therefore, how to efficiently obtain gene editing materials has always been a research difficulty.

[0004] At present, the general experimental process for screening gene editing events is: transgenic technology delivers CRISPR components into cells, relies on the molecular mechanism of the DSB repair pathway in cells to achieve gene editing, and distinguishes whether the transformation is successful through its own screening tags. The general screening tags are hygromycin and Basta resistance screening, and then the genotype of the transformation-positive samples is identified to screen for precise gene editing events. It is well known that gene editing has limited efficiency in cells, and in biological cells, existing screening editing can only be used to distinguish whether the transformation step is successful and effective, and cannot be targeted to enrich and screen cells where editing has occurred. Therefore, there is a need in this field to develop an efficient gene editing screening system.

[0005] Prior art CN109880851A discloses a screening reporter vector and screening method for enriching CRISPR / Cas9-mediated homologous recombination repair cells, wherein the screening reporter vector itself can make cells resistant through homologous recombination repair of resistance gene sequences. However, the gRNAs in the CRISPR / Cas targeting vector and the screening vector used in this system are different from each other and belong to two different vector skeletons. Target gene editing and screening gene repair are two independent processes, and the enrichment efficiency may be affected by the difference in transfection efficiency of each vector. In addition, the screening tag repair in the screening vector depends on the repair template provided in the same vector, that is, the screening tag is functionally repaired by the repair principle of HDR, even after the non-functional resistance screening tag is repaired, its resistance gene homologous recombination repair template is retained. Summary of the invention

[0006] The purpose of the present invention is to provide an efficient gene editing screening system.

[0007] In a first aspect of the present invention, a screening vector for CRISPR / Cas-mediated gene editing is provided, the vector comprising:

[0008] 1) A gRNA expression cassette, wherein the gRNA binds to a target sequence in the genome of the cell to be edited;

[0009] 2) A screening gene expression cassette comprising a screening gene precursor coding sequence having a structure as shown in Formula I below:

[0010] Z0-Z1-T-Z1'-Z2(I)

[0011] In the formula, each “-” is a connecting bond;

[0012] Z0 is the 5′ end coding sequence of the screening gene;

[0013] The Z1 and Z1' fragments are screening gene coding sequence fragments with the same sequence or at least 90% sequence identity, and the length of Z1 and Z1' is 29-400 bp nucleotides;

[0014] T is a sequence that can be recognized by the gRNA;

[0015] Z2 is the 3' end coding sequence of the screening gene.

[0016] In another preferred embodiment, the gene editing is mediated by Cas protein.

[0017] In another preferred embodiment, the Cas protein is Cas9 protein.

[0018] In another preferred embodiment, the screening gene is exogenous to the target cell.

[0019] In another preferred embodiment, the screening gene is selected from the following group: resistance gene, fluorescent protein encoding gene.

[0020] In another preferred embodiment, the resistance gene is selected from the following group: hygromycin phosphotransferase gene (HPT), phosphinothricin acetyltransferase gene (Bar), neomycin phosphotransferase gene (NPTII).

[0021] In another preferred embodiment, the resistance gene is the phosphinothricin acetyltransferase gene (Bar), a herbicide resistance gene.

[0022] In another preferred example, the T fragment in the coding sequence of the screening gene precursor can be recognized and cut by gRNA, and then the screening gene precursor is repaired to a complete screening gene through the single-stranded nucleic acid annealing pathway (SSA).

[0023] In another preferred embodiment, the coding sequence structure of the complete screening gene is as shown in formula (II):

[0024] Z0-Z1-Z2(II)

[0025] wherein each element is as defined in formula I.

[0026] In another preferred embodiment, the screening gene coding sequence is shown as SEQ ID NO:1.

[0027] In another preferred embodiment, the sequence of the T segment contains a stop codon, and preferably, the stop codon is located at the 5' end of the T segment.

[0028] In another preferred embodiment, the nucleotide composition at the 3' end of the T fragment and / or the 5' end of the Z1' fragment corresponds to the PAM sequence of the Cas protein used for gene editing, preferably the PAM sequence corresponding to the Cas9 protein.

[0029] In another preferred embodiment, the Z1 and Z1' fragments are screening gene coding sequence fragments with the same sequence or at least 95% (preferably 96%, more preferably 97%, 98% or 99%) sequence identity.

[0030] In another preferred embodiment, the length of Z1 and Z1' is 29-400 bp nucleotides, preferably 100 nucleotides.

[0031] In another preferred example, the nucleotide sequence of Z0 is shown in positions 1-110 of SEQ ID NO:1.

[0032] In another preferred embodiment, the nucleotide sequences of Z1 and Z1' are shown in positions 111-210 of SEQ ID NO:1.

[0033] In another preferred example, the nucleotide sequence of T is shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.

[0034] In another preferred embodiment, the nucleotide sequence of Z2 is shown in positions 211-570 of SEQ ID NO:1.

[0035] In another preferred embodiment, the screening gene precursor coding sequence is shown as SEQ ID NO: 2, 3, 4 or 27.

