SiRNA of targeted RIG-I receptor gene and application thereof

Abstract

The invention relates to the technical field of biological medicine, and particularly discloses siRNA of a targeted RIG-I receptor gene and application of the siRNA, the siRNA is selected from any one of siRNA-1 and siRNA-3, the siRNA-1 comprises a positive-sense strand with the nucleotide sequence shown as SEQ ID NO.1 and an antisense strand with the nucleotide sequence shown as SEQ ID NO.2, and the siRNA comprises a positive-sense strand with the nucleotide sequence shown as SEQ ID NO.1 and a negative-sense strand with the nucleotide sequence shown as SEQ ID NO.2. The siRNA-3 comprises a positive-sense strand of which the nucleotide sequence is as shown in SEQ ID NO.5 and an antisense strand of which the nucleotide sequence is as shown in SEQ ID NO.6. The invention further discloses a preparation method of the siRNA-3. The siRNA provided by the invention is used for inhibiting expression of RIG-I receptor genes so as to reduce inflammatory response in a dairy cow mammary epithelial cell inflammation model, so that the siRNA provided by the invention can be used for preparing the medicine for treating dairy cow mastitis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a siRNA targeting a RIG-I receptor gene and an application thereof. Background Art

[0002] Cow mastitis is a common disease in dairy cows, mainly due to pathogenic microorganisms invading the udder and causing infection, which leads to decreased milk production and reduced milk quality. In severe cases, it may lead to fibrosis and atrophy of mammary tissue, and even cause the cow to be eliminated.

[0003] The causes of mastitis in dairy cows mainly include self-factors, environmental and management factors, mechanical milking and pathogenic bacteria infection. Among them, self-factors are: dairy cows in the peak lactation period or with excessive milk production have a negative balance of body energy and reduced resistance; the incidence rate is higher in older cows and multi-parity cows. Environmental and management factors: poor feeding environment, milking conditions that do not meet the physiological requirements of lactation, and poor sanitary conditions will increase the risk of mastitis. Mechanical milking: irregular operation, such as improper milking techniques and improper use of milking machines, may also cause mastitis. Pathogenic bacteria infection: common pathogens include Staphylococcus aureus, Escherichia coli and Streptococcus, and mycoplasma and fungal infections are also on the rise. Mastitis can lead to a decrease in milk production, a decrease in milk protein and lactose content, and affect milk quality. If not treated in time, it may turn into chronic mastitis, leading to fibrosis and atrophy of mammary tissue. It is necessary to develop a product that reduces the inflammatory response of mastitis in dairy cows. Summary of the invention

[0004] In order to develop a product that reduces the inflammatory response of cow mastitis, the present invention provides a siRNA targeting the RIG-I receptor gene and its application. The siRNA provided by the present invention is used to inhibit the expression of the RIG-I receptor gene, thereby reducing the inflammatory response in the cow mammary epithelial cell inflammation model. Therefore, the siRNA provided by the present invention can be used to prepare a drug for treating cow mastitis.

[0005] The present invention provides a siRNA targeting the RIG-I receptor gene, wherein the siRNA is selected from any one of siRNA-1 and siRNA-3;

[0006] The siRNA-1 comprises a sense strand with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.2;

[0007] The siRNA-3 comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO.5 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO.6.

[0008] The siRNA provided by the present invention inhibits the expression of the RIG-I receptor gene by targeting the RIG-I receptor gene, thereby reducing the inflammatory response in the cow mammary epithelial cell inflammation model, thereby alleviating mammary inflammation.

[0009] The present invention also provides an application of a RIG-I receptor gene inhibitor in the preparation of a drug for treating bovine mastitis, wherein the RIG-I receptor gene inhibitor has the siRNA targeting the RIG-I receptor gene as the only effective ingredient.

[0010] The present invention also provides an application of the siRNA targeting the RIG-I receptor gene in preparing a drug for treating bovine mastitis.

[0011] Furthermore, the drug has siRNA targeting the RIG-I receptor gene as the only active ingredient.

[0012] Furthermore, the drug has the effect of inhibiting inflammation.

[0013] Furthermore, the inhibition of inflammation is manifested as: inhibiting the expression of inflammatory factors IL-1β, TNF-α, Il-6 and IL-8.

[0014] The present invention also provides an application of the siRNA targeting the RIG-I receptor gene in identifying the function of the RIG-I receptor gene.

[0015] Furthermore, siRNA is used to interfere with the expression of the RIG-I receptor gene, thereby identifying trait changes associated with the RIG-I receptor gene and determining the function of the RIG-I receptor gene.

