High-temperature resistant xylanase mutant
By genetically modifying specific amino acid sites of xylanase, its heat resistance can be improved, solving the problem of insufficient stability of xylanase under high temperature conditions and promoting its application in the feed industry.
Patent Information
- Application Number
- CN202411875718.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-18
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2042-11-18
AI Technical Summary
Existing xylanases are not stable enough under high temperature conditions, which affects their widespread application in feed, food, energy and other fields.
By genetically engineering wild-type xylanase and introducing specific amino acid substitutions, such as I24T, G25N, V27Y, T41V, S65N, N160A, and N160R, its heat resistance can be improved.
It significantly improved the heat resistance of xylanase, resulting in a higher residual enzyme activity rate after treatment at 95℃, thus promoting its application in the feed industry.
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering and protein engineering, and particularly relates to a high-temperature resistant acid xylanase mutant and application thereof. BACKGROUND
[0002] Xylan is a kind of polymeric pentose and an important component of hemicellulose, which accounts for one third of the total plant carbohydrate and is the second most abundant renewable material resource after cellulose in nature. It exists in the cell wall and almost all parts of plants.
[0003] Xylanase is a kind of enzyme that can degrade xylan into oligosaccharides or xylose. Complete enzymatic hydrolysis of a xylan molecule requires several steps of enzymatic reactions, and there are two enzymes acting on the main chain: β-1, 4- xylanase (1, 4-β-D-xylanohydrolase: EC 3.1.2.8) and β-xylosidase (1, 4-β-D-xylanxylohydrolase: EC 3.2.1.37). Generally speaking, the former acts on the xylanosidic bond from the inside of the main chain to decompose xylan into oligosaccharides, and the latter acts on the end of oligomeric xylose to release xylose.
[0004] Many microorganisms can produce xylanase. The biochemical properties of xylanase are mainly obtained from the research of bacterial and fungal xylanases. The xylanases produced by bacteria can be generally divided into two categories: high-molecular-weight acid-resistant xylanases and low-molecular-weight alkali-resistant xylanases. However, there is no such difference in fungi, but the low-molecular-weight xylanases are commonly alkali-resistant.
[0005] Xylan in feed is difficult to be digested by monogastric animals, and it combines with a large amount of water, which increases the volume and viscosity of chyme in the digestive tract of animals, reduces the action of endogenous enzymes in the digestive tract, and thus hinders the digestion and absorption of nutrients, especially fat and protein, and reduces the utilization rate of feed. Research results show that if xylanase is added to feed, the size of arabinoxylan molecules can be significantly reduced, and the arabinoxylan can be decomposed into oligomeric xylose with a smaller degree of polymerization, so as to improve the feed performance and eliminate or reduce the anti-nutritional effects caused by the increase in viscosity.
[0006] In the production of grape wine and Japanese barley shochu, there has been research on the application of xylanase. Japanese researchers applied acid-resistant xylanase XylC to the production of Japanese barley shochu, and found that the enzyme can help to improve the fermentation efficiency and increase the yield of alcohol.
[0007] The application value of xylanase in papermaking, food, energy, feed and environment has been affirmed. However, due to the low expression level in natural materials, the difficulty in large-scale production, the difficulty in purification of the product and the fact that some properties of xylan cannot fully meet the requirements of application, with the development of genetic engineering technology, the means of genetic engineering is used to improve the expression amount by using a biological reactor and to solve some defects of xylanase activity (such as specific enzyme activity, stress resistance, pH value, thermal stability and the like) at the molecular level, which has become a research hotspot at present. SUMMARY
[0008] The purpose of the present application is to provide a high-temperature-resistant xylanase mutant and its application. The heat resistance of the mutant is significantly improved compared with the wild type, thereby facilitating the wide application of xylanase in the field of feed.
[0009] The present application relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 1, and comprising a substitution of an amino acid at at least one position selected from the group consisting of 24, 25, 27, 41, 65, 160, compared with SEQ ID NO: 1.
[0010] In some embodiments of the present application, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID NO: 1.
