SgRNA sequence for targeted knockout of O antigen gene cluster OL101 and application of sgRNA sequence

Abstract

The invention discloses a sgRNA sequence for targeted knockout of an O antigen gene cluster OL101 and application of the sgRNA sequence. The invention relates to an sgRNA sequence for targeted knockout of an O antigen gene cluster OL101. The sequence comprises oagen-sgRNA-F as shown in SEQ ID NO. 1 and oagen-sgRNA-R as shown in SEQ ID NO. 2. The invention relates to a CRISPR / Cas9 and lambda Red plasmid vector system for targeted knockout of an O antigen gene cluster OL101, the plasmid vector system is a sgRNA sequence for targeted knockout of the O antigen gene cluster in claim 1 and a recombinant expression plasmid vector of lambda Red and CRISPR / cas9 vectors, and the sequence of the plasmid vector system is as shown in SEQ ID NO.3. According to the invention, the Klebsiella pneumoniae OL101 can be specifically knocked out in a targeted manner, so that an OL101 knocked-out strain is obtained, and the specific functions of the Klebsiella pneumoniae O antigen OL101 can be clarified. According to the system for targeted knockout of the Klebsiella pneumoniae O antigen OL101, O antigen gene clusters of strains can be effectively knocked out, the gene knockout period is short, and the method is simple.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a sgRNA sequence for targeted knockout of an O antigen gene cluster, a CRISPR / Cas9 and a plasmid vector system of λRed and an application thereof. Background Art

[0002] In recent years, the drug resistance of bacteria in my country has become increasingly serious, and multidrug-resistant and even pan-drug-resistant bacteria have gradually become an important cause of infection and death in patients. According to the results of the BRICS China Bloodstream Infection Bacterial Resistance Monitoring (January-December 2021), carbapenem, as one of the first-line drugs for the treatment of Klebsiella pneumoniae, has a resistance rate of about 15%. Carbapenem-resistant Klebsiella pneumoniae (CRKP) has a high incidence and mortality rate, which imposes a serious medical burden on patients. It is currently known that the ST11 type is the most important medical-related CRKP clone in China. This clone has the OL101 type O antigen, which is encoded by the OL101 gene cluster. The O antigen of lipopolysaccharide plays an important role in the bacterial pathogenicity, but the specific function of the OL101 antigen of this CRKP clone still needs to be further understood.

[0003] In 2000, some scholars developed a method to use the lambda phage homologous recombination system to achieve recombination between exogenous linear double-stranded DNA and chromosomal DNA homologous sequences in Escherichia coli. In actual operation, the genes of three red proteins (Gam, Exo, Beta) are placed on the expression vector. Once the exogenous dsDNA is electroporated into the cell, there is a probability that homologous recombination will occur in the same genomic target sequence, replacing the gene to be knocked out.

[0004] The CRISPR-Cas system is an RNA-mediated acquired immune system that provides sequence-specific protection against foreign DNA. When foreign DNA enters bacteria and invades their genome, the bacteria will use this defense mechanism to cut it off. Currently, the CRISPR / Cas system has been developed into a genome editing tool. Summary of the invention

[0005] The purpose of the present invention is to provide a sgRNA sequence and application thereof for targeted knockout of O antigen gene cluster OL101 in view of the deficiencies of the prior art.

[0006] The technical solution of the present invention is as follows: A sgRNA sequence for targeted knockout of an O antigen gene cluster OL101, comprising oagen-sgRNA-F as shown in SEQ ID NO.1 and oagen-sgRNA-R as shown in SEQ ID NO.2.

[0007] A CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of an O antigen gene cluster OL101. The plasmid vector system is a recombinant expression plasmid vector of the sgRNA sequence, λRed and CRISPR / cas9 vector for targeted knockout of an O antigen gene cluster, and its sequence is: SEQ ID NO.3.

[0008] A method for constructing a CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of an O antigen gene cluster comprises the following steps: (1) using BsaI to digest the plasmid vector pCAS-RED to obtain a linear pCAS-RED vector after digestion; (2) annealing oagen-sgRNA-F and oagen-sgRNA-R of the sgRNA sequence targeting the knockout of the O antigen gene cluster to obtain a double-stranded DNA sequence, and connecting the double-stranded DNA sequence to the pCAS-RED plasmid vector after enzyme digestion to obtain a recombinant expression plasmid vector of the sgRNA sequence targeting the knockout of the O antigen gene cluster.

