Novel beta-1, 4-endo-xylanase as well as coding gene and application thereof

Abstract

The invention discloses novel beta-1, 4-endo-xylanase as well as a coding gene and application thereof, and relates to the technical field of gene engineering. A genome of a strain of Lachnospiraceae bacteriaceae NK4A136 bacteria with the integrity of 96.44% and the contamination rate of 0 is assembled by using a metagenome binning technology, a beta-1, 4-endo-xylanase gene is obtained through annotation of a KEGG Enzyme database, the nucleotide sequence of the beta-1, 4-endo-xylanase encoding gene is shown as SEQ ID NO.3, and the amino acid sequence of the beta-1, 4-endo-xylanase encoding gene is shown as SEQ ID NO.4. The invention further discloses a preparation method of the beta-1, 4-endo-xylanase encoding gene. Compared with fungus-derived xylanase, the xylanase has good thermal stability and pH stability, can significantly improve the in-vitro enzymolysis reducing sugar growth rate of bran, is beneficial to pretreatment of bran raw materials, and has application value in preparation of feed from bran.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a novel beta-1,4-endo-xylanase and a coding gene and application thereof. Background Art

[0002] Xylan is the main component of hemicellulose, the second largest renewable resource on earth, and is also the most abundant polysaccharide besides cellulose. In today's world of energy shortage and serious pollution, the rational use of renewable resources is urgent. Therefore, the full utilization of xylan has attracted much attention. However, the chemical structure of xylan is complex, and the degradation of xylan requires the help of a complex set of hydrolytic enzymes, the most important of which is β-1,4-endo-xylanase (β-1,4-D-xylanohydrolase: EC 3.1.2.8).

[0003] β-1,4-endo-xylanase is the most important enzyme in the hydrolysis process of xylan. It mainly acts on the glycosidic bond of β-1,4-D-xylosidic bond. The hydrolysis products are xylose, xylobiose and above xylo-oligosaccharides. Most of the β-1,4-endo-xylanases from wild strains of Trichoderma and Aspergillus have low enzyme activity. In addition, the protein subunits of fungal xylanases are more complex than those from bacteria, and their thermal stability is poorer than that of bacterial xylanases. Therefore, most of the existing industrial xylanases are derived from bacteria. At present, the exploration of bacterial β-1,4-endo-xylanase gene resources is limited, and further exploration of highly active and stable bacterial β-1,4-endo-xylanase is needed.

[0004] With the development of sequencing technology, combined with metagenomic analysis methods, in terms of mining microbial functional enzyme genes, it is possible to successfully avoid the difficulties of traditional microbial pure culture technology, and quickly discover a large number of functional enzyme genes in a short period of time, thereby improving the breadth and effectiveness of functional enzyme gene screening, and greatly promoting the improvement of functional enzyme gene cloning efficiency, providing a new research strategy for searching and discovering bacterial β-1,4-endo-xylanase genes. Summary of the invention

[0005] The purpose of the present invention is to provide a β-1,4-endo-xylanase with better pH stability and temperature stability. The enzyme is obtained through the annotation of Asian elephant feces metagenome, which fills the deficiency of existing β-1,4-endo-xylanase in industrial production.

[0006] In order to achieve the above object, the present invention provides a novel β-1,4-endo-xylanase, the amino acid sequence of which is shown in SEQ ID NO.4. The β-1,4-endo-xylanase can be used to increase the growth rate of reducing sugars in bran by enzymatic hydrolysis in vitro or / and to prepare bran feed by enzymatic hydrolysis of bran.

[0007] The present invention also provides a gene encoding the above-mentioned β-1,4-endo-xylanase, and the nucleotide sequence of the gene encoding is shown in SEQ ID NO.3.

[0008] The present invention also provides a primer for identifying the above coding gene, and the nucleotide sequence of the primer is shown as SEQ ID NO.1 and SEQ ID NO.2.

[0009] The present invention also provides a recombinant plasmid comprising the above coding gene, wherein the recombinant plasmid is selected from a prokaryotic plasmid.

[0010] Preferably, the above-mentioned prokaryotic plasmid is selected from pET28a(+).

