A directional cloning method for directly connecting the target fragment amplification product into a circular cloning vector

Abstract

The present invention discloses a directional cloning method for directly connecting a target fragment amplification product into a circular cloning vector, and relates to the field of gene engineering technology. The method comprises the following steps: designing a PCR amplification primer pair for amplification of the target fragment to be inserted; adding the amplification product containing the recombination arm and the circular basic vector to a reaction system containing both a homologous recombinase and a restriction endonuclease, and obtaining a recombinant vector into which the target fragment is inserted by a cloning reaction; the target fragment does not contain the restriction endonuclease cleavage site, and after the target fragment is inserted, the restriction endonuclease site selected by the original vector is destroyed. The directional cloning method provided by the present invention does not require the preparation of a T vector, does not require the linearization of the vector, and does not have the phenomenon of vector self-ligation, which saves experimental time and makes the cloning experiment simpler and easier; any fragment that does not contain the selected restriction endonuclease cleavage site can be cloned into the target intermediate vector using this method.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for directed cloning by directly ligating the amplified product of a target fragment into a circular cloning vector. Background Technology

[0002] Molecular cloning technology, developed in the 1970s, has opened up new fields in molecular genetics research, allowing humans to understand, identify, isolate, and modify genes, and create new species. The emergence, development, and widespread application of molecular cloning technology have not only propelled scientific research forward and profoundly impacted industries such as agriculture, animal husbandry, and medicine, but will also pave a new path to solving the world's three major crises—energy, food, and environmental protection—bringing enormous economic and social benefits to human society.

[0003] Cloning reactions are a crucial step in molecular cloning experiments, and the quality of these reactions directly impacts the success of subsequent work. Conventional molecular cloning methods can be categorized as follows:

[0004] (1) TA Cloning (Original TA Cloning Kit). This utilizes the characteristic that the amplified product will have a single A base protruding from its end after Taq DNA polymerase amplification. This protruding A base is then ligated to a T vector to form a clone. The disadvantage of cloning is that the T vector is unstable, and the sticky 3' end protruding T is easily lost.

[0005] Vectors digested with enzymes can still undergo self-ligation. This is mainly caused by incomplete digestion, inappropriate selection of ligases (e.g., T4 ligase has low recognition rate and ligation efficiency), improper use of alkaline phosphatase, and an incorrect ratio of vector to target fragment. This phenomenon can interfere with the insertion and expression of the target gene, leading to false positives and increasing the difficulty of screening.

[0006] (2) Single enzyme digestion and ligation cloning. After single enzyme digestion of the vector, it needs to be treated with dephosphorylase (CIAP) for dephosphorylation in order to reduce the proportion of vector self-ligation. If dephosphorylation is not performed, the proportion of vector self-ligation will be too high, making screening difficult. For CIAP dephosphorylation, if the treatment time is too short, it will not achieve the dephosphorylation effect; if the treatment time is too long, the vector will be easily destroyed and cannot be used subsequently.

[0007] (3) Double enzyme digestion ligation cloning. This method is a common directional cloning method. However, if the purpose of cloning is only for screening and no subsequent functional studies are conducted, this cloning method is not necessary.

[0008] Therefore, it can be seen that the above-mentioned conventional cloning reactions, whether T vectors or enzyme-digested cloning vectors, all require the vector to be digested, purified and recovered by electrophoresis or ethanol precipitation, which are complicated steps before a linearized vector can be obtained. Furthermore, subsequent experimental steps of fragment ligation into the vector are required to complete the process.

[0009] Given the cumbersome experimental steps and the high cost of enzyme digestion vector experiments, there is an urgent need for a cloning method that is applicable to restriction endonucleases that produce either blunt ends or sticky ends (i.e., restriction sites) after digestion, in order to save cloning reaction time and make the cloning process simpler and easier. Summary of the Invention

[0010] This invention provides a method for directional cloning by directly ligating the amplified product of a target fragment into a circular cloning vector, specifically achieved through the following techniques.

[0011] A method for directed cloning by directly ligating the amplified product of a target fragment into a circular cloning vector includes the following steps:

[0012] PCR amplification primers were designed for the target fragment to be inserted. The amplification product containing the recombinant arm and the circular basic vector were simultaneously added to a reaction system containing both homologous recombinase and restriction endonuclease. The cloning reaction yielded a recombinant vector with the target fragment inserted. The target fragment does not contain the restriction endonuclease cleavage site. After the target fragment is inserted, the original restriction sites on the circular basic vector used for inserting the target fragment are destroyed.