[0036] In another preferred embodiment, the gRNA expression cassette and the screening gene expression cassette each independently comprise a promoter.

[0037] In another preferred embodiment, in the gRNA expression cassette, the gRNA coding sequence is operably linked to the AtU6-26 promoter.

[0038] In another preferred embodiment, in the screening gene expression cassette, the screening gene precursor coding sequence is operably linked to the 35S promoter.

[0039] In another preferred embodiment, the screening vector further comprises the following elements:

[0040] 3) Gene editing homologous recombination repair template; and / or

[0041] 4) Cas protein expression cassette.

[0042] In another preferred example, the screening vector further comprises a second gRNA expression cassette, and the gRNA binds to the MAR1 gene sequence in the genome of the cell to be edited.

[0043] In another preferred example, in the Cas protein expression cassette, the Cas protein coding sequence is operably linked to the DD45 promoter.

[0044] In another preferred embodiment, the cells to be edited are selected from plant cells, animal cells, or a combination thereof.

[0045] In another preferred embodiment, the plant includes Arabidopsis thaliana.

[0046] In a second aspect of the present invention, a screening vector for CRISPR / Cas-mediated gene editing is provided, the vector comprising:

[0047] 1) A first gRNA expression cassette, wherein the first gRNA binds to a target sequence in the genome of a cell to be edited;

[0048] 2) a second gRNA expression cassette, wherein the second gRNA binds to the MAR1 gene sequence in the genome of the cell to be edited;

[0049] 3) Exogenous screening genes.

[0050] In another preferred embodiment, the gene editing is mediated by Cas protein.

[0051] In another preferred embodiment, the Cas protein is Cas9 protein.

[0052] In another preferred example, the second gRNA targets the sequence shown in SEQ ID NO:24.

[0053] In another preferred embodiment, the exogenous screening gene is selected from the following group: resistance gene, fluorescent protein encoding gene.

[0054] In another preferred embodiment, the exogenous resistance gene is a phosphinothricin acetyltransferase gene (Bar), a herbicide resistance gene.

[0055] In another preferred embodiment, the first gRNA expression cassette and the second gRNA expression cassette each independently comprise a promoter.

[0056] In another preferred embodiment, the screening vector further comprises the following elements:

[0057] 4) Gene editing homologous recombination repair template; and / or

[0058] 5) Cas protein expression cassette.

[0059] In another preferred embodiment, the cells to be edited are selected from plant cells, animal cells, or a combination thereof.

[0060] In another preferred embodiment, the plant includes Arabidopsis thaliana.

[0061] In the third aspect of the present invention, provided is the use of the screening vector as described in the first aspect of the present invention or the screening vector as described in the second aspect of the present invention in screening CRISPR / Cas-mediated gene editing events.

[0062] In a fourth aspect of the present invention, a method for screening CRISPR / Cas mediated gene editing events is provided, comprising the steps of:

[0063] 1) providing cells to be edited, and transfecting the cells with the screening vector described in the first aspect of the present invention to obtain transfected cells;

[0064] 2) Determine the expression of the screening gene in the transfected cells, thereby screening cells that have undergone gene editing.

[0065] In another preferred embodiment, the screening gene is a resistance gene, and in the step 2), the transfected cells are contacted with a drug for screening cells expressing the resistance gene, thereby determining the expression of the screening gene.

[0066] In another preferred example, the screening gene is the Basta herbicide resistance gene, and the drug used to screen cells expressing the resistance gene is Basta herbicide.

[0067] In another preferred embodiment, the cells to be edited stably express the Cas protein; and / or the screening vector contains a Cas protein expression cassette.

[0068] In a fifth aspect of the present invention, a method for screening CRISPR / Cas mediated gene editing events is provided, comprising the steps of:

[0069] 1) providing cells to be edited, and transfecting the cells with the screening vector described in the second aspect of the present invention to obtain transfected cells;

[0070] 2) Determining the expression of the MAR1 gene and the exogenous screening gene in the transfected cells, thereby screening cells in which gene editing has occurred.

[0071] In another preferred embodiment, in step 2), the expression of the MAR1 gene is determined by contacting the transfected cells with kanamycin.

[0072] In another preferred embodiment, the exogenous screening gene is a resistance gene, and in the step 2), the expression of the screening gene is determined by contacting the transfected cells with a drug for screening cells expressing the resistance gene.

[0073] In another preferred example, the screening gene is the Basta herbicide resistance gene, and the drug used to screen cells expressing the resistance gene is Basta herbicide.

[0074] In another preferred embodiment, the cells to be edited stably express the Cas protein; and / or the screening vector contains a Cas protein expression cassette.

[0075] In another preferred embodiment, the cells are Arabidopsis cells.

[0076] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0078] Figure 1 A schematic diagram of the repair mechanism of genetic double-strand breaks (DSBs) is shown.

[0079] Figure 2 A schematic diagram of HDR-mediated SOS1-GFP gene knock-in is shown.