[0011] The present invention also provides a recombinant bacterium capable of expressing the above-mentioned β-1,4-endo-xylanase, wherein the recombinant bacterium is preferably selected from Escherichia coli BL21 (DE3).

[0012] The present invention also provides a method for preparing the above-mentioned β-1,4-endo-xylanase, comprising:

[0013] The above recombinant bacteria are fermented and cultured, and after IPTG induction, the supernatant is collected by centrifugation to obtain β-1,4-endo-xylanase.

[0014] The present invention has the following advantages:

[0015] The present invention assembles a genome of a bacterium of the genus NK4A136 of the Lachnospiraceae family with a completeness of 96.44% and a contamination rate of 0 through the metagenomic binning technology, obtains the β-1,4-endo-xylanase encoding gene through annotation in the KEGG Enzyme database, and prepares the β-1,4-endo-xylanase Xylanmeta through genetic engineering technology. Compared with the xylanase from fungi, the β-1,4-endo-xylanase Xylanmeta from bacteria has good stability at 60 to 80° C. and in the range of pH=5 to 8, and has better pH stability and temperature stability.

[0016] The β-1,4-endo-xylanase provided by the present invention can effectively make up for the problems of the physicochemical properties of the existing β-1,4-endo-xylanase, especially the poor tolerance to conditions such as pH and temperature, and has a good effect on the degradation of bran, and can increase the growth rate of in vitro enzymatic hydrolysis reducing sugar in bran, and has practical value in the preparation of feed, especially the pretreatment of bran raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the electrophoresis result of PCR amplification verification of the novel β-1,4-endo-xylanase encoding gene in the present invention.

[0018] Figure 2 This is the protein SDS-PAGE gel electrophoresis result of the novel β-1,4-endo-xylanase in the present invention.

[0019] Figure 3 The curve showing the effect of temperature on the enzyme activity of the novel β-1,4-endo-xylanase of the present invention.

[0020] Figure 4 The curve showing the effect of pH on the enzyme activity of the novel β-1,4-endo-xylanase of the present invention. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0023] The original data of Asian elephant intestinal metagenomic sequencing used in the present invention has been deposited in the genome sequence archive of the Big Data Center of the Chinese Academy of Sciences with the accession number of CRA003369.

[0024] Example 1 Acquisition of a novel β-1,4-endo-xylanase encoding gene

[0025] 1. Based on the fresh feces samples of Asian elephants stored in this laboratory, the metagenomic DNA was extracted using a kit (QIAamp DNA StoolMini Kit). The steps for extracting the metagenomic DNA of fresh feces of Asian elephants are as follows:

[0026] 1) Weigh about 0.2 g of Asian elephant feces into a sterile centrifuge tube;

[0027] 2) Add 1.4 mL of buffer ASL, vortex continuously for several minutes to mix thoroughly, incubate at 70°C for 5 minutes, and then vortex for 15 seconds;

[0028] 3) Centrifuge at 20,000 g for 1 min to remove fecal impurities and transfer the supernatant to a new centrifuge tube;

[0029] 4) After adding one inhibitEX Tablet, mix immediately for about 1 minute, then leave at room temperature for 1 minute to allow the inhibitor to adsorb to the inhibitEX matrix, and centrifuge at 20,000g for 3 minutes;

[0030] 5) Take the supernatant and transfer it to a new centrifuge tube, and centrifuge it again as in 4);

[0031] 6) Pipette the supernatant into a new centrifuge tube with 15 μL proteinase K added, add 200 μL buffer AL, mix thoroughly and incubate at 70°C for 10 min;

[0032] 7) Add 200 μL of anhydrous ethanol, mix thoroughly, transfer to a QIAamp adsorption column, and centrifuge at 20,000 g for 1 min (if the liquid does not pass through the column completely, repeat the centrifugation once more);

[0033] 8) Wash the column with 500 μL of buffer AW1 and AW2 respectively, centrifuge for 3 min as in 7), and transfer the column to a new collection tube;

[0034] 9) Add an appropriate amount of buffer AE to the center of the adsorption column, place it at room temperature for 1 minute, and then centrifuge it for 1 minute to elute. The resulting metagenomic DNA can be used for downstream molecular biology experiments or stored at -20°C for future use.

