Application of grain size and grain weight related protein in regulation and control of plant growth and seed growth

Abstract

The invention relates to the technical field of molecular biology, in particular to an application of a grain size and grain weight related protein in regulation and control of plant growth and seed growth, and the application of the grain size and grain weight related protein can increase the grain number per spike, the spike length, the seed size and the thousand seed weight of a plant. Experimental results show that the flag leaf length and the ear length of the transgenic plant with the strain knocked out are larger than those of a control plant; the seeds are larger than the wild type; the thousand seed weight is obviously higher than that of a wild type plant, and the grain area, the grain length and the grain width are obviously higher than those of a wild type Fielder material; the function of the gene TaSK41 is proved through a CRISPR-Cas9 system, an important gene resource is provided for plant molecular breeding, an effective means is provided for high yield of plants, meanwhile, the gene engineering technology plays an important role in improving the wheat yield and rapidly and efficiently cultivating high-yield wheat varieties, and a foundation is laid for application practice of wheat breeding.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to the application of proteins related to grain size and grain weight in regulating plant growth and seed growth. Background Art

[0002] As one of the three major staple crops in the world, wheat production is vital to human survival and development. Wheat production is jointly affected by the number of grains per ear, thousand-grain weight, and the number of ears per mu. As one of the three elements of yield, thousand-grain weight is determined by multiple factors such as grain length, grain width, and grain weight, and contributes the most to yield in breeding. Different wheat varieties have different grain sizes determined at the genetic level, which is a basic determining factor. Generally speaking, the larger the grain, the higher the grain weight. Therefore, genetic improvement of grain weight is an effective way to increase wheat yield. Cloning wheat grain weight-related genes, studying the molecular mechanism of its yield increase, and improving crop yield traits through genetic engineering are effective ways to breed high thousand-grain varieties.

[0003] Glycogen synthase kinase (GSK3 / SHAGGY-like) is a class of conserved serine / threonine protein kinases. There are many members in the plant GSK3 / SHAGGY-like gene family. Glycogen synthase kinase 3 (GSK3) belongs to the glycogen synthase kinase family. It is a protein kinase that is ubiquitous and very conserved in eukaryotes and plays a key role in various physiological processes such as intracellular signal transduction and metabolic regulation. TaSK41 kinase belongs to the glycogen synthase kinase 3 (GSK3) subfamily. The glycogen synthase kinase genes of different species have certain structural similarities, but there are also species-specific differences. Its protein sequence usually has a conserved protein kinase domain and other specific domains, which are essential for the activity and functional regulation of the kinase. For example, in Arabidopsis, the protein encoded by the AtSK41 gene contains domains similar to other GSK3 family members, which are involved in protein phosphorylation reactions and interactions with other proteins. In Eucalyptus grandis, the expression level of the EgrSK41 gene is relatively high in mature leaves, and its expression level gradually decreases with the maturity of internode secondary development, indicating that this gene is closely related to the secondary development of Eucalyptus grandis stems (see Hu Bing, Li Wenxin, Zeng Bingshan. Cloning and expression analysis of glycogen synthase kinase 3 EgrSK41 in Eucalyptus grandis [J]. Molecular Plant Breeding, 2022, 20(6):9.).

[0004] The protein encoded by TaSK41 is a member of the GSK family in wheat, but there is little research on its function in this field. The inventors found that it has the function of regulating wheat growth and grain growth during the research process, so they conducted in-depth research and found that the protein TaSK41 can regulate the number of grains per ear, seed size, seed thousand-grain weight, seed grain area, seed grain length, and seed grain width of plants, and has broad application prospects in wheat breeding and other aspects. Summary of the invention

[0005] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0006] The primary purpose of the present invention is to provide any of the following uses of a protein related to grain size and grain weight, or a substance that inhibits the expression of a gene encoding the protein related to grain size and grain weight, or a substance that reduces the activity of the protein related to grain size and grain weight, or knocks out the content of the protein related to grain size and grain weight:

[0007] (1) Increase the number of grains per ear;

[0008] (2) increase plant spike length;

[0009] (3) Increase plant seed size;

[0010] (4) Increase the thousand-grain weight of plant seeds;

[0011] (5) Plant breeding to increase yield;

[0012] The grain size and grain weight related proteins are as follows S1), S2) or S3):

[0013] S1) the amino acid sequence of the protein TaSK41-1A shown in SEQ ID NO.1, the protein TaSK41-4A shown in SEQ ID NO.3, the protein TaSK41-5B shown in SEQ ID NO.5 or the protein TaSK41-5D shown in SEQ ID NO.7;

[0014] S2) a protein having the same function as described in S1) after one or more amino acid residues are replaced and / or deleted and / or added;

[0015] S3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of S1) or S2).

