A 5'UTR and its application
By designing specific 5'UTR nucleotide sequences and lipid nanoparticle delivery systems, the stability and translation efficiency of mRNA were optimized, solving the problems of unstable translation efficiency and poor stability caused by existing UTR sequences, and improving the immunogenicity and safety of mRNA vaccines.
Patent Information
- Application Number
- CN202411972581.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2044-12-30
AI Technical Summary
Existing UTR sequences lead to unstable translation efficiency and poor stability of mRNA, resulting in immunogenicity. Furthermore, they make it difficult to achieve cell-specific expression and sequence optimization, thus affecting the therapeutic efficacy and safety of mRNA drugs.
A nucleotide sequence of 5'UTR is provided, selected from any one of SEQ ID NO:1-6 or a sequence with ≥80% homology therein, and the stability and translation efficiency of mRNA are optimized by adjusting the number of nucleotides at the 5' end and/or 3' end, and an optimized mRNA vaccine is formed by combining it with a lipid nanoparticle delivery system.
It significantly improved mRNA expression and stability, enhanced the immune effect of the vaccine, reduced immunogenicity, and achieved cell-specific expression and sequence optimization.
Smart Images

Figure CN119752906B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, specifically to a 5'UTR and its applications. Background Technology
[0002] The UTR (untranslated region) is the region in an mRNA molecule that does not encode a protein, and it is divided into the 5' UTR and the 3' UTR. The 5' UTR is located at the 5' end of the mRNA and contains promoter elements, which facilitate ribosome binding to mRNA and translation initiation. The 3' UTR is located at the 3' end and contains regulatory elements, affecting mRNA stability, transport, and degradation. In the mRNA domain, the UTR has a significant impact on mRNA stability and translation efficiency.
[0003] However, existing UTR technologies have several drawbacks. First, translation efficiency is unstable; certain UTR sequences may lead to low translation efficiency, affecting protein expression levels. Second, there are mRNA stability issues; some sequences in the 3' UTR may be detrimental to mRNA stability, leading to rapid degradation. Furthermore, UTR sequences may possess immunogenicity. All of these factors can potentially affect the therapeutic efficacy or safety of mRNA drugs. In addition, achieving cell-specific expression using UTRs, overcoming difficulties in mRNA sequence optimization, navigating mRNA production and purification challenges, and managing off-target effects are also challenges faced by current UTR technologies.
[0004] To overcome these drawbacks, this invention develops a new UTR designed to improve the efficiency and safety of mRNA therapy. Summary of the Invention
[0005] To overcome the above-mentioned shortcomings, the present invention provides a 5'UTR that can prolong mRNA expression and stability, and significantly improve the immune effect of the vaccine.
[0006] In one aspect, the present invention provides a 5'UTR, wherein the nucleotide sequence of the 5'UTR is selected from the group consisting of:
[0007] 1) The nucleotide sequence shown in any one of SEQ ID NO: 1-6;
[0008] 2) A nucleotide sequence with ≥80% homology to any of the sequences shown in SEQ ID NO:1-6; or,
[0009] 3) A nucleotide sequence in which the 5' end and / or 3' end of any of the nucleotide sequences shown in SEQ ID NO:1-6 is increased by 1-20 nucleotides and / or decreased by 1-20 nucleotides.
[0010] UTR (Untranslated Region) sequence identity refers to the similarity or consistency of UTR regions in sequences of different species or different genes.
[0011] In some embodiments, the nucleotide sequence of the 5'UTR is selected from nucleotide sequences that have ≥81% homology (preferably ≥85%, more preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) to the sequence shown in any of SEQ ID NO:1-6.
[0012] In some embodiments, the nucleotide sequence of the 5'UTR is selected from nucleotide sequences shown in any of SEQ ID NO:1-6, with 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotide added to the 5' and / or 3' ends.
[0013] In some embodiments, the nucleotide sequence of the 5'UTR is selected from the nucleotide sequence shown in any of SEQ ID NO:1-6, with the 5' end and / or 3' end reduced by 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotide.
[0014] In some embodiments, the nucleotide sequence of the 5'UTR is selected from nucleotide sequences shown in any of SEQ ID NO:1-6, wherein the 5' end is augmented with 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, or 1 nucleotide; and the 3' end is depleted with 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, or 1 nucleotide.
[0015] In some embodiments, the nucleotide sequence of the 5'UTR is selected from the nucleotide sequence shown in any of SEQ ID NO:1-6, wherein the 5' end is reduced by 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotide; and the 3' end is increased by 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotide.
[0016] Another aspect of the present invention provides a biological element comprising a 5'UTR as described in the present invention; the biological element is any one of the following:
[0017] a) mRNA transcription template construct;
[0018] b) Carrier;
[0019] c) Reporter gene systems; and,
[0020] d) Nucleic acid biological preparation of plasmid templates.
[0021] The ribonucleic acid (RNA) molecules used according to the present invention involve polymer molecules assembled into chains of nucleotides called G, A, U, and C. Each nucleotide in the RNA contains a ribose sugar, numbered 1' to 5' on the carbon atoms. A nitrogenous base is attached to the 1' position, typically adenine (A), cytosine (C), guanine (G), or uracil (U). In the polymer RNA molecule, a phosphate group is attached to the 3' position of one ribose and the 5' position of the next ribose. Thus, the nucleotides in the polymer RNA molecule are covalently linked to each other, wherein the phosphate group from one nucleotide binds to the 3' carbon on the subsequent nucleotide, thereby forming a phosphodiester bond. Thus, the RNA chain has a 5' end and a 3' end, named in relation to the carbons on the ribose ring. By convention, upstream and downstream refer to the 5' to 3' direction in which RNA transcription occurs. mRNA is a large family of RNA molecules that transmits genetic information from DNA to ribosomes, where they specify the amino acid sequence of the protein product of gene expression. After primary transcripts (mRNA) are transcribed by RNA polymerase (called pre-mRNA), the processed mature mRNA is translated into a polymer of amino acids: proteins, as outlined in the central dogma of molecular biology. As in DNA, mRNA genetic information is contained in a nucleotide sequence arranged as codons consisting of three bases each. Each codon encodes a specific amino acid, except for the stop codon, which terminates protein synthesis.
[0022] An mRNA transcription template construct containing a 5'UTR (upstream untranslated region) is a synthetic mRNA molecule designed in molecular biology to express a specific protein. This construct contains the sequence encoding the target protein, as well as some additional elements, including the 5'UTR.
[0023] In mRNA molecules, the 5'UTR is a non-coding region located upstream of the coding sequence (i.e., the open reading frame, ORF). This region has a significant impact on mRNA stability and translation efficiency. In eukaryotes, the 5'UTR typically contains regulatory elements, such as a 5' cap structure, which facilitates the initiation of mRNA translation.
[0024] An mRNA transcription template construct is a synthetic DNA template used to generate mRNA in vitro through transcription. This construct typically includes the following parts:
[0025] Promoter: A DNA sequence used to initiate the transcription process of mRNA. In mammalian cells, commonly used promoters include the human cytomegalovirus promoter (HCMV) or the rabbit β-globin promoter.
[0026] 5'UTR: Located between the promoter and the coding sequence, it can affect mRNA stability and translation efficiency. The 5'UTR can be extracted from natural genes or artificially designed. As used in this invention, the 5'UTR (5' untranslated region) (also called the leader sequence or leader RNA) is the region of mRNA located directly upstream of the start codon. The 5'UTR begins at the transcription start site and terminates one nucleotide (nt) before the start codon (usually AUG) of the coding region. In prokaryotes, the 5'UTR is often 3-10 nucleotides long, while in eukaryotes it is often much longer, generally ranging from 100 to several thousand nucleotides long, although shorter UTRs are sometimes observed in eukaryotes.