[0013] The directional cloning method provided by this invention allows for the design of forward / reverse primers for PCR amplification based on the restriction enzyme sites of the target fragment and the circular basal vector when amplifying the target fragment.

[0014] Optionally, the forward primer for PCR amplification contains a portion of the circular basal vector sequence on one side of the restriction enzyme insertion site, and the reverse primer contains a portion of the circular basal vector sequence on the other side of the restriction enzyme insertion site.

[0015] This segment of the sequence is typically 15-22 bp.

[0016] This invention utilizes homologous recombinases, restriction endonucleases, and circular basic vectors to directly achieve linearization and directional cloning of circular basic vectors in the same system. During the reaction, the A base (A tail) is removed, and no insert fragment appears in the final plasmid. It can be amplified with any PCR enzyme (e.g., Taq DNA polymerase or high-fidelity PCR enzyme) without considering whether the product ends with an A tail.

[0017] Conventional cloning reactions, whether using T-vectors or circular base vectors, require prior linearization through enzymatic digestion. The vectors are then purified by electrophoresis or alcohol precipitation to obtain the linearized vector. This linearized vector then needs to be ligated into the target fragment to create the final recombinant vector. The entire reaction process is complex and cumbersome.

[0018] In the method described above, two types of endonucleases linearize the vector while the recombinase homologously recombines the fragment into the linearized vector, shortening the experimental time and reducing the number of experimental steps. Furthermore, by utilizing the minimal self-circularization of the linearized vector under the action of the recombinase, false positive clones are reduced, thus improving cloning efficiency.

[0019] Furthermore, the homologous recombinase is Taq DNA polymerase or high-fidelity DNA polymerase.

[0020] High-fidelity PCR enzymes (such as Pfu DNA Polymerase and PrimeSTAR HS DNA Polymerase) utilize their 3'→5' exonuclease activity to ensure the fidelity of PCR products, but the amplified PCR products are blunt-ended DNA fragments without an A tail, which cannot be directly used for directed cloning experiments. Taq DNA polymerase has both 5'→3' DNA polymerase and 5'→3' exonuclease activities, but no 3'→5' exonuclease activity. In the PCR reaction, the amplified product has an A tail at the 3' end and can be directly used for directed cloning. Therefore, the characteristics of high-fidelity PCR enzymes and Taq DNA polymerase undoubtedly limit the range of PCR enzymes that can be selected in molecular cloning.

[0021] Furthermore, the homologous recombinase is selected from commercially available seamless cloning kits, such as DNA AssemblyMix Ultra Rapid Multi-Fragment DNA Seamless Cloning Premix (Yugong Biotechnology Co., Ltd.), 2×Seamless Cloning Mix (Bomaide Biotechnology Co., Ltd.), Seamless Cloning Kit (Beyotime Biotechnology Co., Ltd.), ClonExpress IIOne Step Cloning Kit (NovaZeneca) or EasyGeno Rapid Recombinant Cloning Kit (Tiangen Biotech Co., Ltd.).

[0022] Furthermore, the restriction endonuclease is a blunt-ended endonuclease or a sticky-ended endonuclease.

[0023] Furthermore, the annular base carrier is pUC57, pUC18, or pBluescriptII SK(+), or other annular carriers commonly used in the art.

[0024] Furthermore, the PCR amplification reaction system includes the target fragment, PCR Mix, forward amplification primers, reverse amplification primers, and water. The concentration and amount of each reagent in the reaction system can be adjusted routinely according to actual conditions.

[0025] Optionally, the reaction system for PCR amplification is shown in Table 1 below:

[0026] Table 1

[0027] .

[0028] Furthermore, the reaction system for directed cloning includes restriction endonuclease buffer, circular base vector, amplification product, restriction endonuclease, and homologous recombination mix. The concentration and amount of each reagent in the reaction system can be routinely adjusted according to actual conditions.

[0029] Optionally, the reaction system for directed cloning is shown in Table 2 below.

[0030] Table 2

[0031] .