[0080] Figure 3 The process of HDR-mediated gene knock-in using the screening vector of the present invention is shown.

[0081] Figure 4 The process of converting the screening gene precursor in the screening vector of the present invention into the complete screening gene through SSA is shown.

[0082] Figure 5 The invention shows the use of the screening vector for Arabidopsis gene editing and screening. Figure 5 a and 5d are schematic diagrams of vector construction for one-step transformation and continuous transformation, respectively. Figure 5 b and 5e show the results of resistance gene screening. Figure 5 c and 5f show the results of genotype identification, where the upper part shows the genotype band after gene knock-in, and the lower part shows the wild-type genome band.

[0083] Figure 6 The method using multiple endogenous marker genes as screening tags and the results of T1 generation stress test are shown. Figure 6 a shows the screening process. Figure 6 b shows the results of the optimal screening conditions test for direct screening of the T1 generation using a variety of other stress tolerance phenotypes, with each mutant tested under different concentrations of NaCl, sorbitol, mannitol, and ABA. Figure 6 c shows the screening of co-edited T1 mutants directly on the culture medium. Among them, WNK8 was screened with 200mM soribitol, ABI3 was screened with 1m MABA, and PMEI10 was screened with 200mM sodium chloride. The results showed that the screening effect was not ideal and it was difficult to effectively screen out mutants.

[0084] Figure 7 An endogenous screening tag screening system is shown. Figure 7 a shows a schematic diagram of the co-editing screening system. The vector contains two sgRNAs, targeting the gene of interest and the MAR1 locus, respectively. In each vector, the two sgRNAs can generate DSBs at two different sites simultaneously. Figure 7 b shows that T1 transgenic plants were germinated directly in soil and subsequently selected by spraying with Basta and kanamycin.

[0085] Figure 8 Statistical analysis of mutation rates in a two-step screen using an endogenous screening tag screening system is shown. Figure 8 a and b show the analysis of the mutation rates of the target site and MAR1 in 40 randomly selected Basta-resistant and 32 kanamycin-resistant T1 transgenic plants, and the determination of the Pearson correlation coefficient and determination coefficient (R) of the mutation rates of SOS1 and MAR1 sites. 2 ). Figure 8 c shows the statistical analysis of the target gene mutation rate. The target gene mutation rate was calculated after Basta (left) and kanamycin (right) selection. The standard deviation of the Student's t test was determined (*P<0.05, ***P<0.001, ****P<0.0001).

[0086] Fig. 9 Precise knock-in gene targeting by a two-step screening strategy is shown. Fig. 9 a shows a schematic diagram of the knock-in vector. The structures of GFP KI-SOS1, Flag KI-ROS1, and Luc KI-NIA2 are shown. Fig. 9 b shows the growth of plants after selection with Basta and kanamycin. T1 transgenic seeds were directly sown into soil and selected by spraying with Basta and kanamycin. Fig. 9 c shows genotyping PCR detection of knock-in GT events, using full-length primers to detect the exact knock-in GT events. DETAILED DESCRIPTION

[0087] After extensive and in-depth research, the inventors have developed a HDR-mediated gene editing screening system for the first time. The screening label system of the present invention comprises a CRISPR / Cas9 single guide RNA (gRNA) target site located in the direct repeat sequence of a non-functional selection gene. The screening label system of the present invention establishes a coupling relationship between the HDR of the target gene of the organism and the vector screening label, that is, the CRISPR / Cas9 complex will simultaneously target and cut the target gene site to be edited in the genome and the target site in the screening label precursor, and the label to be screened will be repaired to become a complete screening gene, and it will have a screening function. On this basis, the present invention has been completed.

[0088] Experiments have shown that the reporter system of the present invention can significantly improve the screening efficiency of DSB-mediated related editing events. Importantly, the reporter system of the present invention is a screening tag loaded in a vector. Compared with traditional transgenic resistance screening, the reporter system of the present invention will not mutate endogenous resistance genes, nor will it introduce new screening genes into the endogenous genome. The screening tag system of the present invention uses itself as a repair template and relies on the SSA repair pathway to enrich homologous recombination repair cells, which is simpler and more efficient. Therefore, the reporter system of the present invention shows a wider adaptability and higher screening efficiency for DSB-mediated biological editing events.

[0089] On the other hand, the present invention provides a screening method using the Arabidopsis endogenous marker gene MAR1 as a screening tag after screening a variety of endogenous genes. After mutation, this gene will confer kanamycin screening resistance to Arabidopsis. The present invention designs two different sgRNAs in the vector, one targeting the endogenous marker gene and the other targeting the target gene site SOS1. The vector containing the donor fragment and sgRNA is transformed into the Arabidopsis parental line through Agrobacterium using a continuous transformation method, and then the genotype identification of the screening positive plants after the corresponding screening resistance is obtained to obtain the system test results.