[0027] The coding sequence (ORF) or coding region is the coding sequence of the target protein, which will be transcribed into mRNA and translated into protein in the cell.
[0028] 3'UTR: An untranslated region located downstream of the coding sequence, which may contain sequences that regulate mRNA stability and degradation. As used in this invention, the 3'UTR may contain regulatory regions within the 3' untranslated region known to affect mRNA polyadenylation and stability. Many 3'UTRs also contain AU-rich elements (AREs).
[0029] In some embodiments, the 3'UTR has a nucleotide sequence as shown in SEQ ID NO:10.
[0030] The poly(A) tail (polyadenylation signal) is a sequence used to add a string of adenosine nucleotides (poly(A) tail) to the 3' end of mRNA, which helps with mRNA stability and translation.
[0031] In some implementations, the mRNA transcription template construct further includes one or more of a promoter element, a coding region, a 3'UTR, and a polyA tail element.
[0032] In some implementations, the elements in the mRNA transcription template construct are arranged in the following order from the 5' end to the 3' end: promoter element, 5'UTR, coding region, 3'UTR, and PolyA tail.
[0033] The vector of the present invention may be, for example, a plasmid, a granule, a virus, a bacteriophage, or another vector conventionally used in genetic engineering, and may contain additional genes, such as marker genes that allow selection of the vector in a suitable host cell and under suitable conditions.
[0034] Furthermore, the vector of the present invention can also be an expression vector. The nucleic acid molecules and vectors of the present invention can be designed for direct introduction into cells or for introduction via liposomes, viral vectors (e.g., adenovirus, retrovirus), electroporation, ballistic (e.g., gene gun) or other delivery systems. Additionally, baculovirus systems can be used as eukaryotic expression systems for the nucleic acid molecules of the present invention.
[0035] In some implementations, the vector is an expression vector or a cloning vector; the vector is a virus or a plasmid.
[0036] In some implementations, the carrier is pUC-Kan-TMA.
[0037] In this context, the expression vectors are known in the art, such as Okayama-Berg cDNA expression vectors pcDV1 (Pharmacia), pRc / CMV, pcDNA1, pcDNA3 (In-vitrogene), pSPORT1 (GIBCO BRL), pX (Pagano, Science 255 (1992), 1144-1147), yeast two-hybrid vectors such as pEG202 and dpJG4-5 (Gyuris, Cell 75 (1995), 791-803), or prokaryotic expression vectors such as λgt11 or pGEX (Amersham-Pharmacia).
[0038] In some implementations, the nucleic acid biopharmaceutical plasmid template includes one or more of a promoter, a coding region, a 3'UTR, and a terminator.
[0039] In addition to the sequence of the nucleic acid molecule encoding the mRNA molecule of the present invention, the vector of the present invention may also contain expression control elements that allow proper expression of the coding region in a suitable host. Such control elements are known to those skilled in the art and may include promoters, splice cassettes, translation start codons, and translation and insertion sites for introducing the insert into the vector. Preferably, the nucleic acid molecule of the present invention is operatively linked to the expression control sequence that allows expression in eukaryotic or prokaryotic cells. Therefore, the present invention relates to vectors containing the nucleic acid molecule of the present invention, wherein when eukaryotic and / or prokaryotic (host) cells are transfected with the vector, the nucleic acid molecule is operatively linked to a control sequence recognized by the host cell.
[0040] In some embodiments, the polyA has a nucleotide sequence as shown in SEQ ID NO:16.
[0041] Control elements that ensure expression in eukaryotic and prokaryotic (host) cells are well known to those skilled in the art. As mentioned above, they typically include regulatory sequences that ensure transcription initiation and, optionally, polyadenylate signals that ensure transcription termination and transcript stabilization.
[0042] However, according to the present invention, it is not important that the vector itself contains the polyadenylated tail sequence. As described above, if the mRNA molecule of the present invention is generated by the in vitro transcription method further described herein, the aforementioned polyadenylated tail is part of the construct of the present invention (and is not necessarily initially located on the cloning vector) and is located at the 3' end of the RNA, adjacent to the UTR at the 3' end of the RNA construct. If the RNA molecule of the present invention is generated by the in vitro transcription method, the plasmid containing the RNA molecule of the present invention is linearized prior to in vitro transcription downstream of the polyadenylated tail to ensure that the in vitro transcribed RNA molecule contains the aforementioned polyadenylated tail.
[0043] The reporter gene system containing the 5' untranslated region (5'UTR) is an experimental tool that uses the 5'UTR sequence to bind to a reporter gene (such as fluorescent protein or β-galactosidase) and clone it into an expression vector to study how the 5'UTR affects the stability and translation efficiency of mRNA, thereby revealing the role of gene expression regulation mechanisms, promoter activity, translation efficiency, and intracellular signaling pathways.
[0044] In some implementations, the reporter gene system further includes one or more of a promoter, expression vector, reporter gene, and regulatory element.
[0045] Regulatory elements may include transcriptional and translational enhancers, and / or naturally related or heterologous promoter regions. These regulatory elements may also include enhancers or silencers, which are key regulatory elements of gene expression. Enhancers such as immunoglobulin enhancers, enhancers in the HIV LTR, muscle-specific enhancers, glucocorticoid receptor response elements (GREs), and thyroid hormone receptor response elements (TREs) can enhance gene expression, while silencers such as HIV silencers, lactose operon silencers, thyroid hormone receptor silencers, vitamin D receptor silencers, and Mad / Max silencing elements can suppress gene expression.
[0046] In some implementations, the control element is an enhancer or a silencer.
[0047] The promoters include the CMV-HSV thymidine kinase promoter, SV40, RSV promoter (Rous sarcoma virus), human elongation factor 1α promoter, glucocorticoid-induced MMTV promoter (mouse mammary tumor virus), metallothionein- or tetracycline-inducible promoters or enhancers, such as the CMV enhancer or SV40 enhancer. These promoters are known in the art and are described in particular in Charron, J. Biol. Chem. 270 (1995), 25739-25745. For expression in prokaryotic cells, many promoters have been described, including, for example, the tac-lac promoter or the trp promoter.
[0048] In some implementations, the promoter is, for example, the T7 promoter, the SV40 promoter, the CMV promoter, or the GRE promoter.
[0049] In some embodiments, the reporter gene is, for example, green fluorescent protein, luciferase, β-galactosidase, alkaline phosphatase, or anthocyaninase.
[0050] In another aspect, the present invention provides a transformant comprising a host cell of a 5'UTR as described in the present invention or a biological element as described in the present invention.
[0051] This invention relates to hosts or non-human hosts carrying vectors of the invention, i.e., host cells or hosts, which are typically genetically modified with nucleic acid molecules or vectors containing such nucleic acid molecules according to the invention. The term "genetic modification" refers to the presence of nucleic acid molecules or vectors according to the invention in addition to the host cell or host's natural genome, introduced into the cell or host or one of its predecessors / parents. The nucleic acid molecules or vectors may exist as independent molecules outside the genome, preferably as replicable molecules, in the genetically modified host cell or host, or they may be stably integrated into the genome of the host cell or host. Transformation of host cells with vectors according to the invention can be performed using standard methods, such as those described in Sambrook and Russell (2001), *Molecular Cloning: A Laboratory Manual*, CSH Press, Cold Spring Harbor, NY, USA; and *Methods in Yeast Genetics*, *A Laboratory Course Manual*, Cold Spring Harbor Laboratory Press, 1990. The host cells are cultured in a nutrient medium that meets the specific requirements of the host cells being used—particularly in terms of pH, temperature, salt concentration, aeration, antibiotics, vitamins, and trace elements.