[0016] The present invention also provides an application of siRNA targeting RIG-I receptor gene in preparing RIG-I receptor gene inhibitor, wherein the inhibitor has the siRNA-1 as the only effective ingredient.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The siRNA-1 and siRNA-3 provided by the present invention can significantly reduce the expression of the RIG-I receptor gene, and it is found that the interference efficiency of siRNA-1 on the RIG-I receptor gene is significantly higher than that of siRNA-3. The present invention utilizes siRNA-1 to interfere with the expression of the RIG-I receptor gene, thereby inhibiting the inflammatory response in the cow mammary epithelial cell inflammation model, and significantly reducing the expression of inflammatory factors IL-1β, TNF-α, Il-6 and IL-8. Therefore, the siRNA-1 provided by the present invention can be used to prepare a drug for treating cow mastitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 Effects of different concentrations of LPS on the survival rate of bovine mammary epithelial cells.

[0021] Figure 2 10 μg mL -1 Effects of LPS stimulation on the gene expression of IL-1β, IL-6, IL-8 and TNF-α in bovine mammary epithelial cells;

[0022] In the figure, A is 10 μg·mL -1 Effects of LPS stimulation on IL-1β gene expression in bovine mammary epithelial cells;

[0023] B is 10 μg·mL -1 Effects of LPS stimulation on IL-6 gene expression in bovine mammary epithelial cells;

[0024] C is 10 μg·mL -1 Effects of LPS stimulation on IL-8 gene expression in bovine mammary epithelial cells;

[0025] D is 10 μg·mL -1 Effect of LPS stimulation on TNF-α gene expression in bovine mammary epithelial cells.

[0026] Figure 3 10 μg mL -1 The effects of LPS on inflammatory signaling pathways MAPK and NF-κB in bovine mammary epithelial cells;

[0027] In the figure, A is the results of Western Blot detection of ERK protein phosphorylation levels in the CON group (blank control group) and the LPS stimulation group at 15min, 30min, 60min and 120min;

[0028] B is the statistical graph of P-ERK / ERK ratio in CON group (blank control group) and LPS stimulation group at 15min, 30min, 60min and 120min;

[0029] C is the results of Western Blot detection of P38 protein phosphorylation levels in CON group (blank control group) and LPS stimulation group at 15min, 30min, 60min and 120min;

[0030] D is the statistical graph of P-P38 / P38 ratios of CON group (blank control group) and LPS stimulation group at 15min, 30min, 60min and 120min;

[0031] E is the results of Western Blot detection of P65 protein phosphorylation levels in CON group (blank control group) and LPS stimulation group at 15min, 30min, 60min and 120min;

[0032] F is the statistical graph of the P-P65 / P65 ratio of the CON group (blank control group) and the LPS stimulation group at 15min, 30min, 60min and 120min.

[0033] Figure 4 This is a diagram showing the screening results of genes related to dairy cow mastitis;

[0034] In the figure, A is 10 μg·mL -1 Statistical diagram of changes in the expression of genes related to bovine mastitis after LPS stimulation of bovine mammary epithelial cells;

[0035] B is a volcano plot of changes in expression levels of genes related to mastitis in dairy cows.

[0036] Figure 5 is the transfection efficiency of siRNA into bovine mammary epithelial cells.

[0037] Figure 6 The effect of siRNA-1 interference of RIG-I receptor gene on inflammatory factors in the cow mammary epithelial cell inflammation model;

[0038] In the figure, A shows the effect of siRNA-1 interference of RIG-I receptor gene on the expression of IL-1β in the cow mammary epithelial cell inflammation model;

[0039] B is the effect of siRNA-1 interference of RIG-I receptor gene on the expression of IL-8 in the cow mammary epithelial cell inflammation model;

[0040] C is the effect of siRNA-1 interference of RIG-I receptor gene on IL-6 in the cow mammary epithelial cell inflammation model;

[0041] D shows the effect of siRNA-1 interference of RIG-I receptor gene on TNF-α in the cow mammary epithelial cell inflammation model. DETAILED DESCRIPTION

[0042] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0043] Example 1: Construction of cow mammary epithelial cell inflammation model.

[0044] For the specific experimental methods and operating steps involved in this example, please refer to the following article: Zhang K, Zhang M, Su H, et al. Regulation of Inflammatory Responses of Cow Mammary Epithelial Cells through MAPK Signaling Pathways of IL-17A Cytokines. Animals (Basel). 2024; 14(11): 1572. Published 2024 May 25. doi: 10.3390 / ani14111572.