[0090] The results showed that compared with the traditional vector-based screening tag (Basta herbicide resistance gene), the screening method targeting the endogenous screening gene MAR1 can significantly improve the efficiency of relative gene editing (gene knock-in). After introducing DSBs into both the endogenous potential resistance gene and the target gene, efficient screening of target gene editing can be achieved.

[0091] the term

[0092] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0093] As used herein, the terms "comprise", "include", and "contain" are used interchangeably and include not only closed definitions, but also semi-closed and open definitions. In other words, the terms include "consisting of", "consisting essentially of".

[0094] Screening vector

[0095] As used in the present invention, the terms "screening vector", "screening vector of the present invention", and "reporter system of the present invention" all refer to the screening vector for CRISPR / Cas-mediated gene editing of the first aspect or the second aspect of the present invention.

[0096] As used in the present invention, the term "gene editing" refers to the process of introducing exogenous genes, knocking out or knocking down endogenous genes, or performing gene replacement in the genome of an organism. In a preferred embodiment, the screening vector of the present invention is used to screen for CRISPR / Cas-mediated gene editing.

[0097] When performing gene editing, the editing vector usually needs to simultaneously construct a Cas gene expression cassette, an sgRNA expression cassette, and a transformation screening tag expression cassette. If a fragment is to be inserted, a homologous template for repairing the target fragment should also be added.

[0098] Cas is the abbreviation of CRISPR-associated protein. There are many types of common Cas proteins in the CRISPR system. Currently, more than 10 different CRISPR / Cas proteins have been studied for genome editing. The main CRISPR-Cas proteins that can be used in the present invention are spCas9, FnCas9, SaCas9, NmCas9, St1Cas9, St3Cas9, CjCas9, AsCPf1, LbCpf1, and Cas13.

[0099] In one embodiment, the screening vector of the present invention contains a screening gene expression cassette. As used in the present invention, the terms "screening gene" and "screening tag" have the same meaning and refer to a gene tag with a gene editing screening function. The "screening function" means that the expression of the screening gene can indicate whether there is potential for a desired gene editing event to occur in an organism. In the present invention, the screening gene can select conventional label genes in the art, such as resistance genes, fluorescent protein genes, etc. In some embodiments, the screening gene used in the present invention can be a hygromycin resistance gene, a green fluorescent protein, a kanamycin resistance gene, but is not limited thereto.

[0100] As used in the present invention, the terms "screening gene precursor" and "screening tag precursor" have the same meaning, and refer to a gene fragment that does not have a screening function itself, but can be converted into a screening gene with a screening function through gene editing. The present invention constructs a special screening gene precursor structure, which comprises two segments of repeat sequences (Z1, Z1') and a gRNA target sequence (T) located between the two segments of repeat sequences. When gRNA guides the CRISPR / Cas system to perform gene editing, the gRNA target sequence in the screening gene precursor is also cut at the same time to form a double-strand break (DSB). The screening tag precursor is repaired by single-strand annealing repair (SSA) between the direct repeat sequences with the help of two gene fragments with 3' and 5' direct repeat sequences near the DSB, thereby forming a complete screening gene with a screening function. Figure 2-4 A schematic diagram of the process is shown.

[0101] In one embodiment, the T sequence segment between the repeat sequences Z1 and Z1' contains a stop codon (eg, at the 5' end), so that the screening gene precursor cannot be fully expressed before being repaired, and thus does not have the screening function.

[0102] In one embodiment, several nucleotides at the 3' end of the T sequence and / or the 5' end of the Z1' sequence constitute the PAM sequence corresponding to the Cas protein, so that the CRISPR / Cas system can cut the T sequence. In the CRISPR system, the PAM sequence consists of 1 nucleotide at the 3' end of the T sequence and 2-3 nucleotides at the 5' end of the Z1' sequence. In another embodiment, the Cas protein used is the Cas9 protein, and 1 nucleotide at the 3' end of the T sequence and 2 nucleotides at the 5' end of the Z1' sequence constitute the PAM sequence ngg.

[0103] In one embodiment, the screening vector further comprises a Cas protein expression cassette. In one embodiment, the screening vector further comprises a target gene editing homologous recombination repair template, thereby utilizing a single vector transformation to simultaneously complete target cell gene editing and screening tag repair.

[0104] In this article, when referring to the screening gene precursor corresponding to a specific screening gene, repeated middle letters are used to represent it. For example, the herbicide resistance gene as a screening gene is represented as "Bar", and its corresponding screening gene precursor is represented as "Ba-ar".

[0105] In another embodiment, the screening vector of the present invention contains a first gRNA expression cassette targeting a target sequence in the genome of the cell to be edited and a second gRNA expression cassette targeting an endogenous screening gene. In a preferred embodiment, the endogenous screening gene is the MAR1 gene. The second gRNA in the screening vector targets the MAR1 gene, causing DSB to occur, thereby causing a mutation loss of function and exhibiting a kanamycin resistance phenotype.