[0052] The host cell of this invention can be any prokaryotic or eukaryotic cell. Suitable prokaryotic cells are those commonly used for cloning, such as *Escherichia coli* or *Bacillus subtilis*. Eukaryotic cells include, for example, fungal or animal cells. Examples of suitable fungal cells are yeast cells, preferably those of the genus *Saccharomyces*, and most preferably those of the species *Saccharomyces cerevisiae*. Suitable animal cells are, for example, insect cells, vertebrate cells, preferably mammalian cells, such as, for example, HEK293, NSO, CHO, COS-7, MDCK, U2-OSHela, NIH3T3, MOLT-4, Jurkat, PC-12, PC-3, IMR, NT2N, Sk-n-sh, CaSki, and C33A. Other suitable cell lines known in the art can be obtained from cell line collections, such as Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) or American Type Culture Collection (ATCC). According to the present invention, it is further envisioned that primary cells / cell cultures can function as host cells. These cells are particularly derived from insects (such as fruit flies or cockroaches) or mammals (such as humans, pigs, mice, or rats). The host cells may also comprise cells derived from and / or derived from cell lines such as neuroblastoma cell lines. The primary cells mentioned above are well known in the art, and particularly include primary astrocytes, (mixed) vertebral cultures, or hippocampal cultures.
[0053] In some implementations, the host cell is a prokaryotic cell or a eukaryotic cell.
[0054] In some embodiments, the host cell is selected from yeast cells or mammalian cells; the mammalian cell is, for example, HEK293 cells.
[0055] Another aspect of the present invention provides a method for optimizing mRNA, the method comprising the steps of:
[0056] (i) Culturing the transformant as provided in this invention to obtain a culture containing a vector containing an mRNA transcription template construct;
[0057] (ii) Isolate and / or recover the vector described in (i) from the culture and linearize it with enzymes to form an mRNA transcription template;
[0058] (iii) Transcribe the mRNA transcription template described in step (ii) to obtain optimized mRNA.
[0059] In some embodiments, the method further includes the step of purifying and / or modifying the optimized mRNA obtained in step (iii).
[0060] The present invention also relates to a method for producing the RNA molecules of the present invention by culturing host cells containing expression vectors encoding various modules of the present invention or the entire RNA molecule of the present invention in a culture medium, and recovering the RNA molecules from the host cells or the culture medium. The present invention further relates to a method for producing the RNA molecules of the present invention, comprising culturing host cells of the present invention and optionally recovering the RNA molecules from the culture. Methods for recovering and / or subsequently purifying the RNA molecules of the present invention are known to those skilled in the art.
[0061] In another aspect, the present invention provides an optimized mRNA, which is prepared by the method described in the present invention.
[0062] As used in this invention, the 3'UTR (3' untranslated region) relates to the portion of messenger RNA (mRNA) immediately following the translation stop codon. mRNA molecules are transcribed from a DNA sequence and then translated into proteins. Several regions of the mRNA molecule are not translated into proteins, including the 5' cap, 5'UTR, 3'UTR, and PolyA tail.
[0063] In some implementations, the optimized mRNA also includes one or more of a 3'UTR and a polyA tail element.
[0064] In some embodiments, the mRNA comprises mRNA encoding the RABV-G protein.
[0065] In some embodiments, the amino acid sequence of the RABV-G protein is shown in SEQ ID NO:21.
[0066] In some embodiments, the sequence of the mRNA encoding the RABV-G protein is shown in SEQ ID NO:28.
[0067] mRNA can be modified in various ways, including 5' cap structure, nucleotide modifications (such as N1-methylpseuuridine, 5-methylcytidine, 2'-O-methylated nucleotides, pseudouridine, locked nucleotides), 3' end poly-A tail modification, non-natural bases, backbone modification, and binding to lipid nanoparticles, to improve its stability and translation efficiency, reduce immunogenicity, and promote intracellular delivery.
[0068] The present invention provides an mRNA vaccine against RABV-G, wherein the mRNA vaccine comprises the mRNA as described in the present invention.
[0069] Another aspect of the present invention provides the application of the 5'UTR, the biological element, or the host cell provided by the present invention in optimizing mRNA.
[0070] Another aspect of the present invention provides a drug-loaded lipid nanoparticle, wherein the lipid nanoparticle contains the optimized mRNA provided by the present invention.
[0071] In some embodiments, the lipid nanoparticles further comprise one or more of cationic lipids, ionizable lipids, auxiliary lipids, cholesterol and its derivatives, lipid polymer complexes, and PEG lipids and their derivatives.
[0072] In some implementations, PEG lipids, also known as PEG-lipids or polyethylene glycol-lipids, are complex molecules used in drug delivery and biomedical research, consisting of two parts: polyethylene glycol (PEG) and lipids.
[0073] In some implementations, the lipid nanoparticles are used to encapsulate and protect mRNA.
[0074] In some embodiments, the auxiliary lipid is a phospholipid derivative.
[0075] In some embodiments, the lipid nanoparticles comprise 30 mol% to 90 mol% cationic / ionizable lipids; 0 mol% to 20 mol% phospholipids; 30 mol% to 50 mol% cholesterol and its derivatives; and 0 mol% to 5 mol% PEG lipids.
[0076] In some embodiments, the cationic lipid comprises one or more of hydroiodic acid, 1,2-dilinoleyl-3-dimethylammonium, 1,2-dilinoleyl-3-[(N,N-dimethylamino)ethylamino]propane-1-ol, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium, 1,2-dioleoyl-sn-glycerol-3-trimethylammonium, N,N-dioleoyl-1,3-propanediammonium, N-[1-(2,3-dioleoyloxy)propyl]-N,N-dimethylglycine, N-[1-(2,3-dioleoyloxy)propyl]-N,N-dimethylethylene glycol, dodecylamine, octadecylamine, octadecyl phosphate, polyethylene glycol-200-dodecyl ether, polyethylene glycol-200-octadecyl ether, and 2-[(2-aminoethyl)amino]ethanol.
[0077] In some embodiments, the phospholipids comprise 1,2-distearyl-sn-glycerol-3-phosphocholine, 1,2-dilinoleoyl-sn-glycerol-3-phosphocholine, 1,2-dimyristoyl-sn-glycerol-phosphocholine, 1,2-dioleoyl-sn-glycerol-3-phosphocholine, 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine, and 1,2-distearyl-sn-glycerol. -3-phosphocholine, 1,2-di-undecanoyl-sn-glycerol-phosphocholine, 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine, 1,2-di-O-octadecenyl-sn-glycerol-3-phosphocholine, 1-oleoyl-2-cholesterolylhemisuccinoyl-sn-glycerol-3-phosphocholine, 1-hexadecyl-sn-glycerol-3-phosphocholine, 1,2-dilinyl One or more of the following: 1,2-diarachidonico-sn-glycerol-3-phosphate choline, 1,2-di-docosahexaenoo-sn-glycerol-3-phosphate choline, 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diphydanoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-distearate-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinolenoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonico-sn-glycerol-3-phosphate ethanolamine, 1,2-di-docosahexaenooyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt, and sphingomyelin.