[0011] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID NO: 1.
[0012] In some embodiments of the present application, the mutant comprises a substitution of at least one amino acid in the group consisting of I24T, G25N, V27Y, T41V, S65N / Q, N160A / M / R.
[0013] In some embodiments of the present application, the mutant comprises a substitution or a combination of substitutions selected from the following substitutions and combinations of substitutions: I24T; G25N; V27Y; T41V; S65N; S65Q; N160A; N160M; N160R;
[0014] I24T / G25N;
[0015] I24T / V27Y;
[0016] I24T / T41V;
[0017] I24T / S65N;
[0018] I24T / S65Q;
[0019] I24T / N160A;
[0020] I24T / N160M;
[0021] I24T / N160R;
[0022] G25N / V27Y;
[0023] G25N / T41V;
[0024] G25N / S65N;
[0025] G25N / S65Q;
[0026] G25N / N160A;
[0027] G25N / N160M;
[0028] G25N / N160R;
[0029] V27Y / T41V;
[0030] V27Y / S65N;
[0031] V27Y / S65Q;
[0032] V27Y / N160A;
[0033] V27Y / N160M;
[0034] V27Y / N160R;
[0035] T41V / S65N;
[0036] T41V / S65Q;
[0037] T41V / N160A;
[0038] T41V / N160M;
[0039] T41V / N160R;
[0040] S65N / N160A;
[0041] S65N / N160M;
[0042] S65N / N160R;
[0043] S65Q / N160A;
[0044] S65Q / N160M;
[0045] S65Q / N160R;
[0046] I24T / G25N / V27Y;
[0047] I24T / G25N / T41V;
[0048] I24T / G25N / S65N;
[0049] I24T / G25N / S65Q;
[0050] I24T / G25N / N160A;
[0051] I24T / G25N / N160M;
[0052] I24T / G25N / N160R;
[0053] I24T / V27Y / T41V;
[0054] I24T / V27Y / S65N;
[0055] I24T / V27Y / S65Q;
[0056] I24T / V27Y / N160A;
[0057] I24T / V27Y / N160M;
[0058] I24T / V27Y / N160R;
[0059] I24T / T41V / S65N;
[0060] I24T / T41V / S65Q;
[0061] I24T / T41V / N160A;
[0062] I24T / T41V / N160M;
[0063] I24T / T41V / N160R;
[0064] G25N / T41V / S65N;
[0065] G25N / T41V / S65Q;
[0066] G25N / T41V / N160A;
[0067] G25N / T41V / N160M;
[0068] G25N / T41V / N160R;
[0069] I24T / S65N / N160A;
[0070] I24T / S65N / N160M;
[0071] I24T / S65N / N160R;
[0072] I24T / S65Q / N160A;
[0073] I24T / S65Q / N160M;
[0074] I24T / S65Q / N160R;
[0075] G25N / S65N / N160A;
[0076] G25N / S65N / N160M;
[0077] G25N / S65N / N160R;
[0078] G25N / S65Q / N160A;
[0079] G25N / S65Q / N160M;
[0080] G25N / S65Q / N160R;
[0081] T41V / S65N / N160A;
[0082] T41V / S65N / N160M;
[0083] T41V / S65N / N160R;
[0084] T41V / S65Q / N160A;
[0085] T41V / S65Q / N160M;
[0086] T41V / S65Q / N160R;
[0087] I24T / G25N / V27Y / T41V;
[0088] I24T / G25N / V27Y / S65N;
[0089] I24T / G25N / V27Y / S65Q;
[0090] I24T / G25N / V27Y / N160A;
[0091] I24T / G25N / V27Y / N160M;
[0092] I24T / G25N / V27Y / N160R;
[0093] I24T / G25N / T41V / S65N;
[0094] I24T / G25N / T41V / S65Q;
[0095] I24T / G25N / T41V / N160A;
[0096] I24T / G25N / T41V / N160M;
[0097] I24T / G25N / T41V / N160R;
[0098] I24T / V27Y / T41V / S65N;
[0099] I24T / V27Y / T41V / S65Q;
[0100] I24T / V27Y / T41V / N160A;
[0101] I24T / V27Y / T41V / N160M;
[0102] I24T / V27Y / T41V / N160R;
[0103] G25N / V27Y / T41V / S65N;
[0104] G25N / V27Y / T41V / S65Q;
[0105] G25N / V27Y / T41V / N160A;
