Application of ELF3 gene in regulating and controlling growth of terminal bud of poplar

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application of an ELF3 gene in regulation and control of terminal bud growth of a poplar. Screening tests show that knockout of the ELF3 gene can achieve the technical effects of delaying growth stop and dormancy time of tree terminal buds and promoting tree growth under a short-day condition.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to the application of ELF3 gene in regulating the growth of poplar terminal buds. Background Art

[0002] Poplar is a perennial woody plant that grows in temperate zones. Dormancy is an important physiological phenomenon for poplars to cope with winter growth adversity. Studies have shown that short-day conditions in autumn induce the apical buds of poplars to stop growing, thereby establishing dormancy. Inhibiting seasonal dormancy in poplars can help promote the growth of poplars under artificially controlled environments, thereby increasing photosynthetic carbon fixation and biomass accumulation in trees.

[0003] The seasonal growth of poplar terminal buds is regulated by a number of genes, including the miR156-SPL module (PNAS, 2023, 120(48): e2311226120), the CO / FT module (Science, 2006, 312(5776): 1040-3), etc. Due to the complexity of this trait, more genes regulating the seasonal growth of terminal buds need to be identified, so as to provide more effective technical means for regulating the growth of terminal buds.

[0004] In order to solve the above problems, the present invention provides a new method for regulating the growth of poplar terminal buds. Summary of the invention

[0005] The invention aims to provide a method for regulating the growth of poplar terminal buds.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] The present invention provides an application of the ELF3 gene in regulating terminal bud growth and / or plant height and / or leaf number of poplar under short-day conditions, characterized in that the gene comprises any one of the following:

[0008] (1) A gene with a sequence shown in SEQ ID NO.1 or SEQ ID NO.2;

[0009] (2) a gene encoding the sequence shown in SEQ ID NO.3;

[0010] (3) The gene numbered Potri.006G233800 in the Populus gene database.

[0011] The present invention also provides a method for promoting the growth of terminal buds and / or the growth of plant height and / or the increase of leaf number of poplars under short-day conditions, characterized in that the method comprises the following steps:

[0012] (1) Knockout the above genes in poplar;

[0013] (2) Select plants that have increased terminal bud growth and / or plant height growth and / or leaf number under short-day conditions.

[0014] In some embodiments, the above-mentioned method of knocking out a gene is a gene editing method.

[0015] In some embodiments, the method for knocking out a gene is to use CRISPR / Cas gene editing method, and the selected target sequence is AGGCTTCATGTGAATGATAC and

[0016] ACTAGCGACTTAGCTCCTAC or AGTAGCGACTTAGCTCCTAC.

[0017] The present invention also provides a kit, characterized in that it comprises any one of the following:

[0018] (1) Able to simultaneously identify AGGCTTCATGTGAATGATAC and

[0019] RNA molecules with the target sequence shown as ACTAGCGACTTAGCTCCTAC or AGTAGCGACTTAGCTCCTAC;

[0020] (2) a DNA molecule encoding the RNA described in (1);

[0021] (3) A vector for expressing the RNA described in (1).

[0022] In some embodiments, the above-mentioned kit further includes a Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein.

[0023] In some embodiments, the RNA molecule is

[0024] GUAUCAUUCACAUGAAGCCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu

[0025] A combination of the sequences shown in ACUAGCGACUUAGCUCCUACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuuu.

[0026] The present invention also provides the use of the above-mentioned kit in promoting the growth of terminal buds and / or the growth of plant height and / or the increase of leaf number of poplars under short-day conditions.

[0027] The innovation and beneficial effects of the present invention are as follows: After screening and testing, the present invention found that knocking out the ELF3 gene can achieve the technical effect of delaying the growth cessation and dormancy time of tree apical buds and promoting tree growth under short-day conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Structural diagrams of four photoperiod genes and locations of gene editing targets.

[0029] Figure 2 Construction of gRNA expression cassettes targeting four photoperiod genes.