[0078] In some embodiments, the cholesterol and its derivatives comprise one or more of cholesterol, steroids, sitosterol, ergosterol, campesterol, stigmasterol, and rapeseed sterol.
[0079] In some embodiments, the PEG lipid comprises one or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol; the PEG-modified diacylglycerol is, for example, PEG-DMG-2000.
[0080] In some embodiments, the lipid nanoparticles contain lipids, DSPC, cholesterol, and PEG-DMG.
[0081] In some embodiments, the lipid nanoparticles comprise 47 mol% ALC-0315 lipids with 10 mol% DSPC, 41.5 mol% cholesterol, and 1.5 mol% PEG-DMG.
[0082] In some embodiments, the lipid nanoparticles are mRNA-LNPs.
[0083] In some embodiments, the mRNA-LNP is prepared by the following steps:
[0084] 1) Mix 47 mol% ALC-0315 lipids with 10 mol% DSPC, 41.5 mol% cholesterol and 1.5 mol% PEG-DMG and dissolve in ethanol solution;
[0085] 2) Dissolve the mRNA in citrate or acetate buffer at pH 4.0 as the aqueous phase. When mixing in a microfluidic device, maintain the aqueous phase to alcohol phase ratio at 3:1.
[0086] 3) After preparation by rapid mixing, the ethanol content in mRNA-LNP is reduced and dispersed into the target buffer using an ultrafiltration tube (100kDa) or tangential flow filtration (TFF) device.
[0087] In some embodiments, the molar ratio of ionizable lipid molecules to bases in the mRNA solution is defined as the N / P ratio. In some embodiments, the N / P ratio is 6:1.
[0088] In some implementations, the mRNA used is the mRNA encoding RABV-G in which each uridine is replaced with N1-methylpseudouridine.
[0089] Another aspect of the present invention provides a pharmaceutical composition comprising one or more of the following: the 5'UTR, the biological element, the transformant, the optimized mRNA, or the lipid nanoparticles, as provided in the present invention, and optionally an excipient or pharmaceutical carrier.
[0090] In another aspect, the present invention provides a kit comprising one or more of the 5'UTR, the biological element, the transformant, the optimized mRNA, the lipid nanoparticles, and the pharmaceutical composition provided by the present invention.
[0091] In some embodiments, the kit further comprises one or more of lipids, polymer delivery systems, inorganic nanoparticles, exosomes, viral vectors, and peptides.
[0092] Adding additional lipids to lipid nanoparticles can enhance their stability, encapsulation efficiency, regulate particle size, enhance affinity with target cells, control drug release, improve in vivo distribution, reduce toxicity, and increase functionality, thereby improving the efficiency and safety of drug delivery and gene therapy.
[0093] The lipid is one or more of the following: cationic lipids, ionizable lipids, auxiliary lipids, cholesterol and its derivatives, lipid polymer complexes, and PEG lipids and their derivatives.
[0094] Another aspect of the present invention provides the application of the 5'UTR, the biological element, the transformant, the optimized mRNA, or the lipid nanoparticles provided by the present invention in the preparation of mRNA drugs.
[0095] Another aspect of the present invention provides the use of optimized mRNA, drug-loaded lipid nanoparticles, or pharmaceutical compositions as defined above in the treatment and / or prevention of diseases, particularly useful in mRNA-based therapies.
[0096] The term "treatment" is used herein to generally mean achieving the desired pharmacological and / or physiological effects. Therefore, the treatment of the present invention can relate to the treatment of an (acute) state of a disease, but can also relate to preventive treatment in relation to the complete or partial prevention of the disease or its symptoms. Preferably, "treatment" should be understood as therapeutic in terms of partially or completely curing the disease and / or attributing adverse effects and / or symptoms to the disease. In this respect, "acute" means that the person being treated or vaccinated exhibits symptoms of the disease. In other words, the person to be treated or vaccinated actually requires treatment, and in the context of the present invention, the term "acute treatment" refers to measures taken to actually treat the disease after the onset or outbreak of the disease. Treatment can also be prophylactic or preventive treatment, i.e., measures taken to prevent the disease, such as to prevent infection and / or the onset of the disease.
[0097] The pharmaceutical compositions of the present invention can be administered in a variety of forms of administration known to those skilled in the art. Administration can be systemic, topical, oral, or via aerosol, including but not limited to tablets, injection needles, inhalers, creams, foams, gels, lotions, and ointments.
[0098] As described above, the present invention relates to a pharmaceutical composition comprising an effective amount of the mRNA molecule (or nucleic acid molecule, carrier or host cell) according to the present invention and at least one pharmaceutically acceptable excipient or carrier.
[0099] Excipients or carriers are inactive substances formulated together with the active ingredient (i.e., the constructs of the invention according to the above description) to enhance the formulation containing the effective active ingredient. Excipients are commonly referred to as “fillers,” “diluents,” or “enrichment agents.” Enrichment allows for convenient and accurate dispensing of the drug when manufacturing dosage forms. They can also be used for various therapeutic enhancement purposes, such as promoting drug absorption or solubility, or other pharmacokinetic considerations. Excipients are also useful in the manufacturing process, in addition to contributing to in vitro stability, such as preventing denaturation within the expected shelf life, and facilitating the handling of the active ingredient involved by promoting powder flowability or non-stickiness. The selection of appropriate excipients also depends on the route of administration and dosage form, as well as the active ingredient and other factors.
[0100] Therefore, consistent with the above, pharmaceutical compositions containing an effective amount of the nucleic acids of the present invention can be in solid, liquid, or gaseous form, particularly in the form of (one or more) powders, (one or more) tablets, (one or more) solutions, or (one or more) aerosols. Preferably, the pharmaceutical composition optionally contains a pharmaceutically acceptable carrier and / or diluent.
[0101] Examples of pharmaceutical carriers, excipients, and / or diluents are well known in the art and include phosphate-buffered saline solutions, water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, etc. Compositions containing such carriers can be formulated using well-known conventional methods. These pharmaceutical compositions can be administered to the treated or vaccinated subject at a suitable dose, i.e., an “effective amount” that can be readily determined by those skilled in the art using methods known in the art. The dosing regimen will be determined by the attending physician and clinical factors. As is well known in the medical field, the dose for any given patient depends on many factors, including the size, body surface area, age, specific compound to be administered, sex, time and route of administration, general health, and other medications administered concurrently.
[0102] According to the present invention, the term "pharmaceutical composition" refers to a composition for administration to a patient, preferably a human patient.
[0103] The pharmaceutical compositions of the present invention can be used for mRNA-based treatment. As described above, the mRNA molecules of the present invention comprising a "coding region encoding a polypeptide" can be used for mRNA-based treatment, wherein the "coding region encoding a polypeptide" encodes a therapeutically or pharmaceutically active polypeptide or protein having therapeutic or preventative effects.
[0104] The mRNA-based therapy according to the present invention can be applied to two main categories: 1. Prevention of infectious diseases: for the prevention of infections including but not limited to pre- and post-exposure prophylaxis of rabies, dengue virus infection, tuberculosis infection, influenza virus infection, herpes simplex virus infection, herpes zoster virus infection, HIV infection, malaria, hepatitis B virus infection, hepatitis C virus infection, measles virus infection, etc.; 2. Treatment of diseases: including but not limited to cancer, cardiovascular diseases, viral infections, immune dysfunction, autoimmune diseases, neurological disorders, inherited metabolic diseases or genetic diseases, or any disease in which proteins or protein fragments produced in cells may have beneficial effects on the patient. Treatment of tumors and cancers includes any type of malignant tumor, precancerous lesion, and benign tumor that occurs in any organ or cell of the human body, such as: head and neck cancer, breast cancer, kidney cancer, bladder cancer, lung cancer, prostate cancer, bone cancer, brain cancer, cervical cancer, rectal cancer, colon cancer, colorectal cancer, appendix cancer, eye cancer, stomach cancer, leukemia, lymphoma, liver cancer, skin cancer, ovarian cancer, penile cancer, pancreatic cancer, testicular cancer, thyroid cancer, vaginal cancer, vulvar cancer, endometrial cancer, gastric cardia cancer, and sarcoma, etc.
