Application of soybean GmBBX13b gene in delaying leaf and plant senescence

Abstract

The application discloses application of a soybean GmBBX13b gene in delaying leaf and plant senescence, wherein a nucleotide sequence of the soybean GmBBX13b gene is shown as SEQ ID NO. 1, and an amino acid sequence of a soybean GmBBX13b protein is shown as SEQ ID NO. 2. The application creates a transgenic soybean strain with overexpression of the GmBBX13b gene, and finds that, compared with a wild type, the GmBBX13b transgenic soybean is significantly delayed in flowering time, leaf and plant senescence time, and the number of branches is obviously increased, and the plant height and the number of stem nodes are also significantly increased. Therefore, overexpression of the GmBBX13b gene in soybean is one of effective ways to change the plant type of soybean and delay the flowering time, leaf and plant senescence of soybean, and has important production and theoretical significance for breeding of superior soybean varieties and development of germplasm resources.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the GmBBX13b gene in delaying soybean leaf and plant senescence. Background Technology

[0002] Soybeans are an important dual-purpose crop for both grain and oil production. Leaf senescence is regulated by both endogenous factors such as leaf age and plant hormones, and exogenous conditions such as light, temperature, and pressure. Adverse environmental factors such as shading, drought, and pests and diseases can all lead to premature leaf senescence, severely affecting crop photosynthetic efficiency and nutrient redistribution, thereby reducing yield. Therefore, in-depth research into the regulatory mechanisms of leaf senescence is of great significance for optimizing crop production performance.

[0003] The B-box (BBX) protein family is a class of zinc finger transcription factors. They play crucial roles in light-regulated development, such as seed germination, seedling photomorphogenesis, shade avoidance, flowering, and responses to biotic and abiotic stresses. The GmBBX13b protein contains two B-box domains. To date, no studies have been reported on the soybean GmBBX13b gene. Therefore, cloning and functional studies of the GmBBX13b gene are of significant importance. Summary of the Invention

[0004] The purpose of this invention is to provide an application of the soybean GmBBX13b gene in delaying leaf and plant senescence.

[0005] To achieve the objectives of this invention, the following technical solutions can be used.

[0006] In a first aspect, the present invention protects the use of any of the following substances in regulating soybean leaf and plant senescence:

[0007] (1) Soybean GmBBX13b gene;

[0008] (2) Soybean GmBBX13b protein;

[0009] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the soybean GmBBX13b gene;

[0010] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0011] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;

[0012] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO.2 in the sequence listing.

[0013] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0014] Secondly, this invention protects the use of any of the following substances in increasing soybean plant height, number of nodes on the main stem, and number of branches:

[0015] (1) Soybean GmBBX13b gene;

[0016] (2) Soybean GmBBX13b protein;

[0017] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the soybean GmBBX13b gene;

[0018] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0019] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;

[0020] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0021] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0022] Thirdly, this invention protects the use of any of the following substances in regulating the flowering time of soybeans:

[0023] (1) Soybean GmBBX13b gene;

[0024] (2) Soybean GmBBX13b protein;

[0025] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the soybean GmBBX13b gene;

[0026] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0027] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;

[0028] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0029] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0030] Fourthly, this invention protects the use of any of the following substances in plant breeding:

[0031] (1) Soybean GmBBX13b gene;

[0032] (2) Soybean GmBBX13b protein;

[0033] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the GmBBX13b gene;

[0034] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0035] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;

[0036] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0037] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0038] In a specific implementation scheme, the tag in the aforementioned protein refers to a polypeptide or protein that is fused with the target protein and expressed using in vitro recombinant technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be a Flag tag, His tag, GST tag, etc.

[0039] In a specific implementation plan, the recombinant bacteria is Agrobacterium, specifically Agrobacterium EHA105.

[0040] Fifthly, the present invention protects a method for delaying the senescence of soybean leaves and plants, the method comprising increasing the content and / or activity of the GmBBX13b protein described above;

[0041] The increase in the content and / or activity of the GmBBX13b protein mentioned above is achieved by increasing the expression level of the GmBBX13b gene.