[0106] G25N / V27Y / T41V / N160M;
[0107] G25N / V27Y / T41V / N160R;
[0108] I24T / G25N / V27Y / T41V / S65N;
[0109] I24T / G25N / V27Y / T41V / S65Q;
[0110] I24T / G25N / V27Y / T41V / N160A;
[0111] I24T / G25N / V27Y / T41V / N160M;
[0112] I24T / G25N / V27Y / T41V / S65N / N160A;
[0113] I24T / G25N / V27Y / S65N / N160M;
[0114] I24T / G25N / V27Y / S65N / N160R;
[0115] I24T / G25N / V27Y / S65Q / N160A;
[0116] I24T / G25N / V27Y / S65Q / N160M;
[0117] I24T / G25N / V27Y / S65Q / N160R;
[0118] I24T / G25N / T41V / S65N / N160A;
[0119] I24T / G25N / T41V / S65N / N160M;
[0120] I24T / G25N / T41V / S65N / N160R;
[0121] I24T / G25N / T41V / S65Q / N160A;
[0122] I24T / G25N / T41V / S65Q / N160M;
[0123] I24T / G25N / T41V / S65Q / N160R;
[0124] I24T / V27Y / T41V / S65N / N160A;
[0125] I24T / V27Y / T41V / S65N / N160M;
[0126] I24T / V27Y / T41V / S65N / N160R;
[0127] I24T / V27Y / T41V / S65Q / N160A;
[0128] I24T / V27Y / T41V / S65Q / N160M;
[0129] I24T / V27Y / T41V / S65Q / N160R;
[0130] G25N / V27Y / T41V / S65N / N160A;
[0131] G25N / V27Y / T41V / S65N / N160M;
[0132] G25N / V27Y / T41V / S65Q / N160A;
[0133] G25N / V27Y / T41V / S65Q / N160M;
[0134] G25N / V27Y / T41V / S65Q / N160R;
[0135] I24T / G25N / V27Y / T41V / S65N / N160A;
[0136] I24T / G25N / V27Y / T41V / S65N / N160M;
[0137] I24T / G25N / V27Y / T41V / S65N / N160R;
[0138] I24T / G25N / V27Y / T41V / S65Q / N160A;
[0139] I24T / G25N / V27Y / T41V / S65Q / N160M;
[0140] I24T / G25N / V27Y / T41V / S65Q / N160R.
[0141] The present application also relates to a DNA molecule encoding the above-mentioned xylanase mutant.
[0142] The present application also relates to a recombinant expression vector comprising the above-mentioned DNA molecule.
[0143] The above-mentioned expression vector is introduced into a host cell, and the heat resistance of the recombinantly expressed xylanase mutant is significantly improved.
[0144] The present application also relates to a host cell comprising the above-mentioned recombinant expression vector.
[0145] In some embodiments of the present application, the host cell is a non-plant cell.
[0146] In some embodiments of the present application, the host cell is Pichia pastoris.
[0147] In some embodiments of the present application, the host cell is Trichoderma reesei.
[0148] The application also provides the application of the xylanase mutant in the feed field.
[0149] The application provides a mutant containing at least one of the following mutation sites: I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M and N160R, based on wild-type xylanase PT. Compared with the wild-type xylanase PT, the xylanase single-point mutant provided by the application has an enzyme activity residual rate increased by 13.1%-23.2% after being treated at 95℃ for 5 min; wherein the xylanase mutant containing the S65N single-point mutation has the strongest heat resistance, and the enzyme activity residual rate is as high as 82.9%, achieving an unexpected technical effect.