[0009] The application of the CRISPR / Cas9 and λRed plasmid vector system is used to target and knock out the Klebsiella pneumoniae O antigen gene cluster.

[0010] The beneficial effects of the present invention are as follows: The sgRNA sequence for targeted knockout of the O antigen gene cluster provided by the present invention can specifically target the O antigen gene cluster OL101. By constructing it into a CRISPR / Cas9 vector system and combining it with a λRed homologous recombination system, it can specifically target and knock out the Klebsiella pneumoniae O antigen gene cluster to obtain a strain with the O antigen gene cluster knocked out, thereby facilitating the elucidation of the specific function of OL101.

[0011] The CRISPR / Cas9 targeted knockout system of the Klebsiella pneumoniae O antigen gene cluster of the present invention can effectively knock out the O antigen gene cluster of the strain, with a short gene knockout cycle and a simple method. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a plasmid map of the recombinant expression vector pCAS-RED-sgRNA constructed in the examples of the present invention.

[0013] Figure 2 This is a graph showing the results of PCR detection by electrophoresis in an embodiment of the present invention.

[0014] Figure 3 It is the survival rate of bacteria after serum treatment in the embodiment of the present invention. DETAILED DESCRIPTION

[0015] The present invention will be described in detail below according to the accompanying drawings and preferred embodiments, and the purpose and effect of the present invention will become more clear. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0016] The principle of targeting the sgRNA sequence for knocking out the O antigen gene cluster is as follows: The target sequence of the sgRNA on the O antigen gene cluster conforms to the sequence arrangement rule of 5'-N(20)-NGG(PAM), the target sequence of the sgRNA on the O antigen gene cluster is located in the conserved region of the gene, and the target site sequence of the sgRNA on the O antigen gene cluster is shown in the sequence table SEQ ID NO.1. The TAGT sequence is added to the 5'-end of the target site sequence of the sgRNA on the O antigen gene cluster to synthesize a forward oligonucleotide, namely, Forward oligo; the complementary chain of the target site sequence of the sgRNA on the O antigen gene cluster is obtained, and the AAAC sequence is added to the 5'-end of the complementary chain to synthesize a reverse oligonucleotide, namely, Reverse oligo.

[0017] The Forward oligo and Reverse oligo of the two complementary oligonucleotides synthesized are annealed and connected to form a double-stranded sgRNA oligonucleotide that can be connected to the plasmid vector.

[0018] The annealed double-stranded sgRNA oligonucleotide was connected to the linearized vector pCAS-RED carrying the Cas9 gene and Red gene (gam, exo, beta) to obtain the expression vector pCAS-RED-sgRNA plasmid carrying the sgRNA oligonucleotide containing the corresponding target sequence ( Figure 1 ), transform competent bacteria DH5α and inoculate on hygromycin plates, pick single clones and identify positive clones by sequencing, and shake the positive clones to extract plasmids.

[0019] The pCAS-RED-sgRNA plasmid carrying sgRNA, Cas9 and Red at the same time and the repair template containing 500bp homology arms at both ends of the O antigen gene cluster were used to transfer to the target bacteria, and hygromycin resistance screening was added to select monoclonal bacteria, and genomic DNA was extracted. The gene fragment containing the target sequence was PCR amplified using the genomic DNA as a template, and the O antigen gene cluster was confirmed to have been knocked out by whole genome sequencing to obtain knockout bacteria. The specific preparation method is as follows: S1: Prepare 10 MHA solid plates containing 100 μg / ml hygromycin S1.1: Weigh 7.6 g of Mueller-Hinton Agar (MHA) culture medium into 200 ml of distilled water, autoclave at 121°C for 20 minutes, and place in a 60°C water bath for later use.

[0020] S1.2: Accurately weigh 0.02 g of hygromycin into 1 ml of aqueous solution to obtain a hygromycin solution.

[0021] S1.3: Add the hygromycin solution prepared in S1.2 to the 200 ml MHA culture medium prepared in S1.1, mix well, and pour into a sterile culture dish with a diameter of 90 mm, about 20 ml in each culture dish.