[0045] 1. Evaluation of the potential cytotoxicity of LPS on bovine mammary epithelial cells

[0046] CCK-8 method was used to select different time points: 4h, 6h, 8h, 12h, 24h and different concentrations: 0μg·mL -1 , 1μg·mL -1 , 5μg·mL -1 , 10μg·mL -1 , 20μg·mL -1 , 50μg·mL -1 and 100 μg mL -1 To evaluate the potential cytotoxicity of LPS on bovine mammary epithelial cells.

[0047] The results are as follows Figure 1 As shown, after LPS treatment, 0 μg·mL -1 ~10 μg mL -1 The cell viability of bovine mammary epithelial cells did not change significantly at this concentration, indicating that LPS would not have potential cytotoxicity to bovine mammary epithelial cells within this time period and concentration. -1 The inflammation model was constructed with the concentration of

[0048] 2. Validation of the cow mammary epithelial cell inflammation model

[0049] To explore whether the inflammation model was successfully constructed, RT-qPCR was used to detect the effect of LPS on the gene expression of IL-1β, IL-6, IL-8, and TNF-α in bovine mammary epithelial cells within 24 hours.

[0050] The results are as follows Figure 2 As shown, the concentration was 10 μg mL at 4 h, 8 h, 12 h, and 24 h. -1 LPS can stimulate the secretion of IL-1β, IL-6, IL-8, and TNF-α in bovine mammary epithelial cells, and compared with the blank control group (CON), the secretion levels of IL-1β, IL-6, and IL-8 in the LPS stimulation group were the highest at 12h (P<0.001), and the secretion level of TNF-α was the highest at 24h (P<0.001). The bovine mammary epithelial cells without any treatment were the blank control group.

[0051] 3. Verify whether LPS can activate the inflammatory signaling pathways MAPK and NF-κB in bovine mammary epithelial cells.

[0052] Western Blot method was used to detect the effect of LPS on the phosphorylation levels of P38, ERK and P65 at 15min, 30min, 60min and 120min.

[0053] The results are as follows Figure 3 As shown in the figure, compared with the blank control group, the phosphorylation levels of P38, ERK, and P65 proteins in the LPS stimulation group at 15min, 30min, 60min, and 120min were significantly increased (P<0.001). The results showed that LPS can activate the MAPK and NF-κB inflammatory signaling pathways in bovine mammary epithelial cells, indicating that the inflammatory model of bovine glandular epithelial cells was successfully established.

[0054] Example 2: Screening of genes related to cow mastitis.

[0055] 1. Screening of differential gene expression by transcriptomics

[0056] The model was constructed according to the method in Example 1 using a concentration of 10 μg·mL -1 The inflammatory model of bovine glandular epithelial cells was constructed by stimulating bovine mammary epithelial cells with LPS for 12 hours, which was recorded as the LPS group, and the bovine mammary epithelial cells without any treatment were used as the control group. The number of genes that were differentially expressed upregulated (log2 FC>=1&p<0.05) and downregulated (log2 FC<=-1&p<0.05) in the control group and the LPS group was counted, and the differentially expressed genes (DEGs) were screened in the control group and the LPS group, and the overall distribution of the differentially expressed genes was represented by drawing differential gene bar graphs, volcano graphs and differential gene cluster heat maps.

[0057] The results are as follows Figure 4 As shown in the figure, compared with the control group, 906 genes were significantly upregulated and 549 genes were significantly downregulated in the LPS group. Among them, the RIG-I receptor gene (also known as DDX58) was upregulated most significantly. This result indicates that when LPS stimulates bovine mammary epithelial cells, the RIG-I receptor gene may be a potential differentially expressed gene that responds to the inflammation of bovine mammary epithelial cells.

[0058] The RIG-I receptor gene sequence is shown in SEQ ID NO.7.

[0059] SEQ ID NO.7:

[0060] GTAAGAGTCACATTTAC TTGTATTCTCTGTGTAGCAACATGTGGCATCTATTATTAAAATTCAGCAATGGACTTTT .

[0061] Example 3: Effect of silencing the RIG-I receptor gene on inflammation in a cow mammary epithelial cell inflammation model.

[0062] The model was constructed according to the method in Example 1 using a concentration of 10 μg·mL -1 The inflammatory model of bovine glandular epithelial cells was established by stimulating bovine mammary epithelial cells with LPS for 12 hours, which was recorded as the LPS group, and the bovine mammary epithelial cells without any treatment were used as the control group.

[0063] 1. Design of siRNA primers for RIG-I receptor gene

[0064] The siRNAs for the RIG-I receptor gene were designed and were named siRNA-1, siRNA-2, and siRNA-3. The specific primer information is shown in Table 1.