[0030] Figure 3 Map of the PKSE401-ELF4 vector.

[0031] Figure 4 Genotypes of ELF3-edited plants.

[0032] Figure 5 Genotypes of ELF4-edited plants.

[0033] Figure 6 Genotype of LUX-edited plants.

[0034] Figure 7 Genotypes of SPL9-edited plants.

[0035] Figure 8 Phenotypes of ELF3-edited plants. 717-4: receptor control; ID70-NR9, ID70-NR11, ID70-NR12, ID70-NR15: represent the 4 edited plants elf3-9, elf3-11, elf3-12, elf3-15, respectively. SD0W, SD2W, SD4W, SD6W: represent 0 weeks, 2 weeks, 4 weeks, and 6 weeks after short-day treatment, respectively.

[0036] Fig. 9 Phenotypes of ELF4-edited plants. 717-3: receptor control; ID168-NR1, ID168-NR2, ID168-NR7: represent the three edited plants elf4-1, elf4-2, elf4-7, respectively. SD0W, SD2W, SD4W: represent 0 weeks, 2 weeks, and 4 weeks after short-day treatment, respectively.

[0037] Fig.10 Phenotypes of LUX-edited plants. 717-3: receptor control; ID169-NR3, ID169-NR17, ID169-NR19: represent the three edited plants lux1-3, lux1-17, lux1-19, respectively. SD0W, SD2W, SD4W, SD6W: represent 0 weeks, 2 weeks, 4 weeks, and 6 weeks after short-day treatment, respectively.

[0038] Fig.11 Phenotypes of SPL9-edited plants. 717: receptor control; ID145-NR1, ID145-NR4, ID145-NR5, ID145-NR9: represent the four edited plants spl9-1, spl9-4, spl9-5, spl9-9, respectively. SD0W, SD4W: represent 0 weeks and 4 weeks after short-day treatment, respectively. DETAILED DESCRIPTION

[0039] The following definitions and methods are provided to better define this application and guide those of ordinary skill in the art in the practice of this application. Unless otherwise specified, terms are understood according to the conventional usage of those of ordinary skill in the relevant field. All patent documents, academic papers, industry standards and other public publications cited herein are incorporated herein by reference in their entirety.

[0040] In the present application, the words “comprise”, “include” or variations thereof should be understood as including other elements, numbers or steps in addition to the described elements, numbers or steps.

[0041] Unless otherwise indicated, nucleic acids are written from left to right in the 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" when used in the context of a specific nucleic acid refers to the nucleic acid containing the necessary information to direct the translation of the nucleotide sequence into a specific protein. Codons are used to represent information encoding proteins. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). Amino acids can be naturally occurring amino acids, and unless otherwise limited, known analogs of natural amino acids can be included that can function in a manner similar to naturally occurring amino acids.