[0016] The second object of the present invention is to provide any of the following applications of the biological material related to the protein related to grain size and grain weight:

[0017] (1) Increase the number of grains per ear;

[0018] (2) increase plant spike length;

[0019] (3) Increase plant seed size;

[0020] (4) Increase the thousand-grain weight of plant seeds;

[0021] (5) Plant breeding to increase yield;

[0022] The biological material is any one of the following A1) to A5):

[0023] A1) a gene TaSK41-1A encoding the protein TaSK41-1A of claim 1, wherein the nucleotide sequence thereof is shown in SEQ ID NO.2;

[0024] A2) a gene TaSK41-4A encoding the protein TaSK41-4A of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.4;

[0025] A3) a gene TaSK41-5B encoding the protein TaSK41-5B of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.6;

[0026] A4) a gene TaSK41-5D encoding the protein TaSK41-5D of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.8;

[0027] A5) an expression cassette containing any one of the genes described in A1) to A4);

[0028] A6) A recombinant vector containing any one of the genes described in A1)-A4); the recombinant vector is 16318-hGFP-35S::TaSK41;

[0029] A7) a recombinant vector containing the expression cassette described in A5);

[0030] A8) A recombinant microorganism containing any one of the genes described in A1) to A4);

[0031] A9) a recombinant microorganism containing the expression cassette described in A5);

[0032] A10) a recombinant microorganism containing the recombinant vector described in A6);

[0033] A11) A recombinant microorganism containing the recombinant vector described in A7).

[0034] Preferably, the plant is any one of m1) to m7):

[0035] m1) Plants;

[0036] m2) angiosperms;

[0037] m3) monocots;

[0038] m4) plants of the order Poaceae;

[0039] m5) Gramineae;

[0040] m6) Triticum plants;

[0041] m7) Wheat.

[0042] The third object of the present invention is to provide a method for increasing the number of grains per ear of a plant / increasing the ear length of a plant / increasing the seed size of a plant / increasing the thousand-grain weight of plant seeds / plant yield-increasing breeding, comprising: inhibiting or reducing the activity and / or content of the grain size and grain weight-related proteins S1), S2) and / or S3) in the recipient plant, or inhibiting the expression of the coding genes of the grain size and grain weight-related proteins S1), S2) and / or S3), or knocking out the coding genes of the grain size and grain weight-related proteins S1), S2) and / or S3) by CRISPR-Cas9 gene editing technology, thereby obtaining a target plant with increased number of grains per ear / seed size / thousand-grain weight / yield-increasing breeding compared with the recipient plant.

[0043] Preferably, the target plant is a target plant obtained by introducing a substance that inhibits or reduces the activity or content of the gene encoding the protein in S1), S2) and / or S3) into the recipient plant, thereby increasing the number of grains per ear / ear length / seed size / 1000-grain weight / yield-increasing breeding compared to the recipient plant.

[0044] Preferably, the substance is a nucleic acid molecule that inhibits or reduces the expression of genes encoding proteins related to grain size and grain weight) described in S1), S2) and / or S3), and the nucleic acid molecule is an sgRNA that expresses and targets genes encoding proteins related to grain size and grain weight described in S1), S2) and / or S3).

[0045] Preferably, the sgRNA includes sgRNA1 and sgRNA2, the target sequence of sgRNA1 corresponds to nucleotides 217-236 shown in SEQ ID NO.2, and the target sequence of sgRNA2 corresponds to nucleotides 277-296 shown in SEQ ID NO.2.

[0046] Preferably, the gene encoding the protein related to grain size and grain weight is knocked out by performing at least one of the following mutations:

[0047] 1) inserting a nucleotide T between nucleotides 233-234 of sequence 1 in the plant sequence list;

[0048] 2) The four nucleotides GTCG at positions 229-234 of Sequence 2 in the plant sequence list are missing;

[0049] 3) The nucleotide GTCG at position 974-975 of sequence 3 in the plant sequence list is missing;

[0050] 4) One nucleotide TC of nucleotides 1005-1008 of sequence 4 in the plant sequence list is missing;

[0051] 5) The nucleotides 947-948 of sequence 4 in the plant sequence list were deleted and a nucleotide G was inserted between them;

[0052] 6) A nucleotide G at position 232-233 of sequence 1 in the plant sequence list is missing.