[0042] In a specific implementation, the increase in the expression level of the GmBBX13b gene is achieved by transferring a recombinant plant expression vector that overexpresses GmBBX13b into the plant.

[0043] In a sixth aspect, the present invention provides a method for increasing soybean plant height, number of nodes on the main stem, and number of branches, the method comprising increasing the content and / or activity of the GmBBX13b protein mentioned above.

[0044] Preferably, increasing the content and / or activity of the GmBBX13b protein mentioned above is achieved by increasing the expression level of the GmBBX13b gene.

[0045] More preferably, the expression level of the GmBBX13b gene is increased by transferring a recombinant plant expression vector that overexpresses GmBBX13b into the plant.

[0046] More preferably, the recombinant plant expression vector is specifically constructed by the following method: the GmBBX13b gene fragment is constructed into the JRH0641 vector through homologous recombination to obtain the recombinant plant expression vector.

[0047] In a seventh aspect, the present invention protects a method for delaying the flowering time of soybeans, the method comprising increasing the content and / or activity of the GmBBX13b protein described above.

[0048] Preferably, increasing the content and / or activity of the GmBBX13b protein mentioned above is achieved by increasing the expression level of the GmBBX13b gene.

[0049] More preferably, the expression level of the GmBBX13b gene is increased by transferring a recombinant plant expression vector that overexpresses GmBBX13b into the plant.

[0050] More preferably, the recombinant plant expression vector is specifically constructed by the following method: the GmBBX13b gene fragment is constructed into the JRH0641 vector through homologous recombination to obtain the recombinant plant expression vector.

[0051] The recombinant plant expression vector overexpressing GmBBX13b was transferred into the soybean cultivar Williams82 (hereinafter referred to as Wm82) using transgenic technology to increase the expression level of GmBBX13b in soybean. It was found that after overexpression of GmBBX13b, soybean plant height, number of main stem nodes, and number of branches increased significantly, while flowering time, leaf senescence time, and plant senescence time were significantly delayed.

[0052] The recombinant plant expression vector was constructed using the following method: the GmBBX13b gene fragment was constructed into the JRH0641 vector through homologous recombination to obtain the recombinant plant expression vector.

[0053] The significant advantages of this invention are:

[0054] This invention provides, for the first time, the application of the protein encoded by the GmBBX13b gene in regulating soybean leaf and plant senescence. Transgenic soybean lines overexpressing the GmBBX13b gene were created, and it was found that compared with wild-type soybeans, GmBBX13b transgenic soybeans exhibited significantly delayed flowering time, leaf and plant senescence time, a significantly increased number of branches, and significantly increased plant height and main stem nodes. Therefore, this invention can obtain late-maturing soybean lines, which have significant application value. Attached Figure Description

[0055] Figure 1 This is a schematic diagram illustrating the detection of transcriptional and protein expression levels in the soybean GmBBX13b transgenic line of this invention.

[0056] Figure 2 This is a statistical result of the flowering time of soybean plants after overexpression of GmBBX13b in the field according to the present invention.

[0057] Figure 3 This is a statistical result graph showing the results of overexpression of GmBBX13b in soybeans according to the present invention, including plant height, number of main stem nodes, number of branches, number of leaves, and plant senescence time in the field. Detailed Implementation

[0058] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0059] Unless otherwise specified, all experimental materials used in the following examples were purchased from routine biochemical reagent stores. The determination of vector sequencing in the following examples was performed by routine sequencing companies.

[0060] The soybean (Glycine max) variety Wm 82 was provided by the National Center for Soybean Improvement at Nanjing Agricultural University.

[0061] The overexpression vector used in this invention is JRH0641, which was provided by the National Center for Soybean Improvement, Nanjing Agricultural University.

[0062] Example 1: Construction of soybean GmBBX13b overexpression vector

[0063] Total RNA was extracted from tender leaves of soybean Wm 82 seedlings and cDNA was synthesized using a reverse transcription kit.

[0064] This invention provides primers for constructing overexpression vectors, including primers for amplifying target fragments.

[0065] JRH0641-GmBBX13b-XhoI-F: GTCCGGACTCAGATCTCGAGATGCGAACGCTTTGTGATGC;

[0066] JRH0641-GmBBX13b-SpeI-R: GGAGGACCGGATCCACTAGTTGGCTGATTATTTGATGCTT.