[0106] In one embodiment, the screening vector of the present invention further comprises an exogenous screening gene, which may be any of the exogenous screening genes described above, such as the Bar herbicide resistance gene. The present invention finds that the dual-step screening strategy of herbicide resistance and kanamycin resistance brought about by MAR1 mutation can greatly improve the screening efficiency of gene editing.

[0107] In another embodiment, the screening vectors of the first aspect and the second aspect of the present invention can be combined. That is, the screening vector of the present invention can simultaneously contain a first gRNA expression cassette targeting a target sequence in the genome of a cell to be edited, a screening gene expression cassette encoding the screening gene precursor, and a second gRNA expression cassette targeting an endogenous screening gene.

[0108] Screening methods

[0109] The present invention also provides a gene editing screening method using the screening vector of the present invention.

[0110] In the method of the present invention, screening and enrichment of gene editing are performed by transforming the screening vector of the present invention into the target cells to be edited, and observing the expression of the screening gene (such as resistance gene) in the target cells after transfection.

[0111] The screening vector of the present invention may include a Cas protein expression cassette for one-step transfection. The screening vector of the present invention may also be transferred into a cell line that has stably expressed the Cas protein, i.e., a continuous transformation method.

[0112] The method of the present invention can be used for gene editing and screening of various cells, including but not limited to plant cells and animal cells. In one embodiment, the method of the present invention can be used for gene editing and screening of plants, for example, Arabidopsis thaliana.

[0113] The main advantages of the present invention include:

[0114] 1) The reporter system of the present invention establishes a coupling relationship between the organism target gene HDR and the vector screening tag, so that the screening tag can more accurately indicate whether the target gene editing event occurs. The system of the present invention can significantly improve the screening efficiency of DSB-mediated related editing events.

[0115] 2) The reporter system of the present invention is a screening tag loaded in a vector. Compared with the traditional transgenic resistance screening, the reporter system of the present invention will not mutate the endogenous resistance gene, nor will it introduce new screening genes into the endogenous genome.

[0116] 3) The present invention has discovered through screening the MAR1 gene suitable as an endogenous screening tag, and provided a two-step screening strategy based on exogenous screening genes and the MAR1 gene, which significantly improved the screening efficiency of gene editing events.

[0117] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0118] Materials and methods

[0119] Gene accession number

[0120] SOS1:At2g01980;

[0121] DME: At5g04560;

[0122] DD45:At2g21740;

[0123] MAR1:AT5G26820.

[0124] Plasmid construction

[0125] sgRNA was designed and driven by the AtU6-26 Pol III promoter using sgRNA design websites including CRISPRPrimer Designer, CRISPR-PLANT, CRISPOR, CHOPCHOP, DESKGEN, and CRISPR tool ATUM. 1, 2. In brief, the AtU6-26 promoter-driven sgRNA expression cassette and donor sequence were constructed in pCambia1300 with Bar or Ba-ar resistance genes. Human codon-optimized Streptococcus pyogenes Cas9 was used to construct an all-in-one construct for the one-step method and a parental cell line for the continuous transformation method. The constructed vector was transferred into Agrobacterium tumefaciens GV3101 for subsequent transformation experiments in Arabidopsis.

[0126] The following are the sequences of the resistance screening tag and screening tag precursor used in the embodiments of the present invention. The underlined part is the sequence recognized by the target gene sgRNA, and tga is the stop codon, so that the original screening tag does not have the screening function before being repaired. The sequence marked in bold is the repeated sequence fragment of the resistance screening gene.

[0127] >Bar

[0128]

[0129]

[0130] >Ba-ar(SOS1-sg)

[0131]

[0132] >Ba-ar(DME-sg2)

[0133]

[0134]

[0135] >Ba-ar(DME-sg12)

[0136]

[0137] >Ba-ar(GusgRNA)

[0138]

[0139]

[0140] The sgRNA targeting sequences in each screening tag are as follows:

[0141] >Ba-ar(SOS1-sg)

[0142] GTTAGAAGGTGATAATGCGGcGG(SEQ ID NO:5)>Ba-ar(DME-sg2)

[0143] CAACAAAACCTAAAGATGACtGG(SEQ ID NO:6)>Ba-ar(DME-sg12)

[0144] GAATTCGAGGGCTGATCCGGgGG(SEQ ID NO:7)>Ba-ar(GusgRNA)

[0145] GGTAGATATCACACTCTGTCtGG(SEQ ID NO:8)

[0146] Table 1 Primer sequences

[0147]

[0148]

[0149] Example 1 One-step gene knock-in screening based on Ba-ar screening vector

[0150] In this example, the Sold Overly Sensitive 1 (SOS1) gene was selected as the target gene site 1 for the HDR-mediated GT selection tag system test, and the insertion of the green fluorescent protein (GFP) fragment (720 bp) was achieved through HDR.

[0151] In the control group, the intact traditional Basta herbicide resistance screening gene tag Bar was used. In the experimental group, the improved Ba-ar screening vector was used. The designed hygromycin screening tag, the intact Bar and Ba-ar screening tags were constructed into the PCambia1300 vector containing DD45:Cas9 ( Figure 5 a) and transformed into Arabidopsis thaliana Col0 ecotype via Agrobacterium-mediated transformation.

