A recombinant expression vector for increasing gene copy number, construction method and application
By introducing multiple β-glucosidase genes on the E. coli expression vector and increasing the gene copy number, the problem of low β-glucosidase expression in E. coli is solved, and a significant increase in β-glucosidase expression and a reduction in production costs are achieved, providing support for industrial production.
Patent Information
- Application Number
- CN202510036418.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-09
- Publication Date
- 2025-04-04
AI Technical Summary
As a prokaryotes, E. coli cannot undergo effective post-translational modification, resulting in a relatively low expression of β-glucosidase, limiting its use in industrial applications.
By introducing multiple β-glucosidase genes on the E. coli expression vector, the gene copy number is increased, thereby increasing the expression of β-glucosidase.
The expression of β-glucosidase in E. coli was increased, and the crude enzyme activity of β-glucosidase in the crushing solution was increased from about 22U/mL in single copy to about 36U/mL in double copy, reducing production costs and laying the foundation for industrial production.
Smart Images
Figure CN119752970A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of gene engineering, and specifically relates to a recombinant expression vector for increasing the number of gene copies, a construction method and an application thereof. Background Art
[0002] As an important model strain, Escherichia coli has been able to express a variety of proteases due to its low-cost and simple recombinant protein expression system. However, Escherichia coli is a prokaryotic organism and cannot perform effective post-translational modifications. The expression level is relatively low, which limits its application in actual industry. It is hoped that the expression level of proteases in Escherichia coli can be increased by modifying the vector through molecular technology.
[0003] In order to improve the recombinant expression level of heterologous proteins in Escherichia coli, commonly used strategies include chassis host modification, gene expression regulatory elements and strain growth environment optimization. The improvement of the expression level of the target protein is often achieved by regulating the transcription level of the target gene. The copy number of the target gene will affect its mRNA content in the cell. Studies have shown that increasing the copy number of the target gene is an effective strategy to increase the expression of the target protein.
[0004] β-glucosidase is a major enzyme preparation that can be used to improve food flavor and form biologically active monomer components. It has great use value in the fields of food, medicine and chemistry. At present, there are always technical difficulties in the production of β-glucosidase preparations, such as low yield, which results in high enzyme costs or the inability to achieve industrial production of enzyme preparations. Therefore, using the current mature molecular biology technology to transform related strains or constructed vectors to increase the yield of proteases has become a research hotspot. Summary of the invention
[0005] In view of the deficiencies of the prior art, the present invention discloses a method for increasing the copy number of a recombinant expression vector to increase the expression amount of β-glucosidase, which can increase the expression amount of β-glucosidase in Escherichia coli.
[0006] The purpose of the present invention can be achieved through the following technical solutions:
[0007] A recombinant expression vector for increasing the number of gene copies, wherein the expression vector introduces multiple beta-glucosidase genes into an Escherichia coli expression vector, and the nucleotide sequence of the beta-glucosidase gene is SEQ ID No.1.
[0008] A method for constructing a recombinant expression vector for increasing the number of gene copies, the construction method comprising the following steps:
[0009] S1. Using the plasmid pET-22b-Bgl2A containing the target gene as a template, three pairs of primers B1 and B2; B3 and B4; B5 and B6 were designed, and the β-glucosidase gene was cloned using the three pairs of primers to obtain three groups of β-glucosidase gene fragments;
[0010] S2, using primers B1 and B2 to clone the β-glucosidase gene to obtain β-glucosidase gene-A, and then digesting it with restriction endonuclease A; using primers B3 and B4 to clone the β-glucosidase gene to obtain β-glucosidase gene-B, and then digesting it with restriction endonuclease B; using primers B5 and B6 to clone the β-glucosidase gene to obtain β-glucosidase gene-C, and then digesting it with restriction endonuclease C;
[0011] S3, digesting the pET-22b vector with NdeⅠ and HindⅢ, and then connecting with the digested fragments of β-glucosidase gene-A and β-glucosidase gene-B, and transforming into Escherichia coli BL21 to construct the recombinant vector pET-22b-Bgl2A-Bgl2A;
[0012] S4. Use NdeⅠ and HindⅢ to cut the recombinant vector pET-22b-Bgl2A-Bgl2A to obtain Bgl2A-Bgl2A, connect it with the β-glucosidase gene-C and pET-22b vector after enzyme cutting, and transform Escherichia coli BL21 to obtain pET-22b-Bgl2A-Bgl2A-Bgl2A, which is a recombinant expression vector with increased gene copy number.
[0013] Furthermore, the sequence of the primer B1 is SEQ ID NO.2, and the sequence of the primer B2 is SEQ ID NO.3.
[0014] Furthermore, the sequence of the primer B3 is SEQ ID NO.4; the sequence of the primer B4 is SEQ ID NO.5.