[0022] S1.4: Incubate at room temperature for 2 hours until the MHA medium solidifies, then dry in the air and store at 4°C for future use.

[0023] S2: Preparation of competent bacteria S2.1: Columbia blood agar plates were inoculated with the target bacteria in four zones.

[0024] S2.2: Weigh 1.9 g of Mueller-Hinton (MH) medium in 50 ml of distilled water and sterilize by autoclaving at 121°C for 20 minutes. After the autoclave is over, place in a 4°C refrigerator for later use.

[0025] S2.3: Pick a single colony and add it to 5 ml liquid culture medium, amplify it at 220 rpm and 37°C overnight. On the next day, take 500 μL and add it to 50 ml MH liquid culture medium, amplify it at 220 rpm and 37°C for 2.5 hours to culture the bacteria.

[0026] S2.4: Use a centrifuge to collect the bacteria. The centrifuge is set at 5000 rpm for 5 minutes.

[0027] S2.5: Rinse the bacteria with 15 ml of double distilled water (ddH2O) precooled at 4°C and resuspend the bacteria.

[0028] S2.6: Repeat step S2.5.

[0029] S2.7: Use the same centrifugation conditions as S2.4 again to collect the bacteria by centrifugation, wash the bacteria with 1 ml of 10% glycerol solution by volume, and resuspend the bacteria.

[0030] S2.8: Repeat step S2.7.

[0031] S2.9: Dispense into 1.5 ml EP test tubes, 100 μL per tube, and store at -80℃ until use.

[0032] S3: Construction of pCAS-RED-sgRNA plasmid: S3.1: Synthesize the following two sgRNA sequences (1) oagen-sgRNA-F:TAGTTTCGTTGCAACCGTCAACCG; as shown in SEQ ID NO.1; (2) oagen-sgRNA-R: AAACCGGTTGACGGTTGCAACGAA; as shown in SEQ ID NO.2.

[0033] S3.2: Dilute the two sequences to 100 μmol / L using ddH2O according to the synthesized concentration.

[0034] S3.3: Anneal the two sgRNA sequences to form a double-stranded sgRNA according to the following conditions.

[0035] (1) Add a, b, and c to a 0.2 ml PCR tube and heat at 95°C for 3 minutes in a thermal cycler. Then cool the PCR tube to 25°C at a rate of 0.5°C / 10s in the thermal cycler. The two sequences will automatically connect to form a double-stranded sgRNA. a. 1 μl oagen-sgRNA-F solution b. 1 μl oagen-sgRNA-R solution c. 8 μl ddH2O.

[0036] (2) Place the double-stranded sgRNA annealed in (1) at 4°C for later use.

[0037] S3.4: Use Bsal endonuclease to digest the pCAS-RED plasmid, specifically: Prepare the following ad system, mix well at low speed in a centrifuge, 1000 rpm, 10 seconds, then place in a 37°C constant temperature water bath for 2 hours, purify the plasmid vector using a DNA purification kit after the water bath ends, and store for later use.

[0038] a.1μl Bsal b. 5 μl 10× Cutsmart Buffer c.5μl pCAS-RED (200μg / ml) d. 39 μl ddH2O.

[0039] S3.5: Use T4 DNA ligase to connect the pCAS-RED plasmid vector digested in S3.4 and the double-stranded sgRNA in S3.3, specifically: The following system was configured, and the mixture was mixed at low speed in a centrifuge, 1000 rpm, for 10 seconds. Then, the mixture was placed in a constant temperature water bath at 16°C for 2 hours to obtain the pCAS-RED-sgRNA plasmid, the sequence of which is shown in SEQ ID NO.3.

[0040] a. 0.5 μl T4 DNA ligase b.1μl 10× Ligase Buffer c.2μl linearized pCAS-RED (25μg / ml) d.1 μl double-stranded sgRNA e. 5.5 μl ddH2O.

[0041] S4: Electroporation of pCAS-RED-sgRNA plasmid into Klebsiella pneumoniae S4.1: Thaw the prepared competent bacteria stored at -80℃ on ice.