[0152] Subsequently, the corresponding resistance screening ( Figure 5 b) GT plants were obtained for further genotyping. Figure 5 c. The results showed that among the 437 hygromycin-resistant materials screened in the S0S1-GFP-Hyg vector, 1 strain obtained an accurate knock-in (KI) of the GFP fragment, and the KI positive rate of screening was 1 / 437 (0.23%). However, 480 strains in the S0S1-GFP-Bar vector failed to successfully obtain an accurate KI event. After the plants mediated by the S0S1-GFP-Ba-ar vector were screened by Basta, 200 strains survived, and after identification, 2 strains were accurately inserted with the GFP fragment, and the KI positive rate was 2 / 200 (1.00%).

[0153] This example shows that the Ba-ar screening tag has a strong advantage in HDR-mediated GT screening, which can increase the screening efficiency by 2.17-3 times and achieve efficient screening of gene knock-in.

[0154] Example 2: Continuous transformation method based on Ba-ar screening vector DME 3' end Flag knock-in

[0155] To enhance the application of HDR-mediated GT selection tags in HDR-mediated GT, this system was incorporated into the continuous transformation method. Flag was knocked into the 3' end of the DNA glycosidase gene DME (At5g04560) in Arabidopsis thaliana. Specific sgRNA and donor constructs were designed for the 3' in-frame insertion (DME-Flag) ( Figure 5 d). Similar to the one-step method (Example 1), a modified Ba-ar screening tag was used.

[0156] These constructs were transformed into the Arabidopsis parental line (WT415) via Agrobacterium. Each independent T1 plant was then analyzed by PCR for GT events, which were initially screened using Basta herbicide herbicide resistance pressure ( Figure 5 e). The results are shown in Table 2. Genotype identification ( Figure 5 f) shows that in the experimental group, using the traditional Basta herbicide resistance screening gene tag, 1 out of 288 plants in the DME-Flag-Bar vector achieved accurate insertion of the Flag fragment (screening positive rate 0.35%). The use of the improved Basta herbicide resistance screening gene tag significantly reduced the number of surviving plants after herbicide screening. 155 surviving plants were obtained in the T1 generation transformed with the DME-Flag-Bar-ar vector, of which 5 achieved accurate insertion of the Flag fragment (screening positive rate 3.23%). Compared with the screening efficiency of the traditional screening tag, the screening efficiency of the improved Ba-ar screening tag combined with the continuous transformation method experiment increased by 9.23 times.

[0157] Example 3: Continuous transformation method based on Ba-ar screening vector DME 5' end Flag knock-in

[0158] To enhance the application of HDR-mediated GT selection tags in HDR-mediated GT, this system was incorporated into the continuous transformation method. Flag knock-in was generated at the 5' end of the DNA glycosidase gene DME (At5g04560) in Arabidopsis thaliana. Specific sgRNA and donor constructs were designed for 5' in-frame insertion (Flag-DME) ( Figure 5 d), similar to the one-step method (Example 1), using the modified Ba-ar screening tag.

[0159] These constructs were transformed into the Arabidopsis parental line (WT415) via Agrobacterium. Each independent T1 plant was then analyzed by PCR for GT events, which were initially screened using Basta herbicide herbicide resistance pressure ( Figure 5 e). The results are shown in Table 2. Genotype identification ( Figure 5f) shows that in the experimental group, using the traditional Basta herbicide resistance screening gene tag, 1 out of 384 plants in the Flag-DME-Bar vector achieved precise insertion of the Flag fragment (screening positive rate 0.26%). The use of the improved Basta herbicide resistance screening gene tag significantly reduced the number of surviving plants after herbicide screening. A total of 104 surviving plants were obtained in the T1 generation transformed with the Flag-DME-Ba-ar vector, of which 4 achieved precise insertion of the Flag fragment (screening positive rate 3.85%). Compared with the screening efficiency of the traditional screening tag, the screening efficiency of the improved Ba-ar screening tag combined with the continuous transformation method experiment was increased by 14.8 times.

[0160] The results of Examples 2 and 3 show that the combination of Ba-ar labeling and continuous transformation method can also greatly improve the HDR screening efficiency.

[0161] Table 2 Screening and enrichment efficiency

[0162]

[0163]

[0164] Example 4 Selection of endogenous genes that can be used as screening tags

[0165] In this example, the feasibility of efficient screening of gene editing events by endogenous resistance gene tag system was verified. The endogenous genes with screening potential that have been reported are: ABI5, WINK8, MAR1, PMEI10, ABI3, AB14, LHT1 and PQT3.