[0067] 1. Obtaining the GmBBX13b CDS fragment

[0068] (1) Preparation of reaction system 1. Reaction system 1 is 50 μL, consisting of 1 μL KOD Plus, 5 μL 10×PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer JRH0641-GmBBX13b-XhoI-F aqueous solution (concentration 10 μM), 1.5 μL primer JRH0641-GmBBX13b-SpeI-R aqueous solution (concentration 10 μM), 1 μL soybean cDNA and 34 μL ddH2O.

[0069] (2) After completing step (1), take the reaction system 1 and perform PCR amplification. The GmBBX13b fragment is recovered using an agarose gel recovery kit (Zhuangmeng International Biotechnology Co., Ltd.). The reaction program is as follows: 94℃ for 2 min; 94℃ for 15 s, 57℃ for 30 s, 68℃ for 30 s, 35 cycles; store at 12℃.

[0070] 2. The vector JRH0641 was double-digested with restriction endonucleases XhoI and SpeI, and the linearized vector was recovered.

[0071] The vector JRH0641 is described in the following literature: Lyu, X., Cheng, Q., Qin, C., Li, Y., Xu, X., Ji, R., Mu, R., Li, H., Zhao, T., Liu, J., Zhou, Y., Li, H., Yang, G., Chen, Q., and Liu, B. (2020). GmCRY1s Modulate Gibberellin Metabolism to Regulate Soybean Shade Avoidance in Response to Reduced Blue Light. Mol. Plant.

[0072] 3. Obtaining the ligation product

[0073] (1) Mix 1 μL of GmBBX13b fragment, 1.5 μL of the vector backbone recovered in step 2 (50 ng) and 2.5 μL of 2×Uniclone Seamless Cloning Mix (Genesand, SC612) to obtain the ligation system.

[0074] (2) Take the connection system and react at 50°C for 30 min to obtain the connection product.

[0075] 4. The ligation product was transformed into Escherichia coli DH5α competent cells (Tolo Harbor) to obtain several single clones.

[0076] Each single clone was used as a template for bacterial culture PCR amplification and detection. Clones containing the 555bp target fragment GmBBX13b were sent for bacterial culture sequencing, yielding positive clones.

[0077] 5. Inoculate positive monoclonal antibodies into LB liquid medium and culture to obtain bacterial culture; then extract plasmids from the bacterial culture, namely recombinant plasmid GmBBX13b.

[0078] Based on the sequencing results, the structure of the recombinant plasmid GmBBX13b is described as follows: The small DNA fragment between the recognition sequences of the restriction endonucleases XhoI and SpeI of the vector JRH0641 is replaced with the amino acid sequence encoding SEQ ID No. 2 to obtain the recombinant plasmid.

[0079] Example 2: Obtaining Transgenic Soybean Plants

[0080] 1. After constructing the recombinant plasmid and transforming Agrobacterium EHA105, soybean transformation was carried out.

[0081] 2. The recombinant plasmid was transformed into soybean variety Wm 82 (hereinafter referred to as soybean). After screening, differentiation, and rooting, T0 generation transgenic soybean plants were obtained. The specific steps are as follows:

[0082] (1) Sterilize soybeans with chlorine gas produced by the reaction of 15 mL concentrated hydrochloric acid and 100 mL sodium hypochlorite for 2.5-3 hours. Remove the soybeans and dry them in a clean bench.

[0083] (2) Seed germination: Sow soybeans evenly in the germination medium, about 20-30 seeds per dish.

[0084] (3) Agrobacterium infection: Cut the soybean in half, remove part of the embryo tip, and make a wound in the meristematic area to obtain the soybean explant. Place it in a recombinant Agrobacterium bacterial solution with an OD of about 0.6 at 600 nm and shake at room temperature for 30 min. Take out the explant and blow it under sterile conditions for 10 min. Then spread it on a co-culture medium and incubate in the dark for 5 days.