[0150] In conclusion, the heat resistance of the xylanase mutant provided by the application is significantly improved, thereby being beneficial to reducing the production cost of the xylanase and promoting the wide application of the xylanase in the feed field. DETAILED DESCRIPTION
[0151] The application discloses a xylanase mutant, a preparation method and application thereof, a DNA molecule for coding the xylanase mutant, a carrier and a host cell, and those skilled in the art can refer to the content of the present application, and appropriately improve the process parameters. The method and application of the present application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described in the present application without departing from the content, spirit and scope of the present application, to realize and apply the present application.
[0152] The application uses conventional techniques and methods used in the field of genetic engineering and molecular biology, such as the methods recorded in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental schemes and reagents in the field on the basis of the technical solutions recorded in the present application, without being limited by the limitations of the specific embodiments of the present application. For example, the present application can select the following experimental materials and reagents:
[0153] Strains and vectors: Escherichia coli DH5alpha, Pichia pastoris GS115, vector pPIC9k, Amp and G418 are purchased from Invitrogen Company.
[0154] Enzymes and kits: PCR enzymes and ligase were purchased from Takara Company, restriction endonucleases were purchased from Fermentas Company, plasmid extraction kit and gel purification recovery kit were purchased from Omega Company, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.
[0155] Culture medium formula:
[0156] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0157] Yeast culture medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
[0158] Yeast screening medium (MD medium): 2% peptone, 2% agarose;
[0159] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;
[0160] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;
[0161] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0162] LB-AMP plate: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;
[0163] The present application is further described below in conjunction with examples:
[0164] Example 1 Construction of recombinant plasmid
[0165] The synthesized xylanase gene (GeneBank MK138894.1) was optimized according to the codon bias of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before the start codon ATG of the xylanase gene, and GCGGCCGC (Not I restriction site) was added after the stop codon TAA of the xylanase gene. The optimized nucleotide sequence was synthesized by Shanghai Jerui Biological Engineering Co., Ltd. The xylanase was named PT, and the amino acid sequence thereof was SEQ ID NO: 1, and the encoding nucleotide sequence was SEQ ID NO: 2.
[0166] The xylanase gene was digested with restriction enzymes EcoR I and Not I (Fermentas); meanwhile, the plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The digestion products were purified using a gel purification kit, and the two digestion products were connected using T4 DNA ligase (Fermentas). The connection product was transformed into DH5a E. coli (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced (Sangon).
[0167] The plasmid was purified from the E. coli clone with correct sequencing results using a plasmid miniprep kit (Omega), and a recombinant plasmid was obtained and named pPIC9K-PT.
[0168] Example 2 Screening of temperature-resistant xylanase mutants
[0169] To further improve the enzyme activity of xylanase PT, the applicant analyzed the protein structure thereof. The protein is a GHI1 family xylanase, and the structure thereof is a β-jellyroll structure. The applicant screened a large number of mutations of the enzyme through directed evolution technology.
[0170] 1.1 Design of PCR primers PT-F1 and PT-R1:
[0171] PT-F1: GGC GAATTC CAAAGTTTCTGTAGTTCAGCTTCTC (underlined is a restriction enzyme EcoR I recognition site);
[0172] PT-R1: ATA GGCGGCCG CTTATCATTAATCACCAATGTAAACCTT (underlined is a restriction enzyme Not I recognition site).
[0173] The PT gene (SEQ ID NO: 2) was used as a template, and the above primers were used to perform PCR amplification using a GeneMorph II random mutation PCR kit (BioMyS). The PCR product was gel recovered, treated with EcoR I and Not I, and then connected to a pET21a vector treated with the same enzymes. The connection product was transformed into E. coli BL21 (DE3), spread on an LB+Amp plate, and incubated at 37°C. When the transformants appeared, they were picked one by one using a toothpick and added to 150 μL of LB+Amp medium containing 0.1 mM IPTG in each well. The culture was incubated at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the bacterial cells were resuspended with a buffer. The cells were repeatedly frozen and thawed to break the cell wall, and the E. coli cell lysate containing xylanase was obtained.