[0166] For each endogenous gene with screening potential, the optimal screening conditions for direct screening of the T1 generation were tested ( Figure 6 b). Mutants of eight genes other than MAR1, including ABI5 and WINK8, showed stress tolerance phenotypes (Table 3), which are expected to be used for alternative screening. However, direct screening of the T1 generation corresponding to each gene, including WNK8, ABI3, and PME10, failed in all cases, and it was difficult to effectively distinguish mutants by phenotype ( Figure 6 c).

[0167] Table 3 Endogenous gene tolerance conditions

[0168] Gene Gene accession number Tolerance conditions MAR1 AT5G26820 Kanamycin WNK8 AT5G41990 NaCl,soribitol PMEI10 AT1G62760 NaCl ABI3 AT3G24650 ABA,NaCl,mannitol AB14 AT2G40220 ABA,NaCl ABI5 AT2G36270 ABA LHT1 AT5G40780 D-Ala QT3 AT4G17410 paraquat

[0169] After selection, the endogenous marker gene MAR1 of Arabidopsis thaliana was finally selected as the screening tag. Mutation of this gene will give Arabidopsis thaliana kanamycin selection resistance.

[0170] Example 5 Screening function detection of endogenous screening gene MAR1 for SOS1 mutation editing

[0171] In this experiment, MAR1 was selected for preliminary testing. First, the BAR screening tag was used as a control to test the background level of target gene editing efficiency under the tag-mediated screening without editing screening effect in the traditional method. Secondly, kanamycin screening was used to test the screening efficiency of target gene editing screening events mediated by endogenous screening tags ( Figure 7 b).

[0172] To establish an efficient alternative screening system, the relationship between the mutation rates of two different loci simultaneously targeted by CRIPSR / Cas9 was statistically analyzed. First, the mutagenesis efficiency between two different loci simultaneously targeted was tested. Two different loci were targeted for co-editing: Salt Overly Sensitive 1 (SOS1) and MAR1 ( Figure 7 a). A SOS1 and MAR1 co-editing construct containing two sgRNA expression cassettes targeting the two genes was constructed and transformed into the DD45 promoter::Cas9 stable transgenic parent (ABRC stock number CS69955) by Agrobacterium according to the established sequential transformation strategy. These transgenic plants were first selected by the introduced Basta resistance gene and then by the kanamycin resistance phenotype of the endogenous marker MAR1 gene mutation ( Figure 7 b).

[0173] MAR1 sgRNA target sequence: CTGGAGTTCTGGACCGTCCT (SEQ ID NO: 24)

[0174] 40 randomly selected from approximately 100 independent basta-resistant T1 transformants were used to measure the mutation rates of these target sites using the TIDE website. Cas9-mediated simultaneous editing showed a statistically significant positive correlation between the mutation rates of the SOS1 and MAR1 loci ( Figure 8 a). Next, all the obtained basta T1-resistant mutants were sprayed with kanamycin for screening. A total of 32 plants were found to be resistant to kanamycin. Among them, 23 plants showed almost 100% mutation frequency at the MAR1 locus ( Figure 8 b). In addition, biallelic and heterozygous SOS1 mutants were enriched after kanamycin selection ( Figure 8 c).

[0175] Example 6 Detection of the editing and screening function of the endogenous screening gene MAR1 on other genes

[0176] To test the generality of the mutation rate relationship between the two target sites, two other gene sites, Target of Rapamycin (TOR) and the N-terminus of Demeter (DME), were also selected as target sites of interest. Two vectors containing two sgRNAs targeting the target site of interest and MAR1, respectively, were constructed and transformed into the Arabidopsis parental line (WT415) ( Figure 7 a).

[0177] MAR1 sgRNA target sequence: CTGGAGTTCTGGACCGTCCT (SEQ ID NO: 24)

[0178] TOR sgRNA target sequence: TTCTGGTGAgatgggtcatc (SEQ ID NO: 25)

[0179] DME sgRNA target sequence: GAATTCGAGGGCTGATCCGG (SEQ ID NO: 26)

[0180] Two biological replicates were performed for both vectors, generating nearly 100 independent basta-resistant T1 mutants in each experiment. In each experiment, 20 basta-resistant plants were randomly selected to determine the mutation rate at the target site. Since the DD45 promoter is specifically expressed in the one-cell stage, egg cells, and early embryos, most mutations will be heterozygous or biallelic, and mosaic mutations are unlikely. Statistical analysis showed that mutations in the target gene were significantly enriched after kanamycin selection ( Figure 8 c) These results strongly suggest that the two-step surrogate screening system can enrich plants with high DSB efficiency and has the versatility to target different targets.

[0181] Example 7 Dual-gene DSB strategy significantly improves precision editing efficiency

[0182] The double-strand break (DSB) efficiency of the CRISPR / Cas system has been shown to be an important factor in the establishment of accurate GTs. Therefore, to verify whether simultaneous DSB generation at the target sites of GT and MAR1 followed by kanamycin selection can improve the relative efficiency of GT in plants, the following experiment was performed.