[0032] Compared with the prior art, the advantages of the present invention are:

[0033] 1. No need to prepare T-vectors or linearize vectors; PCR products are not limited by amplification enzymes and can be either blunt-ended or contain protruding sticky ends (A). One reaction system has two reactions. While the restriction enzyme linearizes the vector, the recombinase homologously recombines the fragment into the linearized vector. There is no vector self-ligation. Even if the linearized vector undergoes a very small percentage of self-circularization under the action of the recombinase, it will be cleaved again by the restriction enzyme in the system later. This saves experimental time and makes cloning experiments simpler and easier.

[0034] 2. Any fragment that does not contain the selected restriction endonuclease cleavage site can be cloned into the target intermediate vector using this method. Attached Figure Description

[0035] Figure 1 This is the result of cell transformation culture in Example 1.

[0036] Figure 2 The results of PCR identification of fragment I in Example 1 show that 100% of the fragments are the target clones.

[0037] Figure 3 This is the result of cell transformation culture in Example 2.

[0038] Figure 4 The results of PCR identification of fragment II in Example 2 show that 100% of the fragments are the target clones. Detailed Implementation

[0039] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] The present invention provides a directional cloning method for directly ligating the amplified product of a target fragment into a circular cloning vector, specifically comprising: designing PCR amplification primers for amplification of the target fragment to be inserted; simultaneously adding the amplification product containing the recombinant arm and the circular basic vector to a reaction system containing both homologous recombinase and restriction endonuclease, and obtaining a recombinant vector with the target fragment inserted by the cloning reaction; wherein the target fragment does not contain the restriction endonuclease cleavage site.

[0041] In some embodiments of the present invention, the homologous recombinase is Taq DNA polymerase or high-fidelity DNA polymerase.

[0042] In some embodiments of the present invention, the restriction endonuclease is a blunt-ended endonuclease or a sticky-ended endonuclease.

[0043] Optionally, the annular base carrier is pUC57, pUC18, or pBluescriptII SK(+), or other annular carriers commonly used in the art.

[0044] Optionally, the PCR amplification reaction system includes the target fragment, PCR Mix, forward amplification primers, reverse amplification primers, and water. The concentration and amount of each reagent in the reaction system can be adjusted routinely according to actual conditions.

[0045] Typically, the forward primer for PCR amplification contains a circular basal vector sequence on one side of the 15-22 bp restriction enzyme insertion site, and the reverse primer contains a circular basal vector sequence on the other side of the 15-22 bp restriction enzyme insertion site.

[0046] Optionally, the reaction system for directed cloning includes restriction endonuclease buffer, circular base vector, amplification product, restriction endonuclease, and homologous recombination mix. The concentration and amount of each reagent in the reaction system can be adjusted routinely according to actual conditions.

[0047] In other embodiments of the present invention, a kit is also provided for a directed cloning method of directly ligating the amplified product of a target fragment into a circular cloning vector, the kit comprising the homologous recombinase, restriction endonuclease and PCR amplification primers.

[0048] Example 1: Directed cloning of a 489bp fragment

[0049] 1. Experimental Preparation

[0050] Reagents: 2 × Pfu PCR MasterMix (tool enzyme for amplifying PCR fragments), blunt-end restriction enzyme EcoRV, homologous recombination Mix (used to ligate the target fragment to the circular basic vector), competent cells DH5α.

[0051] Materials: The circular base vector used in this patent is pUC57 (2710bp), a commonly used cloning vector, and the selected restriction enzyme site is EcoRV.

[0052] Test segment: In this embodiment, segment I (489 bp) is randomly selected as the target segment to be inserted.

[0053] The nucleotide sequence of fragment I is as follows:

[0054] catatgataaatagtgcactcagaataaaaattctttgtgcaacctacgtgaatgtaaatattcgagacattgataagatctatgttcgaacaggtatctaccatggaggagaacccttatgt gacaatgtgaacactcaaagagtaccttgttccaatcccaggtggaatgaatggctgaattatgatatatacattcctgatcttcctcgtgctgctcgactttgcctttccatttgctctgtta aaggccgaaagggtgctaaagaggaacactgtccattggcatggggaaatataaacttgtttgattacacagacactctagtatctggaaaaatggctttgaatctttggccagtacctcatg gattagaagatttgctgaaccctattggtgttactggatcaaatccaaataaagaaactccatgcttagagttggagtttgactggttcagcagtgtggtaaagttcccataactcgag, as in SEQ Shown as ID NO.1.

[0055] 2. PCR amplification

[0056] Design primers for the amplification of fragment I.