[0035] 2. By means of metagenomic sequencing and binning technology, a genome of a bacterium of the genus NK4A136 of the Lachnospiraceae family with a completeness of 96.44% and a contamination rate of 0 was assembled. The KEGG Enzyme database annotated that it contained a β-1,4-endo-xylanase gene (EC 3.2.1.8). The amino acid sequence of the β-1,4-endo-xylanase was blasted to the NR database. The result showed that the highest amino acid identity with the β-1,4-endo-xylanase in the NR database was 89.6%. The conserved sequence of the β-1,4-endo-xylanase gene was analyzed, and the amplification primers of the β-1,4-endo-xylanase encoding gene of the present invention were designed. The specific sequence is as follows:

[0036] Upstream primer P1 (SEQ ID NO.1):

[0037] CATATGATGAATATTAGCACAACACCTAAG,

[0038] Downstream primer P2 (SEQ ID NO.2):

[0039] TCTAGATTATAATTCGATATGGATATTCTTC.

[0040] The upstream and downstream primers P1 and P2 are used to amplify the β-1,4-endo-xylanase target gene, and the upstream and downstream primers introduce restriction enzyme cutting sites NdeI and XbaI respectively.

[0041] The amplification template was Asian elephant intestinal metagenomic DNA, and the PCR amplification reaction system was: EX Taq 1.25 μL, 10X Buffer 10 μL, dNTP mix 5 μL, P1 and P2 2.5 μL each, DNA 5 μL, ddH2O 73.75 μL, and the total volume was 100 μL.

[0042] The amplification reaction conditions were as follows: 94°C, 5 min; 94°C, 30 s; 55-61°C, 30 s; 72°C, 1 min (30 cycles); 72°C, 10 min; 4°C, 10 min.

[0043] The PCR product was verified by 1% agarose gel electrophoresis, and a band of 1272 bp was obtained. Figure 1 As shown, lane 1 is a DNA marker and lane 2 is a PCR amplification product. After the PCR product is recovered by gel, double enzyme digestion and purification and recovery are performed to obtain the β-1,4-endo-xylanase encoding gene Xylanmeta derived from the metagenome assembly genome of the present invention, whose nucleotide sequence is shown in SEQ ID NO.3, and the amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO.4.

[0044] Example 2 Preparation of novel β-1,4-endo-xylanase

[0045] 1. Construction of recombinant plasmid of β-1,4-endo-xylanase

[0046] 1) Plasmid pET28a(+) was double-digested with restriction endonucleases NdeI and XbaI, and the purified product after digestion was ligated with the purified product after digestion of the target gene using T4 ligase at 16°C overnight. The ligation product was chemically transformed into E. coli DH5α.

[0047] 2) After colony PCR identification, double enzyme digestion identification and sequencing, the recombinant plasmid pET28a-Xylanmeta was obtained;

[0048] 3) The cloned strain E. coli DH5α / pET28a-Xylanmeta containing the correct recombinant plasmid pET28a-Xylanmeta was stored at -80°C with 20% glycerol.

[0049] 2. Construction of recombinant β-1,4-endo-xylanase bacteria

[0050] 1) Add 10 μL of the successfully constructed recombinant plasmid pET28a-Xylanmeta to E. coli BL21 (DE3) competent cells, mix gently, and place on ice for 30 minutes;

[0051] 2) Place the mixture after ice bath in a 42°C molecular water bath for heat shock for 1.5 min, and then ice bath for 5-10 min;

[0052] 3) Add 500 μL LB liquid culture medium (without antibiotics) to a sterile workbench, place in a constant temperature high-speed culture shaker at 37°C and 180 rpm for 1 hour, and centrifuge at 7000 rpm for 3 minutes;

[0053] 4) Move to a sterile workbench and take 100-200 μL of suspended bacteria. Pipette all the bacteria and apply them to a LB solid culture dish containing Kan antibiotics. Place it in a 37°C constant temperature incubator and culture for 16 hours.

[0054] 5) After colony PCR identification and correct sequencing, it was determined that the recombinant E. coli strain E. coli BL21 (DE3) / pET28a-Xylanmeta expressing Xylanmeta was obtained.