[0042] In some embodiments, the nucleotide sequence of the present application can be changed to perform conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequence of the present application can be replaced without changing the amino acid sequence according to the disclosed monocot codon preference, for example, the codons encoding the same amino acid sequence can be replaced with codons preferred by monocot plants without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiment due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in the present application is replaced according to monocot plant preference codons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituent. Exemplary amino acid substitution groups with various aforementioned properties considered are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, and the other corresponding nucleotide sequences are present in a cloned genomic DNA fragment or cDNA fragment group (i.e., a genomic library or a cDNA library) from a selected organism. The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment or other oligonucleotide, and can be marked with a detectable group such as 32P or other detectable markers. Thus, for example, a hybridization probe can be prepared by marking a synthetic oligonucleotide based on the embodiment sequence. The method for preparing hybridization probes and constructing cDNA and genomic libraries is generally known in the art. The hybridization of the sequence can be carried out under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means the following conditions, i.e., under these conditions, relative to hybridization with other sequences, the probe will hybridize with its target sequence to a greater extent (e.g., at least 2 times, 5 times or 10 times of background) that can be detected.Stringent conditions are sequence-dependent and vary in different environments. By controlling the stringency of hybridization and / or controlling the washing conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mismatches to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are conditions in which the salt concentration is less than about 1.5M Na ions, typically about 0.01M to 1.0M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature conditions are: when used for short probes (e.g., 10 to 50 nucleotides), at least about 30°C; when used for long probes (e.g., greater than 50 nucleotides), at least about 60°C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at 37°C, and washing in 1× to 2× SSC (20×SSC=3.0MNaCl / 0.3M trisodium citrate) at 50°C to 55°C. Exemplary moderate stringency conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37°C, and washing in 0.5× to 1× SSC at 55°C to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37°C, and a final wash in 0.1× SSC at 60°C to 65°C for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, typically about 4 hours to about 12 hours. Specificity is usually dependent on post-hybridization washes, with the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) Anal. Biochem. 138: 267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L; where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "% formamide" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washing is usually performed at least until equilibrium is reached and a low level of hybridization background is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mismatch should reduce the Tm by about 1°C; thus, the Tm, hybridization, and / or washing conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≥90% identity are desired, the Tm can be reduced by 10°C.Typically, stringent conditions are selected to be about 5°C lower than the Tm of the specific sequence and its complementary sequence at a defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the Tm.

[0043] Unless otherwise indicated, all numbers used in the specification and claims expressing amounts of ingredients, reaction conditions, and the like are to be understood as modified in all instances by the term "about". As used herein, the term "about", when referring to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the specified amount in some embodiments, ±10% from the specified amount in some embodiments, ±5% from the specified amount in some embodiments, ±1% from the specified amount in some embodiments, ±0.5% from the specified amount in some embodiments, and ±0.1% from the specified amount in some embodiments, as such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Therefore, unless indicated to the contrary, the numerical parameters listed in the specification and the appended claims are approximate values ​​that may vary depending on the desired properties sought to be obtained by the subject matter disclosed in the present application.

[0044] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the inventive method, step or condition, all belong to the scope of the present application. If not otherwise specified, the embodiments are according to conventional experimental conditions, such as Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions of the manufacturer's instructions. If not otherwise specified, the chemical reagents used in the embodiments are conventional commercial reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0045] Example

[0046] Example 1 Knockout of Poplar Photoperiod Genes Using Gene Editing Technology

[0047] Since the seasonal growth of poplar terminal buds is affected by the photoperiod, the inventors screened genes that affect the seasonal growth of terminal buds from plant rhythm and photoperiod regulatory genes. The ELF3, ELF4, LUX, and SPL9 genes were initially selected for seasonal growth testing of poplar terminal buds. The homologous genes of the above genes in plants such as Arabidopsis and rice can affect flowering and photoperiod responses.

[0048] The inventors intend to use the CRISPR / Cas9 gene editing method to knock out the ELF3, ELF4, LUX, and SPL9 genes respectively, and investigate the growth status of poplar apical buds after gene knockout to clarify the impact of genes on apical bud growth.

[0049] The sequence of the gene was queried from the Phytozome database. The ELF3 gene has one allele in poplar (Potri.006G233800), and the inventors designed two knockout sites at the first exon. The ELF4 gene has three alleles in poplar (Potri.008G068200, Potri.001G251600, Potri.009G046400), and the inventors designed four knockout sites, of which gRNA1 and gRNA2 are on Potri.008G068200; gRNA3 is on Potri.001G251600, and gRNA4 is on Potri.001G251600 and Potri.009G046400. The LUX gene has two alleles in poplar (Potri.001G243600 and Potri.009G035000), and the inventors designed two knockout sites at the conserved sequences of the two genes. The SPL9 gene has three alleles in poplar (Potri.016G048500, Potri.002G142400, Potri.014G057800), and the inventors designed two knockout sites, of which gRNA1 is on Potri.016G048500; gRNA2 is on Potri.002G142400 and Potri.014G057800. Based on the knockout sites designed above, the inventors constructed one or multiple gRNA expression cassettes in series for ELF3, ELF4, LUX, and SPL9 (basic structure see Figure 2 ), these gRNA expression cassettes are then constructed together with the Cas9 expression cassette into a gene editing vector. The vector also contains a streptomycin selection marker gene for antibiotic selection during genetic transformation, as well as a basic vector skeleton (such as LB, RB, vector skeleton region, etc.).