[0057] Forward amplification primers, fragment I-F (5'→3'):

[0058] cctcgcgaatgcatctagat CATATGATAAATAGTGCACT, as shown in SEQ ID NO.2. The sequence " cctcgcgaatgcatctagat (20bp) refers to the recombinant arm.

[0059] Reverse amplification primers, fragment I-R (5'→3'):

[0060] cgacgggcccgggatccgatCTCGAGTTATGGGAACTTTA, as shown in SEQ ID NO.3. The sequence “cgacgggcccgggatccgat” (20 bp) is the recombinant arm.

[0061] The reaction system for PCR amplification is shown in Table 3 below.

[0062] Table 3

[0063] The PCR amplification procedure is shown in Table 4 below.

[0064] Table 4

[0065] 3. Purification and recovery of PCR products

[0066] (1) Prepare reagents: sol solution DD, elution buffer EB, rinsing solution WB, adsorption column EC and collection tube.

[0067] (2) Under a long-wave ultraviolet lamp, use a clean blade to cut off the DNA band (PCR product) to be recovered, and remove as much DNA-free gel as possible to obtain a smaller gel volume.

[0068] (3) Place the cut gel containing DNA bands (PCR products) into a 1.5 ml centrifuge tube and weigh it.

[0069] First, weigh an empty 1.5 ml centrifuge tube, then add the gel block and weigh it again. Subtract the two weights to get the weight of the gel.

[0070] (4) Add 3 times the volume of sol solution DD.

[0071] If the gel weight is 100 mg, its volume can be considered as 100 μl, then add 300 μl of sol. If the gel concentration is greater than 2%, add 6 times the volume of sol.

[0072] (5) Place in a 56°C water bath for 10 minutes (or until the gel is completely dissolved). Vortex every 2-3 minutes to help accelerate dissolution.

[0073] (6) Add 150 μl of isopropanol to every 100 mg of the initial gel weight and shake to mix. Adding isopropanol can improve the recovery rate. Do not centrifuge after adding.

[0074] When recovering fragments larger than 4Kb, isopropanol should not be added, as its addition may sometimes reduce recovery efficiency.

[0075] (7) Add the solution obtained in the previous step to the adsorption column EC (place the adsorption column in the collection tube), let it stand at room temperature for 1 min, centrifuge at 12,000 rpm for 30-60 s, and discard the waste liquid in the collection tube.

[0076] (8) Add 700 μl of washing solution WB, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0077] (9) Add 500 μl of washing solution WB, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0078] (10) Place the adsorption column EC back into the empty collection tube, centrifuge at 12,000 rpm for 2 min, and remove as much of the washing solution as possible to avoid the residual ethanol in the washing solution inhibiting the downstream reaction.

[0079] (11) Take out the adsorption column EC and put it into a clean centrifuge tube. Add 50 μl of elution buffer EB to the middle of the adsorption membrane (the elution buffer is better if it is heated in a water bath at 65-70℃ beforehand). Let it stand at room temperature for 2 min and centrifuge at 12,000 rpm for 1 min.

[0080] 3. Targeted cloning

[0081] The circular base vector used in this embodiment is pUC57 (2710 bp), and its nucleotide sequence is shown in SEQ ID NO.4. The reaction system is shown in Table 5 below.

[0082] Table 5

[0083] The reaction conditions were as follows: add 0.2 μl to a centrifuge tube, mix thoroughly, place in a PCR amplification instrument, react at 37℃ for 50 min, and after completion, store directly on an ice box for subsequent transformation operations.

[0084] 4. Cell transformation

[0085] (1) Take the ligation product and add it to the freshly melted DH5α competent cells, mix gently, and incubate in an ice water bath for 20-30 minutes.

[0086] (2) Heat shock in a 42℃ water bath for 90 seconds, without shaking the water surface. After the heat shock, immediately place it in an ice water bath for 2 minutes.

[0087] (3) Add 500 μl of SOC or LB medium to the tube and incubate at 37°C at about 200 rpm for 60 min.

[0088] (4) Centrifuge at 4000 rpm for 1 min, discard part of the supernatant, retain 100-200 μl, gently pipette to resuspend the bacteria, take half of the bacterial suspension and spread it on an LB solid culture plate containing AMP antibiotic, after the liquid is aspirated, invert the plate and incubate overnight at 37℃. The culture results are as follows. Figure 1 As shown.

[0089] 5. Identification of positive clones

[0090] (1) Take a 0.2 μL centrifuge tube and add 10 μL of ddH2O.