[0055] 3. Expression and preparation of β-1,4-endo-xylanase

[0056] 1) Pick a single colony of E. coli BL21(DE3) / pET28a-Xylanmeta and inoculate it into LB liquid medium, and culture it at 37°C with shaking;

[0057] 2) The seeds obtained in step 1) were inoculated into LB liquid medium at a rate of 0.1%, and cultured at 37°C and 180 rpm for about 3-4 hours until the OD 600 Reach 0.6~1.0;

[0058] 3) Add IPTG (final concentration 0.7 mmol / L) to the culture medium of step 2) and induce expression for 15 h at 28°C and 160 r / min;

[0059] 4) After the induction expression is completed, centrifuge at 8000r / min for 6min, collect the bacteria, resuspend the bacteria with Tris-HCl (pH7.0) buffer, and then ultrasonically disrupt the cells in an ice water bath (300W, ultrasound on for 5s, ultrasound off for 7s). The ultrasonically disrupted cell liquid is centrifuged in a refrigerated centrifuge at 4°C and 12000r / min for 10min. Repeat 2 to 3 times (without foreign cell debris) and collect the supernatant to obtain a highly stable β-1,4-endo-xylanase enzyme solution.

[0060] 5) The activity of crude β-1,4-endo-xylanase solution was determined using beechwood xylan as substrate (under pH = 6 and 70°C). After fermentation with a recombinant strain expressing β-1,4-endo-xylanase in Escherichia coli, the activity of β-1,4-endo-xylanase reached 290 U / mL. The β-1,4-endo-xylanase was precipitated by graded salting-out method, and the protein precipitate was collected, dissolved, dialyzed for desalination, and subjected to ion exchange chromatography and gel chromatography, and then freeze-dried to obtain pure β-1,4-endo-xylanase enzyme powder. The obtained enzyme powder was subjected to SDS-PAGE electrophoresis. The results are shown in the figure. Figure 2 As shown, Figure 2 Lane 1 is the protein ladder, and lane 2 is the obtained enzyme powder sample.

[0061] Example 3 Determination of β-1,4-endo-xylanase activity

[0062] The method for determining enzyme activity was the DNS reagent method. The enzyme activity was determined in three parallel experiments, and the results were averaged.

[0063] Enzyme activity unit (U): the amount of enzyme required to release 1 μmol of reducing sugar per minute.

[0064] Optimum pH: At 50°C, place the reaction system at different pH (4-9, see Figure 3 The enzyme activity was measured in a buffer solution (as shown), and the highest enzyme activity was taken as 100% to draw a pH-relative enzyme activity curve.

[0065] Optimum temperature: Under the optimal reaction pH conditions, take an appropriately diluted enzyme solution and place it in a 55-90°C water bath for enzymatic hydrolysis. Measure the enzyme activity at 5°C intervals, and take the highest enzyme activity as 100% to draw a temperature-relative enzyme activity curve.

[0066] pH stability: The enzyme solution was placed in buffer solutions of different pH values, incubated at 70°C for 5 h, and the residual enzyme activity was determined with the highest enzyme activity as 100%.

[0067] Thermal stability determination: Under the optimal reaction pH conditions, the enzyme solution was placed in different temperature gradient conditions (55-90°C) and incubated for 2 hours. The highest enzyme activity was taken as 100%, and the residual enzyme activity of Xylanmeta xylanase was determined.

[0068] The enzymatic properties of the β-1,4-endo-xylanase were determined by the above method. The enzymatic properties of the β-1,4-endo-xylanase are as follows:

[0069] When beechwood xylan was used as substrate to determine the enzymatic properties of β-1,4-endo-xylanase, the optimum temperature was 70°C. Figure 3 , the optimum pH is 6, see Figure 4 ;

[0070] The pH stability and thermal stability of the β-1,4-endo-xylanase were determined using beechwood xylan as a substrate. The results showed that it had good stability at 60-80°C and in the range of pH=5-8. Taking the enzyme activity at 70°C as the standard, the relative enzyme activity was higher than 88% in the range of 60-80°C. As the temperature increased, the enzyme activity gradually decreased. When the temperature was 90°C, the relative enzyme activity was only about 20%. Taking the enzyme activity at pH=6 as the standard, the enzyme had a relatively stable relative enzyme activity at pH=5-8, maintaining above 90%. When the pH reached 9, the relative enzyme activity dropped to 25%.