[0042] S4.2: Add 3 μl of the ligated pCAS-RED-sgRNA plasmid and mix gently. Be careful not to shake the cells vigorously.

[0043] S4.3: Use the Bio-Rad electroporation instrument to transform the pCAS-RED-sgRNA plasmid into competent bacteria (condition: voltage 2500V).

[0044] S4.4: Quickly add 900 μl of SOC (Super Optimal Broth) medium (pre-warmed at 37°C) containing L-arabinose.

[0045] S4.5: Cultivate with shaking at 30°C for 1 hour (200 rpm).

[0046] S4.6: Take an appropriate amount of 50 μl and spread it on MHA solid plate culture medium containing 100 μg / ml hygromycin.

[0047] S4.7: Incubate overnight at 37°C.

[0048] S5: PCR verification of target gene knockout S5.1: Select a single colony cultured on the above-mentioned MHA solid medium containing 100 μg / ml hygromycin.

[0049] S5.2: Use PCR to amplify a gene wbbB in the O antigen gene cluster.

[0050] S5.3: After PCR, use agarose gel electrophoresis to detect the PCR results. Add gelred nucleic acid dye. If no bands are imaged, it means PCR is negative.

[0051] S5.4: The PCR-negative strain is the knockout strain. Select a single colony and store it in a 30% volume ratio glycerol broth medium at -80°C for future use.

[0052] like Figure 2 The figure shows the PCR results of the electrophoresis detection in this example, where M is a marker, 1 is the original wild-type strain, and 2-6 are strains with the O antigen gene cluster knocked out. The electrophoresis of the PCR amplification band of the original strain is positive, and the electrophoresis of the knocked-out strain is negative.

[0053] S6: Serum resistance verification S6.1: Columbia blood agar plates were inoculated with the target bacteria in four zones.

[0054] S6.2: Pick up a single colony from step S6.1 and place it in sterile saline, adjust the turbidity to 0.5 McFarland turbidity, dilute it 10 times, and then take 1 ml of the bacterial solution and 1 ml of normal human serum and mix them at 37°C for reaction.

[0055] S6.3: After 2 hours of reaction, the mixed liquid was diluted gradiently and spread on non-resistant MHA plates. After being placed at 37°C for 16 hours, the bacteria were counted and the survival rate was calculated.

[0056] like Figure 3 The figure shows the difference in bacterial resistance to serum before and after knockout. Figure 3 The results showed that the survival ability of the strain in serum was reduced after the knockout, indicating that the knockout was successful.

[0057] Those skilled in the art can understand that the above are only preferred examples of the invention and are not intended to limit the invention. Although the invention is described in detail with reference to the above examples, those skilled in the art can still modify the technical solutions recorded in the above examples or replace some of the technical features therein with equivalents. Any modification, equivalent replacement, etc. made within the spirit and principle of the invention shall be included in the protection scope of the invention.

Claims

1. A sgRNA sequence for targeting and knocking out the O antigen gene cluster OL101, characterized in that: The sequence includes oagen-sgRNA-F as shown in SEQ ID NO.1 and oagen-sgRNA-R as shown in SEQ ID NO.

2.

2. A CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of O antigen gene cluster OL101, characterized in that: The plasmid vector system is a recombinant expression plasmid vector of the sgRNA sequence, λRed and CRISPR / cas9 vector for targeted knockout of the O antigen gene cluster as claimed in claim 1, and its sequence is: SEQ ID NO.

3.

3. A method for constructing a CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of the O antigen gene cluster, characterized in that: The steps include: (1) using BsaI to digest the plasmid vector pCAS-RED to obtain a linear pCAS-RED vector after digestion; (2) annealing oagen-sgRNA-F and oagen-sgRNA-R of the sgRNA sequence for targeting knockout of the O antigen gene cluster as claimed in claim 1 to obtain a double-stranded DNA sequence, and connecting the double-stranded DNA sequence with the pCAS-RED plasmid vector after enzyme digestion to obtain a recombinant expression plasmid vector of the sgRNA sequence for targeting knockout of the O antigen gene cluster.

4. An application of the CRISPR / Cas9 and λRed plasmid vector system as claimed in claim 2, characterized in that: Used to target and knock out the Klebsiella pneumoniae O antigen gene cluster.

Images