[0091] (2) Use a 10 μL pipette tip to pick up suitable colonies on the transformed plate. When picking, try to select colonies of moderate size with no interfering colonies around them.

[0092] (3) Place the above-mentioned pipette tip into the corresponding centrifuge tube and stir to ensure that the bacteria are fully mixed.

[0093] (4) Using the prepared bacterial culture as a template, positive clone PCR identification was performed. The positive clone PCR identification system is shown in Table 6 below, and the reaction procedure is shown in Table 7 below.

[0094] The nucleotide sequence of the forward primer M13F is (5'→3'): cgccagggttttcccagtcacgac, as shown in SEQ ID NO.5.

[0095] The nucleotide sequence of the reverse primer M13R is (5'→3'): agcggataacaatttcacacagga, as shown in SEQ ID NO. 6.

[0096] Table 6

[0097] Table 7

[0098] (5) The above reaction results were subjected to agarose gel electrophoresis. The electrophoresis results are as follows: Figure 2 As shown.

[0099] Figure 1 and Figure 2 This indicates that the experiment of directly ligating PCR products into a circular cloning vector was successfully completed, and based on... Figure 2 The PCR results show a 100% positivity rate.

[0100] Example 2: Targeted cloning of a 993bp fragment

[0101] 1. Experimental Preparation

[0102] Reagents: 2×Pfu PCR MasterMix, mucoterminal endonucleases EcoRI and HindIII, homologous recombination Mix, competent cells DH5α.

[0103] Materials: The vector used in this patent is pUC57 (2710bp), a commonly used cloning vector. The selected restriction sites are EcoRI (gaattc) at the 5-end and HindIII (aagctt) at the 3-end.

[0104] Test segment: In this embodiment, segment II (993 bp) is randomly selected as the target segment to be inserted.

[0105] The nucleotide sequence of fragment II is as follows:

[0106] ggatccgccaccatgctgccgagagtgggctgccccgcgctgccgctgccgccgccgccgctgctgccgctgctgctgctgctactgggcgcgagtggcggcggcggcggggcgcgcgcggaggtgctgttccgctgcccgccctgcacacccgagcgcctggccgcctgcgggcccccgccggttgcgccgcccgccgcggtggccgcagtggccggaggcgcccgcatgccatgcgcggagctcgtccgggagccgggctgcggctgctgctcggtgtgcgcccggctggagggcgaggcgtgcggcgtctacaccccgcgctgcggccaggggctgcgctgctatccccacccgggctccgagctgcccctgcaggcgctggtcatgggcgagggcacttgtgagaagcgccgggacgccgagtatggcgccagcccggagcaggttgcagacaatggcgatgaccactcagaaggaggcctggtggagaaccacgtggacagcaccatgaacatgttgggcgggggaggcagtgctggccggaagcccctcaagtcgggtatgaaggagctggccgtgttccgggagaaggtcactgagcagcaccggcagatgggcaagggtggcaagcatcaccttggcctggaggagcccaagaagctgcgaccaccccctgccaggactccctgccaacaggaactggaccaggtcctggagcggatctccaccatgcgccttccggatgagcggggccctctggagcacctctactccctgcacatccccaactgtgacaagcatggcctgtacaacctcaaacagtgcaagatgtctctgaacgggcagcgtggggagtgctggtgtgtgaaccccaacaccgggaagctgatccagggagcccccaccatccggggggaccccgagtgtcatctcttctacaatgagcagcaggaggctcgcggggtgcacacccagcggatgcagctcgag,As shown in SEQ ID NO.7.

[0107] 2. PCR amplification

[0108] Design primers for the amplification of fragment II.

[0109] Forward amplification primers, fragment II-F (5'→3'):

[0110] gtaaaacgacggccagtGGATCCGCCACCATGCTGCC, as shown in SEQ ID NO.8. The sequence “ gtaaaacgacggccagt (17bp) refers to the recombinant arm.

[0111] Reverse amplification primers, fragment II-R (5'→3'):

[0112] gaccatgattacgccCTCGAGCTGCATCCGCTGGG, as shown in SEQ ID NO.9. The sequence “ gaccatgattacgcc "(15bp) refers to the recombinant arm."

[0113] The reaction system for PCR amplification is shown in Table 8 below.

[0114] Table 8

[0115] The PCR amplification procedure is shown in Table 9 below.