[0183] The SOS1-GFP vector with knock-in (KI) green fluorescent protein GFP was constructed ( Fig. 9a). Two biological replicates were performed. 100 to 200 independent basta-resistant T1 transgenic plants were obtained in each experiment. To determine the efficiency of GT, all basta-resistant plants obtained were subjected to genotyping analysis. At least one accurate SOS1-GFP GT-positive plant was found, with an efficiency of 1-5% (Table 2). After kanamycin selection, about three quarters of the T1 plants were killed ( Fig. 9 b), resulting in an increase in relative GT efficiency to 4-15% (Table 2).

[0184] In addition to SOS1-GFP, knock-in of Flag epitope tags at the N-terminus of Repressor of Silencing 1 (ROS1) (ROS1-Flag) and DME (Flag-DME) and knock-in of luciferase at the NITRATE REDUCTASE 2 (NIA2) locus (NIA2-Luc) were also tested. Fig. 9 a). In all experiments, genotyping of T1 transgenic plants against basta resulted in accurate KI GT plants with an efficiency of 0.5-3.7% ( Fig. 9 c, Table 4). As with SOS1-GFP, about three-quarters of the basta-resistant T1 strains failed to survive kanamycin selection. As a result, the relative GT efficiency was increased by 1.1 to 3.6 times (Table 4). Although some SOS1-GFP GT-positive plants did not survive kanamycin treatment (e.g., Flag-DME GT plants), overall, the introduction of MAR1DSB and kanamycin selection can significantly improve the efficiency of precise editing.

[0185] Table 4 Gene editing efficiency

[0186]

[0187]

[0188] These results indicate that the two-step screening strategy allows for more stringent selection of GT candidates with high DSB frequencies, thereby improving the relative GT efficiency of Arabidopsis. The advantage of the two-step screening system is that the number of screenings can be reduced by about 25%, improving the relative GT efficiency. In general, the two-step screening system is a new strategy to improve GT efficiency. This example demonstrates that after simultaneously introducing DSBs into endogenous potential resistance genes and target genes, efficient screening of target gene editing can be achieved while conferring plant screening resistance.

[0189] discuss

[0190] These results indicate that by introducing a secondary sgRNA targeting the endogenous screening tag, a screening method that couples screening resistance with target gene editing events through endogenous screening gene mutations can effectively enrich plants with high DSB activity and more efficiently achieve screening efficiency for editing events.

[0191] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A screening vector for CRISPR / Cas-mediated gene editing, characterized in that: The vector comprises: 1) a gRNA expression cassette, wherein the gRNA binds to a target sequence in the genome of the cell to be edited; 2) A screening gene expression cassette comprising a screening gene precursor coding sequence having a structure as shown in Formula I below: Z0-Z1-T-Z1'-Z2(I) In the formula, each "-" is a connecting bond; Z0 is the 5′ end coding sequence of the screening gene; The Z1 and Z1' fragments are screening gene coding sequence fragments with the same sequence or at least 90% sequence identity, and the length of Z1 and Z1' is 29-400 bp nucleotides; T is a sequence that can be recognized by the gRNA; Z2 is the 3' end coding sequence of the screening gene.

2. The screening vector according to claim 1, characterized in that The screening gene is selected from the following group: resistance gene, fluorescent protein encoding gene.

3. The screening vector according to claim 1, characterized in that The T fragment in the coding sequence of the screening gene precursor can be recognized and cut by gRNA, and then the screening gene precursor is repaired to a complete screening gene through the single-stranded nucleic acid annealing pathway (SSA).

4. The screening vector according to claim 3, characterized in that The coding sequence structure of the complete screening gene is shown in formula (II): Z0-Z1-Z2(II) wherein each element is as defined in formula I.

5. The screening vector according to claim 1, characterized in that The nucleotide sequence of T is shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:

8.

6. The screening vector according to claim 1, characterized in that The screening gene precursor coding sequence is shown in SEQ ID NO: 2, 3, 4 or 27.

7. A screening vector for CRISPR / Cas-mediated gene editing, characterized in that: The vector comprises: 1) A first gRNA expression cassette, wherein the gRNA binds to a target sequence in the genome of the cell to be edited; 2) a second gRNA expression cassette, wherein the gRNA binds to the MAR1 gene sequence in the genome of the cell to be edited; 3) Exogenous screening genes.

8. The screening vector according to claim 7, characterized in that The second gRNA targets the sequence shown in SEQ ID NO:

24.

9. A method for screening CRISPR / Cas-mediated gene editing events, characterized in that: Includes steps: 1) providing cells to be edited, and transfecting the cells with the screening vector according to claim 1, thereby obtaining transfected cells; 2) Determine the expression of the screening gene in the transfected cells, thereby screening cells that have undergone gene editing.

10. A method for screening CRISPR / Cas-mediated gene editing events, characterized in that: Includes steps: 1) providing cells to be edited, and transfecting the cells with the screening vector according to claim 7, thereby obtaining transfected cells; 2) Determining the expression of the MAR1 gene and the exogenous screening gene in the transfected cells, thereby screening cells in which gene editing has occurred.

Images