[0053] Compared with the prior art, the beneficial effects of the present invention are as follows: the present invention provides the application of proteins related to grain size and grain weight in regulating plant growth and seed growth; specifically, it provides the application of protein TaSK41 in increasing the number of grains per spike, flag leaf length, spike length, seed size, thousand-grain weight of seeds, grain area of ​​seeds, grain length of seeds, and grain width of seeds; the experimental results show that the number of grains per spike of homozygous strains of gene-edited wheat task41-m1 and task41-m2 is significantly higher than that of wild-type Fielder plants. The flag leaf length and spike length of the transgenic plants of the knockout strains are greater than those of the control plants; the seed size of the edited plants task41-m1 and task41-m2 at 35 days of development is greater than that of the wild-type Fielder material; the thousand-grain weight of the gene-edited plants is significantly higher than that of the wild-type plants. In addition, the grain area, grain length, and grain width of the gene-knockout strains are significantly different from the wild type. The function of gene TaSK41 in regulating grain size and plant grain weight was confirmed through the CRISPR-Cas9 system, which not only provides important genetic resources for plant molecular breeding, but also provides an effective means for plant high yield. At the same time, it plays an important role in using genetic engineering technology to increase wheat yield and quickly and efficiently cultivate high-yield wheat varieties, laying the foundation for the application practice of wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 The expression patterns of the four partially homologous genes of the TaSK41 gene in the present invention in different tissues; wherein, AD are the expression patterns of the genes TaSK41-1A, TaSK41-4A, TaSK41-5B and TaSK41-5D in different tissues, respectively.

[0055] Figure 2 This is the subcellular localization of TaSK41-1A in the present invention.

[0056] Figure 3 The gene structure of TaSK41 and the location of gRNA1 and gRNA2 in the present invention.

[0057] Figure 4 These are the mutation types and two homozygous strains of TaSK41 gene editing in the present invention.

[0058] Figure 5 These are the statistical results of the phenotypic traits of the gene-edited TaSK41 wheat in the present invention; wherein, AF are the yield trait comparison results of two gene-edited homozygous mutants (task41-m1, task41-m2) and the wild type (WT) at maturity: plant height (A), flag leaf length (B), number of grains per ear (C), ear length (D), number of spikelets (E) and number of tillers (F).

[0059] Figure 6 It is a phenotypic diagram of the wheat grain size trait of the gene-edited Task41 in the present invention; A is the comparison result of the grain length of the knockout strains task41-m1, task41-m2 and the wild type (WT); B is the comparison result of the grain width of the knockout strains task41-m1, task41-m2 and the wild type (WT).

[0060] Figure 7 The statistical analysis results of the grain length, width and grain area of ​​the gene-edited TaSK41 mutant plants in the present invention; wherein A is the comparison result of the thousand-grain weight of the gene-edited strains task41-m1, task41-m2 and the wild type (WT). BD are the comparison results of the grain area (B), grain length (C) and grain width (D) of the transgenic wheat knockout strains task41-m1, task41-m2 and the wild type (WT). DETAILED DESCRIPTION

[0061] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0062] It should be noted that in the following examples, unless otherwise specified, the methods used are conventional methods and can be obtained from the literature;

[0063] It should be noted that, in the following examples, unless otherwise specified, the reagents and consumables used can be purchased from the market.

[0064] Example 1: Obtaining wheat TaSK41 protein and its encoding gene

[0065] RNA was extracted from the root tissue of wheat variety Jinmai 47, and the first-strand cDNA was synthesized using the ReverTraAceqPCRRTMasterMix reverse transcription kit. The high-fidelity enzyme KOD-FX and primers TaSK41-cDNA-F1 and TaSK41-cDNA-R1 were used for amplification to obtain a 1286 bp PCR product sequence. After purification and recovery, the product was -BluntCloningKit vector was used for ligation, and the ligation product was transformed into Escherichia coli DH5a competent cells. After bacterial liquid PCR identification, it was sent to Shanghai Bioengineering Priority Company for sequencing. The correctly sequenced gene was named TaSK41. After comparison with the Chinese Spring reference genome, it was found that the PCR product contained 4 cDNA sequences, indicating that TaSK41 contained four partially homologous genes, named TaSK41-1A, TaSK41-4A, TaSK41-5B and TaSK41-5D genes.

[0066] The full length of the TaSK41-1A gene is shown in SEQ ID No.2 (1528 bp), which contains no nucleotides from the 5' end, the nucleotides 1-1281 are an open reading frame (1281 bp), and the nucleotides 1282-1528 are 3UTR (247 bp); the sequence of the protein TaSK41-1A encoded by it is shown in SEQ ID No.1.

[0067] The full length of the TaSK41-4A gene is shown in SEQ ID No.4 (1588 bp), which contains no nucleotides from the 5' end, the nucleotides 1-1281 are an open reading frame (1281 bp), and the nucleotides 1282-1588 are 3UTR (307 bp); the sequence of the protein TaSK41-4A encoded by it is shown in SEQ ID No.3.