[0105] Examples of cardiovascular diseases include, but are not limited to, atherosclerosis, coronary heart disease, pulmonary heart disease, and cardiomyopathy.
[0106] Examples of immune dysfunction and autoimmune diseases include, but are not limited to, rheumatic diseases, multiple sclerosis, and asthma.
[0107] Examples of viral infections include, but are not limited to, infections with human immunodeficiency virus, herpes simplex virus, human papillomavirus, and hepatitis B and C viruses.
[0108] Examples of neurological disorders include, but are not limited to, Parkinson's disease, multiple sclerosis, and dementia.
[0109] Examples of inherited metabolic disorders include, but are not limited to, Gaucher disease and phenylketonuria.
[0110] This invention also relates to methods of mRNA-based therapy. Therefore, this invention relates to treatment methods for diseases such as cancer, cardiovascular disease, viral infection, immune dysfunction, autoimmune disease, neurological disorder, inherited metabolic disease, or genetic disease treated via RNA-based therapy.
[0111] In this invention, in a preferred embodiment, the recipient of treatment or vaccination is a mammal, such as a dog, cat, pig, cow, sheep, horse, rodent such as rat, mouse and guinea pig, or primate such as gorilla, chimpanzee and human. In the most preferred embodiment, the recipient of treatment or vaccination is a human.
[0112] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.
[0113] The reagents and raw materials used in this invention are all commercially available.
[0114] The positive and progressive effects of this invention are as follows: using the 5'UTR of this invention can effectively regulate the expression of mRNA, and compared with the control UTR combination, it makes the mRNA more stable and the expression more persistent, and can regulate the target mRNA to produce sufficient immunogenicity and humoral protection. Attached Figure Description
[0115] Figure 1 To detect the expression of the target protein RABV-G in cell lysates using Western blotting, three designed 5' UTRs and one 3' UTR were paired with BioNTech 3' UTRs and 5' UTRs, respectively, to form a backbone. The RABV-G gene sequence was inserted into the backbone as an ORF sequence. After IVT, mRNA was obtained and transfected into A549 cells. After 24 hours, the expression of the target protein RABV-G in the cell lysates was detected using Western blotting. β-actin was used as an internal control. Untransfected A549 cells served as a control.
[0116] Figure 2 The BCA protein assay kit was used to detect the total protein content in samples. The total protein content in each sample was determined using the BCA protein assay kit, and the expression level of the target protein was calculated.
[0117] Figure 3 To detect the expression of the target protein RABV-G in cell lysates using Western blotting, four designed 5' UTRs and one 3' UTR were paired to form a backbone. The RABV-G gene sequence was inserted into the backbone as an ORF sequence. After IVT, mRNA was obtained and transfected into A549 cells. Western blotting was used to detect the expression of RABV-G in cell lysates after 24, 48, and 72 hours. β-actin was used as an internal control. Untransfected A549 cells served as a control.
[0118] Figure 4 The total protein content in the samples was determined using the BCA protein assay kit. The total protein content in each sample was determined using the BCA protein assay kit, and the grayscale value of the target protein was detected using Western blotting to calculate the expression level of the target protein at 24, 48, and 72 hours.
[0119] Figure 5To detect RABV-G specific binding antibody levels at D5, D7, and D28 using ELISA, the level of CVS-11 neutralizing antibody in D7 serum was detected using a pseudovirus neutralization titration method. Different 5'UTRs and 3'UTRs were combined and paired to construct a backbone, which was then inserted with the target gene RABV-G sequence. After obtaining mRNA via IVT, it was encapsulated in an LNP formulation. At days 0, 7, and 28, BALB / c female mice (n=4 / group) were administered the drug intramuscularly (5 μg / mRNA per mouse). Serum samples were obtained at D5, D7, and D28. The levels of RABV-G specific binding antibodies at D5, D7, and D28 were detected using ELISA, and the level of CVS-11 neutralizing antibody in D7 serum was detected using a pseudovirus neutralization titration method (EC50). (1.52X: indicates that the antibody titer of the sample is 1.52 times the baseline value; *p<0.05; ns: not significant) Detailed Implementation
[0120] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.
[0121] Experimental materials:
[0122] Different UTR sequences:
[0123] 5'UTR:
[0124] >seq_batch16#86
[0125] GAUCAUAAAACUCUCGACGACCCGAAUAUCCGGAGUCUCGGAAGACAAACUCAAGCCACC(SEQ IDNO:1)
[0126] GATCATAAAACTCTCGACGACCCGAATATCCGGAGTCTCGGAAGACAAACTCAAGCCACC(SEQ IDNO:2)
[0127] >seq_batch17#12
[0128] GAACUACAAAGCCAGCAUACCCAACGCCAUUUGAGGUUGUUAGCAGAAAGAGAGGCCACC(SEQ IDNO:3)
[0129] GAACTACAAAGCCAGCATACCCAACGCCATTTGAGGTTGTTAGCAGAAAGAGAGGCCACC(SEQ IDNO:4)
[0130] >seq_batch43#6
[0131] GAACUAAAAAGCAAGCGCAACAGCACAUACGUUCGUUCGCUAGCAAAACUCACCGCCACC(SEQ IDNO:5)
[0132] GAACTAAAAAGCAAGCGCAACAGCACATACGTTCGTTCGCTAGCAAAACTCACCGCCACC(SEQ IDNO:6)
[0133] new_3'UTR:
[0134] CUGCCACUAGGCAGCUAGCCCACCUCCCCAGCCACCCUCCUCCACAGGUCCAGGUGCCGCUCCCUCCCCCACCACACAUCAGUGUCUCCUCCCUCCUGCUUUGCUGCCUUCCCUUUGCACCAGCCCGAGUCUAGGUCUGGGCCAAGCACACUGUGGCCACAGCUCUGGAGUGGGAGGGUUGGUUGCCCCUCACCUCAGAGCUCCCCCAAAGGCCAGUAAUGGAUCCCCGGCCUCAGUCCCUACUCUGCUUUGGGAUAGUGUGAGCUUCAUUUUGUACACGUGUGACUUCGUCCAGUUACA(SEQ ID NO:7)
[0135] CTGCCACTAGGCAGCTAGCCCACCTCCCCAGCCACCCTCCTCCACAGGTCCAGGTGCCGCTCCCTCCCCCACCACACATCAGTGTCTCCTCCCTCCTGCTTTGCTGCCTTCCCTTTGCACCAGCCCGAGTCTAGGTCTGGGCCAAGCACACTGTGGCCACAGCTCTGGAGTGGGAGGGTTGGTTGCCCCTCACCTCAGAGCTCCCCCAAAGGCCAGTAATGGATCCCCGGCCTCAGTCCCTACTCTGCTTTGGGATAGTGTGAGCTTCATTTTGTACACGTGTGACTTCGTCCAGTTACA(SEQ ID NO:8)
[0136] mRNA of the target gene (W1-5)
[0137] RABV-G
[0138]
[0139] Different cell culture reagents and consumables are shown in Table 1:
[0140] Table 1
[0141]
[0142]
[0143] Laboratory animals:
[0144] BALB / c mice: Zhuhai Baishitong Biotechnology Co., Ltd., 7-8 weeks old.