[0071] Application Example 1 Degradation of feed raw material bran by β-1,4-endo-xylanase Xylanmeta

[0072] This application example intends to determine the effect of the enzyme on the degradation of bran, as follows:

[0073] The experimental feed raw material substrate is bran, which is dried and crushed and passed through a 24-mesh sieve. The experiment was designed with two treatments: a control group (without enzyme) and an enzyme-added group.

[0074] Control group: Weigh 10g substrate feed, mix with enzyme for enzymolysis at a feed-water ratio of 1:10 (water is 0.1mol / L acetic acid-sodium acetate buffer with pH=6.5). After the enzymolysis begins, oscillate once every 1h at 120r / min. After the enzymolysis is completed, add 5mL 10% trichloroacetic acid solution, take out an appropriate amount of enzymolysis sample, centrifuge at 4000r / min for 10min, collect the supernatant, and measure its reducing sugar content.

[0075] Enzyme group: Weigh 10g substrate feed, and finally add β-1,4-endo-xylanase Xylanmeta: 10U / g raw material; according to the material-water ratio of 1:10 (water is 0.1mol / L acetic acid-sodium acetate buffer at pH 6.5). The enzymolysis temperature is 60℃, and the enzymolysis is 5h. After the enzymolysis starts, oscillate once every 1h, at a speed of 120r / min, for 10min each time. After the enzymolysis is completed, add 5mL of 10% trichloroacetic acid solution, take out an appropriate amount of enzymolysis sample, 4000r / min, centrifuge for 10min, collect the supernatant, and measure its reducing sugar content.

[0076] The soluble reducing sugar content of the sample after enzymatic hydrolysis was determined by DNS method. An appropriate amount of sample solution was taken and placed in a 25 mL volumetric flask, and water was added to 2 mL. Then 1.5 mL of 3,5-dinitrosalicylic acid solution was added, and color was developed in boiling water for 5 min, and then quickly cooled with running water, and the volume was made up to 20 mL with water, and shaken. Zero was adjusted with distilled water, and the color was compared at 540 nm. The reducing sugar content was calculated by referring to the glucose standard curve.

[0077] Among them, reducing sugar growth rate (%) = (reducing sugar content in the enzyme group - reducing sugar content in the control group) / reducing sugar content in the control group × 100%

[0078] The increasing rate of reducing sugar in bran enzymatically hydrolyzed by β-1,4-endo-xylanase Xylanmeta was 84.2%.

[0079] In summary, the present invention provides a β-1,4-endo-xylanase, and provides the amino acid sequence and coding gene sequence of the enzyme. At the same time, it also provides an efficient preparation method of the enzyme. The prepared β-1,4-endo-xylanase has a highly efficient enzymatic hydrolysis effect on bran, can significantly improve the in vitro enzymatic hydrolysis reducing sugar growth rate of bran, is beneficial to the pretreatment of bran raw materials, and has application value for preparing feed using bran.

[0080] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A novel β-1,4-endo-xylanase, characterized in that: The amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO.

4.

2. The use of the β-1,4-endo-xylanase according to claim 1 in any of the following items, comprising increasing the growth rate of reducing sugars in bran by enzymatic hydrolysis in vitro; Enzymatically hydrolyzed bran is used to prepare bran feed.

3. The gene encoding β-1,4-endo-xylanase according to claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. A primer for identifying a gene encoding a gene as claimed in claim 3, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. A recombinant plasmid comprising the coding gene as claimed in claim 3.

6. The recombinant plasmid according to claim 5, characterized in that The recombinant plasmid is selected from prokaryotic plasmids.

7. The recombinant plasmid according to claim 6, characterized in that The prokaryotic plasmid is selected from pET28a(+).

8. A recombinant bacterium capable of expressing the β-1,4-endo-xylanase according to claim 1.

9. The recombinant bacterium according to claim 8, characterized in that The recombinant bacteria is selected from Escherichia coli BL21 (DE3).

10. The method for preparing β-1,4-endo-xylanase according to claim 1, characterized in that: Include: The recombinant bacteria in claim 8 or 9 are fermented and cultured, induced by IPTG, and then centrifuged to collect the supernatant to obtain the β-1,4-endo-xylanase.

Images