[0050] The inventors transformed the above vectors into poplars respectively, wherein the vector construction used the GoldenGate cloning method to construct a targeting vector (BMC Plant Biol. 2014, 14: 327), and the specific construction method is as follows:

[0051] (1) PCR amplification of the target fragment of the homologous recombination targeting vector: After the effective knockout gRNA is identified, two pairs of primers are designed according to the selected gRNA site. The intermediate vector pCBC-DT1T2 is used as a template and phanta enzyme is used to perform PCR amplification of the target fragment of the homologous recombination targeting vector. The amplification procedure is pre-denaturation at 98°C for 3 min, followed by 30 cycles of reaction at 98°C for 15 s, 60°C for 30 s, and 72°C for 1 min, and finally extension at 72°C for 10 min.

[0052] (2) Connect the homologous recombination targeting vector target fragment to the final vector: Use ECO31I endonuclease and T7 ligase to perform enzyme digestion and ligation reaction in a PCR instrument at 37°C for 5 minutes (ECO31I digestion reaction), then react at 25°C for 10 minutes (T7 ligase ligation reaction), repeat this process for 30 cycles, and connect the amplified homologous recombination targeting vector target fragment to the final vector PKSE401 ( Figure 3 The final vector structure is shown using the ELF4 editing vector as an example).

[0053] (3) The constructed final vector is transformed into Escherichia coli, and several single clones are selected from the screening medium for colony PCR detection of positive strains. The detection bands are sequenced correctly to ensure that the sequence of the target fragment is correct and has no frameshift mutation.

[0054] (4) Amplify and culture the positive E. coli strain and extract the vector plasmid connected with the target fragment.

[0055] (5) The constructed vector was transferred into GV3101 Agrobacterium and colony PCR was performed to obtain positive strains, which were then transformed into the poplar recipient hybrid Populus alba×Populus tremula (717).

[0056] The genetic transformation system of poplar is mainly based on Science.2006,312(5776):1040-3. The main process is: prepare OD 600About 0.6 Agrobacterium was used to infect poplar petiole explants for 30-60 minutes. After washing, the explants were placed in the dark for about 2 days and then transferred to differentiation medium. The medium was changed every 14 days. After about 2 months, the explants were transferred to proliferation medium, and after about one month, the explants were transferred to rooting medium. The inoculation medium, suspension, and regeneration medium required for genetic transformation were all referred to Science. 2006, 312(5776): 1040-3. Each vector was used to infect 60 explants, and the plants with positive transformation were selected to analyze the editing of the target gene.

[0057] For target gene editing detection, primers are designed for each gRNA and 200bp upstream and downstream for amplification. The first step is to determine whether there is a large fragment missing. The second step is to design primers with adapters to amplify the sequence around the gRNA and use it for Hi-Tom sequencing http: / / www.hi-tom.net / hi-tom / index-CH.php. Each gRNA amplified PCR product is sequenced for 1000 reads. After the sequence is returned, the result file is sorted and the genotype before and after editing is compared and analyzed.

[0058] ELF3 obtained 4 target gene editing plants, namely elf3-9, elf3-11, elf3-12, elf3-15 ( Figure 4 ); ELF4 obtained three plants with successful target gene editing, namely elf4-1, elf4-2, and elf4-7 ( Figure 5 ); LUX obtained three plants with successful target gene editing, namely lux1-3, lux1-17, and lux1-19 ( Figure 6 ); SPL9 obtained 4 target gene editing plants, namely spl9-1, spl9-4, spl9-5, spl9-9 ( Figure 7 ).