[0145] The immunoassay reagents are shown in Table 2:
[0146] Table 2
[0147]
[0148]
[0149] Delivery system
[0150] 47 mol% ALC-0315 lipids were mixed with 10 mol% DSPC, 41.5 mol% cholesterol, and 1.5 mol% PEG-DMG and dissolved in ethanol. ALC-0315, DSPC, cholesterol, and PEG-DMG-2000 were all purchased from Xiamen Sinobond Biotechnology Co., Ltd. The mRNA was dissolved in citrate or acetate buffer at pH 4.0 as the aqueous phase. The mRNA used was the mRNA encoding RABV-G, in which each uridine was replaced with N1-methylpseudouridine. The molar ratio of ionizable lipid molecules to bases in the mRNA solution was defined as the N / P ratio. In this example, the N / P ratio was 6:1. During microfluidic mixing, the ratio of the aqueous phase to the ethanol phase was controlled at 3:1. After preparation by rapid mixing, the ethanol content in the mRNA-LNP was reduced and dispersed into the target buffer using an ultrafiltration tube (100 kDa) or tangential flow filtration (TFF) device. The LNP was aseptically filtered using a 0.22 μM filter and stored at 4°C for further use.
[0151] Vector: The pUC-Kan-TMA vector was provided by Suzhou Genewiz Biotechnology Co., Ltd. The T7 promoter sequence, 5'UTR sequence, cloning site sequence (including the BbsI site), and 3'UTR sequence were added to the original vector to obtain a plasmid backbone with paired 5'UTR and 3'UTR sequences. Suitable primers were designed to perform homologous recombination between the amplified product of the target antigen gene and the enzyme-digested plasmid backbone. The resulting cells were transformed into competent cells, plate-cultured, and single colonies were picked and sequenced to obtain correctly sequenced clones: lp-UTR-W1-5-1, lp-UTR-W1-5-2, lp-UTR-W1-5-5, and batch16#86-1-W1-5, batch17#12-1-W1-5, batch43#6-1-W1-5, and bnt-5UTR-lp3UTR-1-W1-5.
[0152] Example 1: Construction of the UTR-mRNA binding complex
[0153] 1.1 Design and synthesize different UTR sequences and clone them into expression vectors.
[0154] 1.1.1 5' UTR sequence and 3' UTR sequence
[0155] 1.1.1.1 Design the following 5' UTR sequence:
[0156] The sequences are batch16#86 (SEQ ID NO:1 and 2), batch17#12 (SEQ ID NO:3 and 4), batch43#6 (SEQ ID NO:5 and 6), and the new_3'UTR sequence (SEQ ID NO:7 and 8).
[0157] 1.1.1.2 BioNTech 5'UTR and BioNTech 3'UTR sequences:
[0158] BioNTech 5'UTR (BNT 5'UTR)
[0159] GGGCGAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC(SEQ ID NO:9)
[0160] BioNTech 3'UTR sequence (BNT 3'UTR)
[0161] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCA GCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCGAGACCUGGUCCAGAGUCGCUAGCCGCGUCGCU(SEQ ID NO:10)
[0162] 1.1.1.3 Comparison with UTR sequences
[0163] Compare with 5'UTR sequence
[0164] GGCUAGCAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC(SEQID NO:11)
[0165] Compare with 3'UTR sequence
[0166] GCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCACGUCUCUUAACUAACUAAGGAUCCCGUCUCUUAACUAACUAAACUAGU (SEQ ID NO: 12)
[0167] 1.1.2 Constructing a plasmid backbone containing the designed pairing of the 5' UTR with the 3' UTR sequences described above.
[0168] 1.1.2.1 Three designed 5' UTR sequences (preceded by the T7 promoter sequence TAATACGACTCACTATAAG (SEQ ID NO:13) and followed by the cloning site sequence ATGATGTCTTCTTGAAGACGATAATAG (SEQ ID NO:14) containing two BbsI sites) and one designed 3' UTR sequence (preceded by the XhoI-containing sequence TAATAGCTCGAG (SEQ ID NO:15) and followed by polyA) were sent to Suzhou Genewise Biotechnology Co., Ltd. for synthesis. The three designed 5' UTR sequences (preceded by the T7 promoter sequence) were paired with the one designed 3' UTR sequence (followed by polyA) respectively, and subcloned and assembled into Genewise's vector pUC-Kan-TMA.
[0169] The polyA sequence is as follows:
[0170] AAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 16)
[0171] The sequence of the pUC-Kan-TMA vector is shown below:
[0172]
[0173] The component information of the 1.1.2.2pUC-Kan-TMA carrier is as follows:
[0174] Table 3
[0175]
[0176]
[0177] 1.1.3 Constructing a plasmid backbone containing the BioNTech 5'UTR and the 3'UTR sequence design described above, as well as the 5'UTR sequence design described above and the BioNTech 3'UTR.
[0178] 1.1.3.1 One BioNTech 5'UTR sequence (preceded by the T7 promoter sequence TAATACGACTCACTATAAG (SEQ ID NO:13) and followed by the cloning site sequence ATGATGTCTTCTTGAAGACGATAATAG (SEQ ID NO:14) containing two BbsI sites) and one BioNTech 3'UTR sequence (preceded by the XhoI-containing sequence TAATAGCTCGAG (SEQ ID NO:15) and followed by polyA) were sent to Suzhou Genewise Biotechnology Co., Ltd. for synthesis. The three designed 5'UTR sequences (preceded by the T7 promoter sequence) were combined with one BioNTech 3'UTR sequence (followed by polyA), and one BioNTech 5'UTR sequence was subcloned and assembled with one designed 3'UTR sequence into Genewise's vector pUC-Kan-TMA.
[0179] The polyA sequence and pUC-Kan-TMA vector are the same as in 1.1.2.1.
[0180] The component information for the pUC-Kan-TMA carrier is the same as in 1.1.2.2.
[0181] 1.2 Different UTR-mRNA conjugates were constructed by combining the target gene mRNA with different UTR sequences using molecular cloning technology.
[0182]
[0183] *(SEQ ID NO:21)
[0184] The CDS sequence of W1-5 was sent to Genscript Biotech for synthesis.
[0185] 1.2.2 Primer Design:
[0186] Table 4
[0187]
[0188] The aforementioned primers were sent to Suzhou Genewiz Biotechnology Co., Ltd. for synthesis.
[0189] 1.2.3 Gene amplification and product purification
[0190] Using NEB's Phusion gene amplification enzyme, the synthesized W1-5 was amplified according to the following program (pre-denaturation 98℃, 30s; denaturation 98℃, 10s; annealing 65℃, 30s; extension 72℃, 60s, 34 cycles; final extension 72℃, 10min; storage temperature 10℃, ∞) using W1-5 as a template. The amplification was performed using W1-5-Fs-c1 / lp-3'UTR-W1-5-R-sc, W1-5-Fs-c2 / lp-3'UTR-W1-5-R-sc, and W1-5-Fs-c5 / lp-3'UTR-W1-5-R, respectively. The target fragments (1632bp, 1626bp, 1628bp, 1640bp, 1634bp, 1636bp, and 1619bp, respectively) were amplified on a gene amplification instrument using the following gene amplification methods: -sc, W1-5-Fs-c1 / b-3'UTR-W1-5-R-sc, W1-5-Fs-c2 / b-3'UTR-W1-5-R-sc, W1-5-Fs-c5 / b-3'UTR-W1-5-R-sc, and b-5'UTR-W1-5-F-sc / lp-3'UTR-W1-5-R-sc. After gel purification, the amplified gene fragments were measured for concentration and stored at -20℃ for later use.