[0065] Table 1 siRNA primers for RIG-I receptor gene

[0066]

[0067] 2. Effect of siRNA of RIG-I receptor gene on the expression of RIG-I receptor gene

[0068] Detect the effect of siRNA of RIG-I receptor gene on the expression of RIG-I receptor gene in the inflammatory model of bovine glandular epithelial cells. The specific experimental steps are as follows:

[0069] Inoculate bovine mammary epithelial cells in a 6-well plate. When the cell confluence reaches 70% to 90%, replace the cell culture medium with Opti-MEM medium and use Lipofectamine 3000 (invitrogen) transfection reagent to transfect siRNA into the cells. After 48 hours, use q-PCR to detect the siRNA transfection efficiency. The specific process is: first dilute Lip 3000: add 5μL Lip 3000 to 125μL Opti-MEM medium; then dilute siRNA: add 2.5μg siRNA to 125μL Opti-MEM medium; mix the diluted Lip3000 with the diluted siRNA 1:1, incubate at room temperature for 15min, then add to the cells, incubate the cells at 37℃ for 8h, replace with DMEM / F12 complete medium containing 10% FBS, and continue transfection for 40h. Then use q-PCR to detect the siRNA transfection efficiency.

[0070] The results are as follows Figure 5As shown, after interfering with bovine mammary epithelial cells through siRNA, it was found that siRNA-2 had no effect, while siRNA-1 and siRNA-3 could significantly reduce the expression of RIG-I receptor gene, and the interference efficiency of siRNA-1 was significantly higher than that of siRNA-3.

[0071] 3. Effect of siRNA of RIG-I receptor gene on inflammatory cytokines in cow mammary epithelial cell inflammation model

[0072] In this experiment, small RNA interference technology was used to interfere with the RIG-I receptor gene with siRNA-1 for 48 hours, and then 10 μg mL -1 After 12 hours of LPS stimulation of bovine mammary epithelium, q-PCR was used to detect the effects of inflammatory cytokines IL-1β, TNF-α, Il-6 and chemokine IL-8 in cells. Specific detection primers are shown in Table 2, q-PCR reaction system is shown in Table 3, and q-PCR reaction procedure is shown in Table 4.

[0073] Table 2 Detection primer information of inflammation-related genes

[0074]

[0075] Table 3q-PCR reaction system

[0076]

[0077] Table 4 q-PCR reaction procedure:

[0078] Reaction temperature Reaction time Number of cycles 50℃ 2min 1 95℃ 10min 1 95℃ 15sec 40 60℃ 30sec 40

[0079] The results are as follows Figure 6 As shown in the figure, the RIG-I receptor gene was silenced before stimulating bovine mammary epithelial cells with LPS, and then LPS was added to act on bovine mammary epithelial cells. The results showed that when the RIG-I receptor gene was silenced, the gene expression of proinflammatory cytokines IL-1β, TNF-α, Il-6 and chemokine IL-8 was reduced.

[0080] This indicates that the siRNA-1 provided by the present invention can significantly reduce the expression of inflammatory cytokines in the cow mammary epithelial cell inflammation model, proving that it can be used to prepare a drug for treating cow mastitis.

[0081] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0082] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A siRNA targeting RIG-I receptor gene, characterized in that: The siRNA is selected from any one of siRNA-1 and siRNA-3; The siRNA-1 comprises a sense strand with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.2; The siRNA-3 comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO.5 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO.

6.

2. Use of a RIG-I receptor gene inhibitor in the preparation of a drug for treating bovine mastitis, characterized in that: The RIG-I receptor gene inhibitor has the siRNA targeting the RIG-I receptor gene as claimed in claim 1 as the only effective ingredient.

3. Use of the siRNA targeting the RIG-I receptor gene according to claim 1 in the preparation of a drug for treating bovine mastitis.

4. The use according to claim 3, characterized in that: The drug has siRNA targeting the RIG-I receptor gene as the only effective ingredient.

5. The use according to claim 4, characterized in that: The drug has the effect of inhibiting inflammation.

6. The use according to claim 5, characterized in that: The inhibition of inflammation is manifested in: inhibiting the expression of inflammatory factors IL-1β, TNF-α, IL-6 and IL-8.

7. Use of the siRNA targeting the RIG-I receptor gene according to claim 1 in identifying the function of the RIG-I receptor gene.

8. Use of the siRNA targeting the RIG-I receptor gene according to claim 7 in identifying the function of the RIG-I receptor gene, characterized in that: By interfering with the expression of RIG-I receptor gene by siRNA, the trait changes related to RIG-I receptor gene were identified.

9. Use of siRNA targeting RIG-I receptor gene in the preparation of RIG-I receptor gene inhibitor, characterized in that: The inhibitor contains the siRNA-1 in claim 1 as the only effective ingredient.

Images