[0015] Furthermore, the sequence of the primer B5 is SEQ ID NO.6; the sequence of the primer B6 is SEQ ID NO.7.
[0016] Furthermore, the restriction endonuclease A is NdeⅠ and BamHI.
[0017] Furthermore, restriction endonuclease B is BamHI and HindIII.
[0018] Furthermore, restriction endonuclease C is HindⅢ and XHoⅠ.
[0019] The above-mentioned recombinant expression vector for increasing the gene copy number is used in the preparation and production of β-glucosidase.
[0020] Beneficial effects of the present invention: The present invention provides a recombinant expression vector for increasing the number of gene copies, and inserts multiple β-glucosidase genes into the multiple cloning site of the Escherichia coli expression vector to increase the number of gene copies. The present invention increases the expression amount of β-glucosidase by increasing the number of copies of the β-glucosidase gene, and the crude enzyme activity of β-glucosidase in the broken liquid is increased from about 22 U / mL of a single copy to about 36 U / mL of a double copy ( Figure 2 ), which reduced the production cost of β-glucosidase and laid a certain foundation for the industrial production of β-glucosidase and its application in various fields. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1 Amplification of the β-glucosidase gene.
[0023] Figure 2 Comparison of enzyme activities of recombinant strains with different copy numbers. DETAILED DESCRIPTION
[0024] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0025] Example 1
[0026] In the present embodiment, a recombinant expression vector for increasing the gene copy number is a vector for introducing a β-glucosidase gene into an Escherichia coli expression vector. The nucleotide sequence of the β-glucosidase gene is shown in SEQ ID No. 1.
[0027] Example 2
[0028] The method for constructing a recombinant expression vector for increasing the number of gene copies in this embodiment is to illustrate the construction of a recombinant expression vector for increasing the number of gene copies in Example 1, and comprises the following steps:
[0029] A1. Obtaining β-glucosidase gene fragment: Using the plasmid pET-22b-Bgl2A containing the target gene as a template, three pairs of primers B1, B2; B3, B4; B5, B6 were designed to clone the β-glucosidase gene respectively.
[0030] A2, construction of recombinant vector: B1, B2 clone β-glucosidase gene-A, and digest with corresponding restriction endonucleases (NdeⅠ and BamHI); B3, B4 clone β-glucosidase gene-B, and digest with corresponding restriction endonucleases (BamHI and HindⅢ); B5, B6 clone β-glucosidase gene-C, and digest with corresponding restriction endonucleases (HindⅢ and XHoⅠ). Digest pET-22b vector with NdeⅠ and HindⅢ, connect with the digested fragments β-glucosidase gene-A and β-glucosidase gene-B, and transform Escherichia coli BL21 (DE3) to construct the recombinant vector pET-22b-Bgl2A-Bgl2A.
[0031] The recombinant vector pET-22b-Bgl2A-Bgl2A was digested with A3, NdeⅠ, and HindⅢ to obtain Bgl2A-Bgl2A, which was then connected with the digested β-glucosidase gene-C and the pET-22b vector and transformed into Escherichia coli BL21 (DE3) to obtain pET-22b-Bgl2A-Bgl2A-Bgl2A.
[0032] Table 1
[0033] Primers sequence Sequence (5, -3, ) B1 SEQ ID No.2 GGAATTCCATATGACTAAAATATCTTTTACCAAC B2 SEQ ID No.3 CGCGGATCCTCTATTTGAGATTAATGCTT B3 SEQ ID No.4 CGCGGATCCATGACTAAAATATCTTTTACCAAC B4 SEQ ID No.5 CCCAAGCTTTCTATTTGAGATTAATGCTT B5 SEQ ID No.6 CCCAAGCTTATGACTAAAATATCTTTACCAAC B6 SEQ ID No.7 CCGCTCGAGTCTATTTGAGATTAATGCTT
[0034] Example 3
[0035] The β-glucosidase activity determination method used in the present invention is:
[0036] The activity of β-glucosidase was determined using pNPG as a substrate. The reaction system was as follows: 450 μL of 50 mmol / L pH 6.5 citric acid-sodium hydrogen phosphate buffer, 25 μL of 100 mmol / L pNPG, and 25 μL of appropriately diluted β-glucosidase. After incubation at 45°C for 5 min, 500 μL of 1 mol / L sodium carbonate was added to stop the reaction. The release of p-nitrophenol was detected at 405 nm, and the concentration was calculated using a standard curve. The enzyme activity unit (U) is defined as the amount of enzyme required to produce 1 μmol of p-nitrophenol in the reaction mixture per minute under the assay conditions.
[0037] The method for measuring the activity of β-glucosidase used in this example is applicable to Example 4 of the present invention. The crude activity of β-glucosidase in the broken liquid is increased from about 22 U / mL for a single copy to about 36 U / mL for a double copy ( Figure 2), the expression level of β-glucosidase increased with the increase of copy number. When the gene copy number of β-glucosidase reached 3, the expression level of enzyme protein did not continue to increase but decreased.