[0116] Table 9

[0117] 3. Targeted cloning

[0118] The circular base vector used in this embodiment is pUC57 (2710 bp), and its nucleotide sequence is shown in SEQ ID NO.4. The reaction system for directed cloning is shown in Table 10 below.

[0119] Table 10

[0120] The reaction conditions were as follows: add 0.2 μl to a centrifuge tube, mix thoroughly, place in a PCR amplification instrument, react at 37℃ for 50 min, and after completion, store directly on an ice box for subsequent transformation operations.

[0121] 4. Cell transformation

[0122] (1) Take the ligation product and add it to the freshly melted DH5α competent cells, mix gently, and incubate in an ice water bath for 20-30 minutes.

[0123] (2) Heat shock in a 42℃ water bath for 90 seconds, without shaking the water surface. After the heat shock, immediately place it in an ice water bath for 2 minutes.

[0124] (3) Add 500 μl of SOC or LB medium to the tube and incubate at 37°C at about 200 rpm for 60 min.

[0125] (4) Centrifuge at 4000 rpm for 1 min, discard part of the supernatant, retain 100-200 μl, gently pipette to resuspend the bacteria, take half of the bacterial suspension and spread it on an LB solid culture plate containing AMP antibiotic, after the liquid is aspirated, invert the plate and incubate overnight at 37℃. The culture results are as follows. Figure 3 As shown.

[0126] 5. Identification of positive clones

[0127] (1) Take a 0.2 μL centrifuge tube and add 10 μL of ddH2O.

[0128] (2) Use a 10 μL pipette tip to pick up suitable colonies on the transformed plate. When picking, try to select colonies of moderate size with no interfering colonies around them.

[0129] (3) Place the above-mentioned pipette tip into the corresponding centrifuge tube and stir to ensure that the bacteria are fully mixed.

[0130] (4) Using the prepared bacterial culture as a template, positive clones were identified by PCR using universal primers M13F / M13R. The sequences of universal primers M13F and M13R are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. The PCR identification system for positive clones is shown in Table 11 below, and the reaction procedure is shown in Table 12.

[0131] Table 11

[0132] Table 12

[0133] (5) The above reaction results were subjected to agarose gel electrophoresis. The electrophoresis results are as follows: Figure 4 As shown.

[0134] Figure 3 and Figure 4 This indicates that the experiment of directly ligating PCR products into a circular cloning vector was successfully completed, and based on... Figure 2 The PCR results show a 100% positivity rate.

[0135] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A directional cloning method for directly connecting the target fragment amplification product into a circular cloning vector, characterized in that: The following steps are involved: Design PCR amplification primers for amplification of the target fragment to be inserted; add the amplification product containing the recombination arm and the circular basic vector to a reaction system containing both a homologous recombinase and a restriction endonuclease, and perform a cloning reaction to obtain a recombinant vector into which the target fragment is inserted; the target fragment does not contain a restriction endonuclease cleavage site; after the target fragment is inserted, the original restriction endonuclease cleavage site on the circular basic vector for inserting the target fragment is destroyed.

2. The directional cloning method of directly connecting the target fragment amplification product into a circular cloning vector according to claim 1, characterized in that: The homologous recombinase is Taq DNA polymerase or high-fidelity DNA polymerase.

3. The directional cloning method of directly connecting the target fragment amplification product into a circular cloning vector according to claim 1, characterized in that: The restriction endonuclease is a blunt-end endonuclease or a sticky-end endonuclease.

4. The directional cloning method of directly connecting the target fragment amplification product into a circular cloning vector according to claim 1, characterized in that: The circular basic vector is pUC57, pUC18 or pBluescriptII SK(+).

5. The directional cloning method of directly connecting the target fragment amplification product into a circular cloning vector according to claim 1, characterized in that: The reaction system of PCR amplification includes target fragment, PCR Mix, forward amplification primer, reverse amplification primer and water.

6. The directional cloning method of directly connecting the target fragment amplification product into a circular cloning vector according to claim 1, characterized in that: The reaction system of directional cloning includes restriction endonuclease buffer, circular basic vector, amplification product, restriction endonuclease and homologous recombination mix.

7. A kit, characterized in that: The kit is used for the directional cloning method of directly connecting the target fragment amplification product into a circular cloning vector according to any one of claims 1 to 6, and the kit comprises the homologous recombinase, restriction endonuclease and PCR amplification primers.

Images