[0174] Take 30 μL lysate to two new 96-well plates respectively, one of which is treated at 95℃ for 5 min, and 30 μL substrate is added to both 96-well plates, after reaction at 37℃ for 30 min, the generated reducing sugar is determined by DNS method, different mutants have different activities after high temperature treatment.
[0175] The experimental results show that some mutations have no effect on the heat resistance of xylanase, some mutations even make the heat resistance or enzyme activity worse; in addition, some mutations can improve the temperature tolerance of xylanase, but the enzymatic properties of the mutants change significantly after mutation, which do not meet the requirements. Finally, the mutation sites that can significantly improve the heat resistance of xylanase without affecting the enzyme activity and original enzymatic properties are obtained: I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, N160R.
[0176] On the basis of the wild-type xylanase PT, the application provides mutants containing single mutation sites I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, N160R respectively.
[0177] Example 3 Expression of xylanase in Pichia pastoris, 3.1 Construction of expression vector
[0178] According to the codon preference of Pichia pastoris, the gene sequences of xylanase PT and its mutants are optimized, synthesized by Shanghai Jeery Bioengineering Co., Ltd., and EcoRI and NotI enzyme cutting sites are added at the 5' and 3' ends of the synthesized sequences respectively.
[0179] According to the method described in Example 1, the synthesized gene sequences of xylanase PT and its mutants are subjected to EcoRI and NotI double enzyme cutting respectively, then are connected with the pPIC-9K vector subjected to the same enzyme cutting at 16℃ overnight, and are transformed into E. coli DH5a, and are coated on LB+Amp plates, and are cultured at 37℃ upside down, after the appearance of transformants, colony PCR (reaction system: template, rTaq DNA polymerase 0.5 μL, 10×Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM) 0.5 μL, 3' AOX primer 0.5 μL, ddH2O 14.5 μL, reaction program: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, 72℃ for 10 min) is carried out. The positive clones are verified, and the correct recombinant expression plasmid is obtained after sequencing verification.
[0180] 3.2 Construction of Pichia pastoris engineering strain
[0181] 3.2.1 Yeast competent preparation
[0182] The Pichia pastoris GS115 strain was activated on a YPD plate, and after 48 h of culture at 30°C, the activated GS115 monoclonal was inoculated in 6 mL of YPD liquid medium, and cultured at 30°C, 220 rpm for about 12 h, then the bacterial liquid was transferred to a flask containing 30 mL of YPD liquid medium, and cultured at 30°C, 220 rpm for about 5 h. The bacterial density was detected by ultraviolet spectrophotometry. When the OD600 value was in the range of 1.1-1.3, 4°C, 9000 rpm centrifugation for 2 min, 4 mL of bacterial body was collected into a sterile EP tube, the supernatant was discarded, and the residual supernatant was absorbed with sterile filter paper. Then the bacterial body was resuspended with 1 mL of pre-cooled sterile water, 4°C, 9000 rpm centrifugation for 2 min, the supernatant was discarded, and the bacterial body was washed with 1 mL of pre-cooled sterile water. Then the bacterial body was resuspended with 1 mL of pre-cooled sterile water, 4°C, 9000 rpm centrifugation for 2 min, the supernatant was discarded, and the bacterial body was resuspended with 100-150 μL of pre-cooled sorbitol (1 mol / L).
[0183] 3.2.2 Transformation and screening
[0184] The recombinant expression plasmids obtained in 3.1 were linearized with Sac I, respectively, and the linearized fragments were purified and recovered, and then transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then the multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).
[0185] The obtained transformants were transferred into BMGY medium and cultured at 30°C, 250 rpm for 1 d, then transferred into BMMY medium and cultured at 30°C, 250 rpm. 0.5% methanol was added every day to induce expression for 4 d. The bacterial body was removed by centrifugation at 9000 rpm for 10 min to obtain the fermentation supernatant containing xylanase PT and xylanase mutants, respectively.