[0191] 1.2.4 Vector linearization and purification
[0192] The three vectors constructed in step 1.1.2 and the four vectors constructed in step 1.1.3 were linearized by NEB Bbs I-HF restriction enzyme digestion and then directly purified into DNA.
[0193] 1.2.5 Homologous recombination ligation of gene amplification products and restriction enzyme vector
[0194] The gene amplification and purification product obtained in step 1.2.3 and the linearized purification vector obtained in step 1.2.4 were subjected to homologous recombination using Novizan 2×ClonExpress Mix. The recombination product was stored at -20℃ for later use.
[0195] 1.2.6 Transformation of Recombinant Products
[0196] Using Trans1-Blue competent cells of Trans1 Gold, the recombinant product obtained in step 1.2.5 was transformed into competent cells according to the following steps: (1) Take 50 μL of competent cells thawed on ice, add the recombinant product, mix gently, and place in ice for 30 minutes; (2) Heat shock in a 42℃ water bath for 90 seconds, and then quickly transfer the tube to an ice bath for 5 minutes; (3) Add 500 μL of sterile SOC medium (antibiotic-free) to each centrifuge tube, mix well, and incubate at 37℃ and 200 rpm for 1 hour for recovery; (4) Spread the cells evenly on LB agar medium containing the corresponding antibiotic, invert the plate, and incubate overnight at 37℃.
[0197] 1.2.7 Transformation plate single-clone colony sequencing
[0198] Twelve single colonies were picked from each plate containing single colonies obtained in step 1.2.6 and placed into 1.5 mL EP tubes containing 500 μL LLB (cannabinoid resistance). The plates were incubated at 37°C and 230 rpm for 6–8 h. 200 μL of bacterial culture was taken from each EP tube and sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing.
[0199] 1.3 Verify the correctness of the constructed UTR-mRNA binding complex
[0200] Bioinformatics software was used to splice, edit, and align the Genewiz sequencing data to obtain the correctly sequenced clones lp-UTR-W1-5-1(16#86+new_3'UTR), lp-UTR-W1-5-2(17#12+new_3'UTR), lp-UTR-W1-5-5(43#6+new_3'UTR), and batch16#86-1-W1-5(16#86+BNT 3'), batch17#12-1-W1-5(17#12+BNT 3'), batch43#6-1-W1-5(43#6+BNT 3'), and bnt-5UTR-lp3UTR-1-W1-5(BNT 5'+new_3'UTR).
[0201] Example 2: Cell-level expression verification
[0202] 2.1 The constructed UTR-mRNA conjugates containing different combinations of UTR elements and the target gene were transfected into cell lines.
[0203] A549 cells were seeded in 12-well plates (10 m²). 5 / well), incubated overnight in a CO2 incubator, and the mRNA containing UTR element combinations was processed using Lipofectamine. TM MessengerMAX TM Transfection reagent was applied to each well (1 μg / well), with untransfected wells serving as blank controls. Cells were washed twice with pre-chilled PBS (1 mL / well) at 24, 48, and 72 hours. The culture plate was then placed on ice. Cells were then washed with Pierce PBS. TM Lyse the protease inhibitors with RIPA lysis buffer (Pulley) (100 μL / well), lyse thoroughly for 30 min, collect the cell lysate, centrifuge at 13,000 rpm at 4 °C for 10 min, and collect the supernatant.
[0204] 2.2 The in vitro expression level of UTR-mRNA conjugates containing different combinations of UTR elements and the target gene was detected by Western blotting.
[0205] Cell lysis buffer (15 μL) from each sample was mixed with an equal volume of Novex. TM Mix Tris-glycine SDS sample buffer (2×), add to the wells of an 8% PAGE-SDS electrophoresis gel, place in Tris-glycine-SDS electrophoresis buffer, run at 80V (30 min) followed by 120V (60 min), remove the electrophoresis gel, sandwich it with a PVDF membrane using the sandwich method, and transfer the membrane in an ice-water bath at a constant current of 300mA for 90 min. Remove the PVDF membrane, immerse it in 5% skim milk powder-TBST solution for 1 hour, then immerse it in 1:1000 diluted anti-RABV-G antibody overnight at 4°C, wash the membrane three times with TBS T, immerse it in 1:2000 diluted HRP-conjugated anti-mouse IgG antibody at room temperature for 1 hour, wash the membrane three times with TBST, develop the color using SuperSignal West Atto ultrasensitive substrate, and photograph with a Tanon 5200 fluorescence microscope. Simultaneously, the expression of the internal control β-actin gene was detected using the same method, and the results are as follows. Figure 1 and Figure 3 As shown in the figure. When comparing and analyzing the expression levels of the target gene, ImageJ was used to measure and statistically analyze the grayscale value of the target gene band. Simultaneously, the total protein content of the samples was detected using the Beyotime BCA protein concentration assay kit. Finally, the target gene expression level in each transfected sample was calculated as: target gene band grayscale value / total sample protein content. This value was then input into Graphpad for plotting and analysis, and the results are shown in the figure. Figure 2 and Figure 4 As shown. Figure 1 and Figure 2 The results showed that the combinations of 5'UTR 16#86, 17#12, 43#6 with BNT 3'UTR, as well as the combination of 3'UTR new_3UTR with BNT 5'UTR, could regulate RABV-G ORF to achieve higher in vitro expression levels than the control 3'UTR and control 5'UTR combination, indicating that 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR can all independently regulate mRNA translation. Figure 3 and Figure 4The results showed that the combination of 5'UTR 16#86, 17#12, 43#6 with 3'UTR new_3UTR could regulate RABV-G ORF to achieve higher and more persistent in vitro expression levels, which could last up to 72 hours after transfection. The in vitro expression level at 72 hours exceeded that of the control UTR combination, indicating that the combination of 5'UTR 16#86, 17#12, 43#6 with 3'UTR new_3UTR can effectively regulate mRNA expression and make the mRNA more stable and persistent compared to the control UTR combination.
[0206] Example 3 Animal-level expression verification
[0207] 3.1 Selecting mice as animal models
[0208] Since the RABV-G antigen exhibits good immunogenicity in BALB / c mice, female BALB / c mice aged 7-8 weeks were used for mRNA immunogenicity assessment and comparison.
[0209] 3.2 RABV-G mRNA conjugates containing different UTRs with good expression effects (a control group) were encapsulated in cationic liposomes (LNP formulation) and administered to mice via intramuscular injection on days 0, 7, and 28, with each mouse receiving 5 μg of mRNA.
[0210] 3.3 At different time points after immunization (day 5, day 7, day 28, and day 56), peripheral blood of animals was collected using the retro-orbital vascular plexus sampling method and placed into a coagulation tube. The tube was left to stand at room temperature for 15 minutes, then centrifuged at 5000Xg at 4℃ for 15 minutes, and the supernatant serum was collected.
[0211] 3.4 Specific antibodies and neutralizing antibody levels in serum were detected by ELISA and pseudovirus neutralizing antibody assay.