[0085] (4) Wash the embryo 4-5 times with sterile water and liquid induction medium containing hormones to ensure that Agrobacterium is thoroughly cleaned. Cut off the elongated embryo, leaving only 3-4 mm. Insert the embryo downwards into the solid bud induction medium and incubate for 2 weeks in a 25°C incubator with 16 hours of light and 8 hours of darkness.

[0086] (5) After 15 days, some explants began to sprout. Those with sprouts were cut off from the stump and transferred to a new solid bud induction medium. Those without sprouts were discarded and continued to be cultured under light in the greenhouse.

[0087] (6) After 15 days, the explants that have sprouted were subcultured into a new solid bud induction medium. The explants that have not sprouted were discarded. The explants were cultured in the greenhouse for 15 days. The explants were cultured in the solid bud induction medium for a total of 30 days.

[0088] (7) Separate the well-grown callus from the bean, discard the explant, scrape off the black surface of the callus, and transfer it to a solid shoot elongation medium. Replace the solid elongation medium every 15 days, and generally subculture 4-5 times, for a total of 60-80 days. The callus is being screened while it is elongating, and seedlings will grow during the screening process.

[0089] (8) When the seedlings grow to about 4-5cm, cut them off from the callus and transfer them to the rooting medium.

[0090] (9) After culturing in the rooting medium for about 20-30 days, the seedlings that have grown strong and developed root systems can be transferred to a pure vermiculite environment in a disposable cup and placed in a low-light hardening environment. Use another disposable plastic cup to cover the seedlings to achieve the purpose of moisturizing. Generally, hardening takes 5 days.

[0091] (10) After a few days of adaptation, when you observe obvious root growth, remove the disposable cup used for moisturizing. Transfer it to a large pot containing nutrient soil and continue to cultivate it.

[0092] Example 3: Obtaining positive transgenic soybean plants

[0093] To identify transgenic positive plants, fresh leaves of the T0 generation were taken, DNA was extracted, and PCR testing was performed.

[0094] For transgenic lines overexpressing GmBBX13b, we detected their basta resistance gene and designed specific primers based on the recombinant vector to detect the insertion of T-DNA in the T0 generation plants. Positive plants were self-crossed twice to identify homozygosity, and the transcriptional and protein expression levels of GmBBX13b were simultaneously detected.

[0095] To identify GmBBX13b overexpression-positive plants, basta testing was performed on the leaves of individual T0 generation transgenic lines. Plants exhibiting basta resistance were considered false positives. Protein was extracted from basta-resistant plants for transcriptional and Western blot analysis. Results showed that, compared to the wild type, GmBBX13b overexpression in GmBBX13b-FLAG#7 and GmBBX13b-FLAG#9 overexpression plants exhibited higher transcriptional and protein expression levels. The results are as follows: Figure 1 As shown.

[0096] Example 4. Phenotypic identification of GmBBX13b transgenic soybean plants.

[0097] The overexpressing transgenic lines GmBBX13b-FLAG#7 and GmBBX13b-FLAG#9 (homozygous for the GmBBX13b gene) obtained in Example 3, along with seeds of the wild-type soybean variety Wm82, were planted at the Nanjing Liuhe transgenic material planting base. Flowering time was recorded 30 days after emergence, and plant height, number of main stem nodes, and number of branches were recorded after Wm82 matured. The overexpressing soybean plants GmBBX13b-FLAG#7 and GmBBX13b-FLAG#9 showed significantly higher plant height, more main stem nodes, and more branches than Wm82 (P<0.05), and significantly later flowering and leaf senescence times (P<0.05). The results are shown in the table below. Figure 2 and Figure 3 .

[0098] The present invention has been described in detail above. The scope of protection of the present invention is not limited to the embodiments described above. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention and are protected by the appended claims.

Claims

1. The application of any one of the following substances in delaying soybean leaf senescence, characterized in that, The application is achieved by overexpressing GmBBX13b protein in soybeans to delay soybean leaf senescence: (1) Soybeans GmBBX13b Gene; (2) Soybean GmBBX13b protein; (3) Contains soybeans GmBBX13b Recombinant gene expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2): (A1) The amino acid sequence as described in SEQ ID NO. 2; (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1); The soybean GmBBX13b The gene encodes the soybean GmBBX13b protein.