[0059] Example 2 Investigation of the properties of gene-edited poplars

[0060] Plants in which the above target genes were successfully edited were selected to investigate the development of flower buds after short-day treatment.

[0061] After the gene-edited and control materials were cultured under long-day conditions (16h-18h light) for 2 months, they were transferred to short-day conditions (8h light and 16h dark). The growth environment temperature was 22°C when there was light and 20°C when there was no light. The growth indicators such as the initial plant height and the number of leaves increased under different treatments were investigated every 5 days. According to the scoring criteria for the growth status of the apical bud, the changes in the growth status of the apical bud were investigated to obtain the bud formation score (Bud set score) data.

[0062] Bud formation scores include: 3 points (score value 3): vigorous growth, characterized by active growth of the apical meristem, continuous production of new stipules and leaves, and stipules appearing vertically upward. 2 points: growth cessation, characterized by the apical tissue no longer producing new stipules and leaves, the stem nodes no longer elongating, and the apex presenting an inverted triangle shape. 1 point: bud formation, characterized by the stipules and embryonic leaves being completely wrapped, the bud scales appearing green, and the leaves appearing fully expanded. 0 points: the apical bud becomes hard and red and enters a deep dormant state.

[0063] The results showed that after knocking out the ELF3 and LUX genes, the apical bud growth of poplars was delayed, while the number of leaves and plant height increased ( Figure 8 and Fig.10 ), indicating that knocking out the ELF3 and LUX genes can achieve the technical effect of delaying the growth cessation and dormancy time of tree apical buds under short-day conditions and promoting tree growth. However, knocking out ELF4 and SPL9 cannot achieve the above technical effect ( Fig. 9 and Fig.11 ).

[0064] Among them, the genome sequence of ELF3 is shown in SEQ ID NO.1, the coding region sequence is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.3.

[0065] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Application of the ELF3 gene in regulating terminal bud growth and / or plant height and / or leaf number of poplar under short-day conditions, characterized in that: The gene includes any one of the following: (1) A gene with a sequence shown in SEQ ID NO.1 or SEQ ID NO.2; (2) a gene encoding the sequence shown in SEQ ID NO.3; (3) The gene numbered Potri.006G233800 in the Populus gene database.

2. A method for promoting terminal bud growth and / or plant height growth and / or leaf number increase in poplar under short-day conditions, characterized in that: The method comprises the following steps: (1) knocking out the gene described in claim 1 in poplar; (2) Select plants that have increased terminal bud growth and / or plant height growth and / or leaf number under short-day conditions.

3. The method according to claim 2, characterized in that The method for knocking out genes is to use a gene editing method.

4. The method according to claim 3, characterized in that The method for knocking out the gene is a CRISPR / Cas gene editing method, and the selected target sequences are AGGCTTCATGTGAATGATAC and ACTAGCGACTTAGCTCCTAC or AGTAGCGACTTAGCTCCTAC.

5. A kit, characterized in that: Includes any of the following: (1) RNA molecules capable of simultaneously recognizing the target sequences represented by AGGCTTCATGTGAATGATAC and ACTAGCGACTTAGCTCCTAC or AGTAGCGACTTAGCTCCTAC; (2) a DNA molecule encoding the RNA described in (1); (3) A vector for expressing the RNA described in (1).

6. The kit according to claim 5, characterized in that: The kit also includes Cas9 protein or a nucleic acid molecule encoding Cas9 protein or a vector expressing Cas9 protein.

7. The kit according to claim 5, characterized in that: The RNA molecule is GUAUCAUUCACAUGAAGCCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and A combination of the sequences shown in ACUAGCGACUUAGCUCCUACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuuu.

8. Use of the kit according to any one of claims 5 to 7 in promoting terminal bud growth and / or plant height growth and / or increase in leaf number of poplars under short-day conditions.

Images