[0212] Recombinant protein RABV-G glycoprotein (0.5 μg / mL) was used as the antigen to coat the ELISA plate. The plate was incubated overnight at 4°C. After washing four times, the plate was blocked at 37°C for 1 hour. Serially diluted (3-fold) serum solutions were added to the wells, with each serum sample replicated. The plate was incubated at 37°C for 1 hour, washed four times, and then HRP-anti-mouse IgG antibody diluted 1:2000 was added. After incubation at 37°C for 1 hour, the plate was washed four times. The plate was then developed with TMB reagent for 15 minutes, and the OD values were read using a BioTek ELISA reader. 630 After terminating the reaction with ELISA stop solution, the OD value was read in a BioTek microplate reader. 450Values. Graphpad was used to analyze the data to determine the antibody endpoint titer. In the neutralizing antibody detection, mouse serum was inactivated in a 37°C water bath for 30 minutes, then diluted 50-fold with DMEM culture medium, followed by 3-fold serial dilutions, for a total of 8 dilutions. HIV pseudovirus expressing the rabies CVS-11 strain RABV-G protein was used (according to Nie, J., Wu, X., Ma, J. et al. Development of in vitro and in vivo rabiesvirus neutralization assays based on a high-titer pseudovirus system. Sci Prepared using the method disclosed in Rep7,42769 (2017).https: / / doi.org / 10.1038 / srep42769) (TCID50 / sample) and diluted serum were mixed and incubated at 37°C for 1 hour. Serum-free and virus-free controls were used as experimental controls. The incubated serum-virus mixture and controls were added to 293T cells that had just been digested with trypsin and seeded into 96-well plates (40,000 cells / well), with each sample used in triplicate. Incubation was performed at 37°C for 48 hours. Part of the culture medium was discarded, leaving 100 μl. 100 μl of Bright-Glo luciferase reagent was added to each well, and the cells were incubated at room temperature for 2 minutes for lysis. 150 μl of the lysis buffer was transferred to a black-background 96-well plate, and fluorescence intensity was detected using a microplate reader. Graphpad nonlinear regression was used to fit the curve for each sample, and the titer corresponding to 50% neutralization was calculated and defined as EC50. Results are as follows: Figure 5As shown in the results, the combination of 5'UTR 16#86, 17#12, 43#6 with 3'UTR new_3UTR effectively regulated the expression of RABV-G mRNA, thereby ensuring sufficient immunogenicity. Specifically, on days 5, 7, and 28 after the first immunization, the RABV-G mRNA regulated by the combination of 5'UTR 16#86, 17#12, 43#6 with 3'UTR new_3UTR effectively activated the production of binding antibody IgG in serum. The serum binding antibody IgG levels produced by the same target mRNA regulated by the control UTR were similar to or higher than those produced by the control UTR, and the humoral immune IgG levels could be maintained for at least 28 days after the first immunization. Therefore, the combination of 5'UTR 16#86, 17#12, 43#6 with 3'UTR new_3UTR can regulate the target mRNA to produce sufficient immunogenicity. Simultaneously, the use of pseudoviruses to detect serum neutralizing antibody levels yielded results similar to those of binding antibody IgG levels, showing similar or higher levels of neutralizing antibody IgG in serum compared to that produced by the same target mRNA regulated by the control UTR. In summary, this indicates that the combination of 5'UTR 16#86, 17#12, 43#6 with 3'UTR new_3UTR can regulate the target mRNA to produce sufficient immunogenicity and humoral protection.
Claims
1. A 5' UTR, characterized in that, The nucleotide sequence of the 5' UTR is selected from any one of the nucleotide sequences shown in SEQ ID NO: 1-6.
2. A biological element, characterized in that, The bio-element comprises the 5' UTR as described in claim 1; the bio-element is any one of the following: a) mRNA transcription template construct; b) Carrier; and, c) Reporter gene system.
3. The bio-element as described in claim 2, characterized in that, The vector is a nucleic acid biological preparation plasmid template.
4. The bio-element as described in claim 2, characterized in that, The mRNA transcription template construct also includes one or more of the following: promoter elements, coding regions, 3' UTR, and polyA tail elements; Alternatively, the reporter gene system may further include one or more of an expression vector, a reporter gene, and a regulatory element.
5. The bio-element as described in claim 2, characterized in that, The vector is an expression vector or a cloning vector.
6. The bio-element as described in claim 2, characterized in that, The vector is a virus or a plasmid.
7. The bio-element as described in claim 4, characterized in that, The promoter is an SV40 promoter, a CMV promoter, or a GRE promoter; and / or, the reporter gene is a green fluorescent protein, luciferase, β-galactosidase, alkaline phosphatase, or anthocyaninase; and / or, the regulatory element is an enhancer or a silencer.
8. The bio-element as described in claim 3, characterized in that, The nucleic acid biopharmaceutical plasmid template includes one or more of a promoter, coding region, 3' UTR, and terminator.
9. A transformant, characterized in that, The transformant is a host cell containing the 5' UTR as described in claim 1 or the biological element as described in any one of claims 2-8.
10. The transformant as described in claim 9, characterized in that, The host cell is a prokaryotic cell or a eukaryotic cell.
11. The transformant as described in claim 10, characterized in that, The host cell is selected from yeast cells or mammalian cells.
12. The transformant as described in claim 11, characterized in that, The mammalian cells in question are HEK293 cells.
13. A method for optimizing mRNA, characterized in that, The method includes the following steps: (i) Cultivate the transformant as described in any one of claims 9-10 to obtain a culture containing a vector construct of mRNA transcription template; (ii) Isolate and / or recover the vector described in (i) from the culture and linearize it with enzymes to form an mRNA transcription template; (iii) Transcribe the mRNA transcription template described in step (ii) to obtain optimized mRNA.
14. The method as described in claim 13, characterized in that, The method further includes the step of purifying and / or modifying the optimized mRNA obtained in step (iii).
15. An optimized mRNA, characterized in that, The optimized mRNA is prepared by the method as described in claim 13 or 14.
16. The optimized mRNA as described in claim 15, characterized in that, The optimized mRNA also includes one or more of 3' UTR and polyA tail elements.
17. The use of the 5' UTR as described in claim 1, the biological element as described in any one of claims 2-8, or the transformant as described in any one of claims 9-12 in optimizing mRNA.
18. A drug-loaded lipid nanoparticle, characterized in that, The lipid nanoparticles contain the optimized mRNA as described in claim 15 or 16.
19. The lipid nanoparticles as described in claim 18, characterized in that, The lipid nanoparticles also include one or more of cationic lipids, ionizable lipids, auxiliary lipids, cholesterol and its derivatives, and PEG lipids and their derivatives.
20. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises one or more of the following: the 5' UTR as claimed in claim 1, the biological element as claimed in any one of claims 2-8, the transformant as claimed in any one of claims 9-12, the optimized mRNA as claimed in claim 15 or 16, and the lipid nanoparticles as claimed in claim 18 or 19, and optionally an excipient or pharmaceutical carrier.
21. A reagent kit, characterized in that, The kit comprises one or more of the following: the 5' UTR as described in claim 1, the biological element as described in any one of claims 2-8, the transformant as described in any one of claims 9-12, the optimized mRNA as described in claim 15 or 16, the lipid nanoparticles as described in claim 18 or 19, and the pharmaceutical composition as described in claim 20.
22. The kit according to claim 21, characterized in that, The kit also contains one or more of lipids, polymer delivery systems, inorganic nanoparticles, exosomes, viral vectors, and peptides.
Citation Information
Patent Citations
Optimized 5UTR sequence and application thereof
CN117487809A
5-UTR sequence and application thereof
CN117821451A