2. The application of any one of the following substances in increasing soybean plant height, number of main stem nodes, and number of branches, characterized in that, The application is achieved by overexpressing the GmBBX13b protein in soybean to increase soybean plant height, number of main stem nodes, and number of branches: (1) Soybeans GmBBX13b Gene; (2) Soybean GmBBX13b protein; (3) Contains soybeans GmBBX13b Recombinant gene expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2): (A1) The amino acid sequence as described in SEQ ID NO. 2; (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1); The soybean GmBBX13b The gene encodes the soybean GmBBX13b protein.

3. The application of any one of the following substances in delaying the flowering time of soybeans, characterized in that, The application is achieved by overexpressing the GmBBX13b protein in soybeans to delay the flowering time of soybeans: (1) Soybeans GmBBX13b Gene; (2) Soybean GmBBX13b protein; (3) Contains soybeans GmBBX13b Recombinant gene expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2): (A1) The amino acid sequence as described in SEQ ID NO. 2; (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1); The soybean GmBBX13b The gene encodes the soybean GmBBX13b protein.

4. The application of any one of the following substances in soybean breeding, characterized in that, The application was achieved by obtaining soybean breeding materials with a delayed soybean leaf senescence phenotype through overexpression of GmBBX13b protein in soybeans. (1) Soybeans GmBBX13b Gene; (2) Soybean GmBBX13b protein; (3) Contains soybeans GmBBX13b Recombinant gene expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2): (A1) The amino acid sequence as described in SEQ ID NO. 2; (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1); The soybean GmBBX13b The gene encodes the soybean GmBBX13b protein.

5. The application according to any one of claims 1-4, characterized in that, The soybean GmBBX13b The gene sequence is as described in SEQ ID NO.

1.

6. A method for delaying soybean leaf senescence, the method comprising increasing the content and / or activity of the GmBBX13b protein as described in claim 1.

7. The method according to claim 6, characterized in that, Increasing the content and / or activity of the GmBBX13b protein by increasing the content of the protein... GmBBX13b It is achieved through the expression level of genes.

8. The method for delaying soybean leaf senescence according to claim 7, characterized in that, Improve the aforementioned GmBBX13b Gene expression levels are determined by overexpression. GmBBX13b The recombinant plant expression vector is transferred into soybean to achieve this; the recombinant plant expression vector is specifically constructed and obtained by the following method: [The text abruptly ends here, likely due to an incomplete sentence or a missing section.] GmBBX13b Gene fragments were constructed using homologous recombination. JRH0641 The vector is thus used to obtain a recombinant plant expression vector.

9. A method for increasing soybean plant height, number of nodes on the main stem, and number of branches, characterized in that, The method includes increasing the content and / or activity of the GmBBX13b protein as described in claim 1.

10. The method according to claim 9, characterized in that, The content and / or activity of the GmBBX13b protein as described in claim 1 are increased by improving the content of the protein. GmBBX13b It is achieved through the expression level of genes.

11. The method according to claim 10, characterized in that, Improve the aforementioned GmBBX13b Gene expression levels are determined by overexpression. GmBBX13b The recombinant plant expression vector was transferred into soybean to achieve this.

12. The method according to claim 11, characterized in that, The recombinant plant expression vector was specifically constructed using the following method: GmBBX13b Gene fragments were constructed using homologous recombination. JRH0641 The vector is thus used to obtain a recombinant plant expression vector.

13. A method for delaying the flowering time of soybeans, characterized in that, The method includes increasing the content and / or activity of the GmBBX13b protein as described in claim 1.

14. The method according to claim 13, characterized in that, The content and / or activity of the GmBBX13b protein as described in claim 1 are increased by improving the content of the protein. GmBBX13b It is achieved through the expression level of genes.

15. The method according to claim 14, characterized in that, Improve the aforementioned GmBBX13b Gene expression levels are determined by overexpression. GmBBX13b The recombinant plant expression vector was transferred into soybean to achieve this.

16. The method according to claim 15, characterized in that, The recombinant plant expression vector was specifically constructed using the following method: GmBBX13b Gene fragments were constructed using homologous recombination. JRH0641 The vector is thus used to obtain a recombinant plant expression vector.

Images