[0038] Example 4
[0039] The application of the method for increasing the expression amount of β-glucosidase by a recombinant expression vector with increased gene copy number in this embodiment is specifically the application of the expression vector in the preparation of β-glucosidase.
[0040] In specific application, the method of obtaining β-glucosidase protein by increasing the gene copy number recombinant expression vector is: obtain β-glucosidase gene by PCR, connect with vector pET-22b(+) by enzyme cutting and connection, obtain pET-22b-Bgl2A-Bgl2A and pET-22b-Bgl2A-Bgl2A-Bgl2A recombinant expression vectors, transfer into Escherichia coli BL21(DE3), and realize multi-copy expression of gene. Inoculate the monoclonal strain in 5mL (containing Amp) liquid LB medium and culture for 8h, transfer into 400mL liquid LB medium (containing Amp) and culture until OD600 is between 0.6 and 0.8, add IPTG with a final concentration of 0.2mM to induce culture for 12 to 16h, and centrifuge to obtain β-glucosidase crude protein and detect enzyme activity.
[0041] In order to understand the expression level of recombinant proteins between single-copy and multi-copy expression vectors, expression vectors with different copy numbers were induced to express, and the enzyme activity of the crude protein after crushing was determined. Figure 2 As shown in the figure, the activity of β-glucosidase increases with the increase of copy number. When the number of copies reaches 3, the activity of the enzyme not only does not increase further, but decreases. Increasing the copy number helps to increase the expression of the protein, but it does not mean that increasing the copy number can increase the expression of the protein indefinitely.
[0042] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.
[0043] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.
Claims
1. A recombinant expression vector for increasing the number of gene copies, characterized in that: The expression vector is a vector for introducing multiple β-glucosidase genes into an Escherichia coli expression vector, and the nucleotide sequence of the β-glucosidase gene is SEQ ID No.
1.
2. A method for constructing a recombinant expression vector for increasing the gene copy number, characterized in that: The construction method comprises the following steps: S1. Using the plasmid pET-22b-Bgl2A containing the target gene as a template, three pairs of primers B1 and B2; B3 and B4; B5 and B6 were designed, and the β-glucosidase gene was cloned using the three pairs of primers to obtain three groups of β-glucosidase gene fragments; S2, first clone the β-glucosidase gene with primers B1 and B2 to obtain β-glucosidase gene-A, and then digest it with restriction endonuclease A; clone the β-glucosidase gene with primers B3 and B4 to obtain β-glucosidase gene-B, and then digest it with restriction endonuclease B; clone the β-glucosidase gene with primers B5 and B6 to obtain β-glucosidase gene-C, and then digest it with restriction endonuclease C; S3, digesting the pET-22b vector with NdeⅠ and HindⅢ, and then connecting with the digested fragments of β-glucosidase gene-A and β-glucosidase gene-B, and transforming into Escherichia coli BL21 to construct the recombinant vector pET-22b-Bgl2A-Bgl2A; S4. Use NdeⅠ and HindⅢ to cut the recombinant vector pET-22b-Bgl2A-Bgl2A to obtain Bgl2A-Bgl2A, connect it with the β-glucosidase gene-C and pET-22b vector after enzyme cutting, and transform Escherichia coli BL21 to obtain pET-22b-Bgl2A-Bgl2A-Bgl2A, which is a recombinant expression vector with increased gene copy number.
3. The method for constructing a recombinant expression vector for increasing gene copy number according to claim 2, characterized in that: The sequence of the primer B1 is SEQ ID NO.2, and the sequence of the primer B2 is SEQ ID NO.
3.
4. The method for constructing a recombinant expression vector for increasing gene copy number according to claim 1, characterized in that: The sequence of the primer B3 is SEQ ID NO.4; the sequence of the primer B4 is SEQ ID NO.
5.
5. The method for constructing a recombinant expression vector for increasing gene copy number according to claim 1, characterized in that: The sequence of the primer B5 is SEQ ID NO.6; the sequence of the primer B6 is SEQ ID NO.
7.
6. The method for constructing a recombinant expression vector for increasing gene copy number according to claim 1, characterized in that: The restriction endonuclease A is NdeⅠ and BamHI.
7. The method for constructing a recombinant expression vector for increasing gene copy number according to claim 1, characterized in that: Restriction endonucleases B are BamHI and HindIII.
8. The method for constructing a recombinant expression vector for increasing gene copy number according to claim 1, characterized in that: Restriction endonuclease C is HindⅢ and XHoⅠ.
9. Use of the recombinant expression vector for increasing gene copy number as claimed in claim 1 in the preparation and production of β-glucosidase.