[0186] 1. Xylanase enzyme activity determination method
[0187] (1) Definition of xylanase activity unit
[0188] The amount of enzyme required to release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / mL under the condition of 37°C and pH 5.5 is defined as one enzyme activity unit U.
[0189] (2) Enzyme activity determination method
[0190] Take 2 mL concentration of 1% xylan substrate (pH 5.5 acetic acid-sodium acetate buffer prepared), added to the colorimetric tube, 37 ℃ equilibrium 10 min, then add 2 mL of pH 5.5 acetic acid-sodium acetate buffer diluted and 37 ℃ equilibrium of acid xylanase enzyme liquid, mix well at 37 ℃, accurate incubation reaction 30 min. After the reaction, add 5 mL DNS reagent, mix well to terminate the reaction. Then boiling water bath boiling 5 min, with tap water cooling to room temperature, add distilled water to 25 mL, mix well, with standard blank sample as blank control, at 540 nm determination of absorbance A E .
[0191] Enzyme activity calculation formula:
[0192] X D = [(A E -A B ) × K + C0] × N × 1000 / (M × t).
[0193] In the formula: X D is the activity of xylanase in the diluted enzyme solution, U / mL; A E is the absorbance of the enzyme reaction solution; A B is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C O is the intercept of the standard curve; M is the molar mass of xylose, 150.2 g / mol; t is the enzyme hydrolysis reaction time, min; N is the enzyme solution dilution multiple; 1000 is the conversion factor, 1 mmol = 1000 μmol.
[0194] (3) Enzyme activity determination results
[0195] According to the above method, the results show that the enzyme activity of the recombinant Pichia pastoris strain expressing the recombinant xylanase PT and its mutants is 330-790 U / mL.
[0196] Example 4 Heat resistance analysis of xylanase mutants,
[0197] The fermentation supernatant of the Pichia pastoris recombinant strain expressing xylanase PT and its mutants described in Example 3 was diluted to about 20 U / mL with pH 5.5 acetic acid-sodium acetate buffer, and the residual enzyme activity was determined after treatment at 95 ℃ for 5 min. The enzyme activity of the untreated sample was taken as 100%, and the residual rate of enzyme activity was calculated. The specific results are shown in Table 1.
[0198] Table 1 Heat resistance analysis of xylanase single-point mutants
[0199] Xylanase mutants Residual enzyme activity after 5 min at 95 °C Wild type PT 67.3% I24T 80.0% G25N 82.7% V27Y 77.6% T41V 81.6% S65N 82.9% S65Q 82.1% N160A 76.5% N160M 77.5% N160R 76.1%
[0200] From the results of Table 1, compared with the wild-type xylanase PT, the xylanase mutants provided by the application respectively containing I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, N160R single-point mutations, after 5 min of treatment at 95℃, the enzyme activity residual rate is increased by 13.1%-23.2%; wherein, the xylanase mutant containing S65N single-point mutation has the strongest heat resistance, and the enzyme activity residual rate is as high as 82.9%. Thus, it is illustrated that the I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, N160R mutation sites can significantly improve the heat resistance of the xylanase PT, and unexpected technical effects are achieved.
[0201] In summary, the xylanase mutant provided by the application has stronger heat resistance, and is more suitable for being used as a feed additive than the wild type.
Claims
1. A xylanase mutant, characterized in that, The mutant is obtained by mutating the 25th amino acid of xylanase with amino acid sequence of SEQ ID NO: 1 from Gly to Asn.
2. A DNA molecule encoding the xylanase mutant of claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid of claim 3; and the host cell is a non-plant cell.
5. The host cell of claim 4, wherein The host cell is Pichia pastoris (MUT+) Pichia pastoris ) or Trichoderma reesei (P1) Trichoderma reesei .
6. Use of the xylanase mutant of claim 1 in feed production.
Citation Information
Patent Citations
Thermal stability improved xylanase XynAS9-m mutant V81P / G82E as well as gene and application thereof
CN103343113A
Xylanase mutant with thermostability improved and application thereof
CN109750015A