[0068] The full length of the TaSK41-5B gene is shown in SEQ ID No.6 (2272 bp), the nucleotides 1-742 from the 5' end are 5'UTR (742 bp), the nucleotides 743-2023 are open reading frame (1281 bp), and the nucleotides 1204-2272 are 3UTR (249 bp); the sequence of the protein TaSK41-5B encoded by it is shown in SEQ ID No.5.

[0069] The full length of the TaSK41-5D gene is shown in SEQ ID No.8 (2324 bp), the nucleotides 1-714 from the 5' end are 5'UTR (714 bp), the nucleotides 715-1995 are open reading frame (1281 bp), and the nucleotides 1282-2324 are 3UTR (329 bp); the sequence of the protein TaSK41-5D encoded by it is shown in SEQ ID No.7.

[0070] Example 2: Analysis of expression patterns of wheat TaSK41 in different tissues

[0071] Samples were collected from different tissues of wheat (Triticum aestivum L.) variety Jinmai 47 at different growth stages, including roots, stems, leaves and ears at heading stage, grains at 5d, 10d, 15d, 20d and 25d after flowering, and seed coats, ovaries and embryos at mid-grain filling stage. The samples were immediately frozen in liquid nitrogen and stored at -80°C for later use. Total RNA from the above liquid nitrogen-preserved samples was extracted by TRIZOL, and the first-strand cDNA was synthesized using the FastKing cDNA First-Strand Synthesis Kit (KR116). Real-time quantitative detection was used to detect the expression differences of the four partial homologous genes of TaSK41, TaSK41-1A, TaSK41-4ATaSK41-5B and TaSK41-5D in different tissues at different stages. The constitutively expressed GAPDH gene was used as an internal reference, and the designed primer sequences are as follows:

[0072] The primer sequences for detecting the expression of gene TaSK41-1A are as follows:

[0073] TaSK41-1A-RT-F: 5'-TCCAAACACCTGTCTACCTAAC-3' (positions 1131-1152 of SEQ ID NO: 1)

[0074] (SEQ ID No.9); TaSK41-1A-RT-R: 5'-GACGACTTCTGGAGGTATACTG-3' (the reverse complementary sequence of positions 1200-1218 of SEQ ID No.1) (SEQ ID No.10);

[0075] The primer sequences for detecting the expression of gene TaSK41-4A are as follows:

[0076] TaSK41-4A-RT-F: 5′-TGAGAGATCCAAACACCCGT-3′ (positions 1124-1143 of SEQ ID No. 2) (SEQ ID No. 11);

[0077] TaSK41-4A-RT-R: 5′-CAGAGACCAGACCCCAAACA-3′ (the reverse complementary sequence of positions 1313-1332 of SEQ ID No. 2) (SEQ ID No. 12);

[0078] The primer sequences for detecting the expression of gene TaSK41-5B are as follows:

[0079] TaSK41-5B-RT-F: 5′-CCTCTTCCACCCCTCTTCAA-3′ (positions 1901-1920 of SEQ ID No. 3) (SEQ ID No. 13);

[0080] TaSK41-5B-RT-R: 5′-ACAAGCTTCCCTCCAGAGTC-3′ (the reverse complementary sequence of positions 2068-2087 of SEQ ID No. 3) (SEQ ID No. 14);

[0081] The primer sequences for detecting the expression of gene TaSK41-5D are as follows:

[0082] TaSK41-5D-RT-F: 5′-TAGCTTTGTGTGGGTGCAAG-3′ (positions 2072-2091 of SEQ ID No. 4) (SEQ ID No. 15);

[0083] TaSK41-5D-RT-R: 5′-GCCTAAAGGCATTGGTCGTA-3′ (the reverse complementary sequence of positions 2252-2271 of SEQ ID No. 4) (SEQ ID No. 16);

[0084] The primer sequences for detecting the expression of the gene GAPDH are as follows:

[0085] TaGAPDH-RT-F: 5'-GACCCAGACAACTCGCAAC-3' (SEQ ID No. 17)

[0086] TaGAPDH-RT-R: 5'-GGAATCCATGACCACCTAC-3' (SEQ ID No. 18)

[0087] The experiment was set up with three replicates.

[0088] Real-time quantitative results such as Figure 1 As shown in the figure, TaSK41-1A, TaSK41-4A, TaSK41-5D, and TaSK41-5B were expressed more highly in 15-day ovaries and 15-day seed coats than in other tissues, followed by panicles and seeds at 5 days of development. As the grain development process progresses, the expression levels of the four partial homologous genes in seeds gradually decrease.

[0089] Example 3: Subcellular localization of TaSK41

[0090] (I) Construction of recombinant vector

[0091] 1. Extract cDNA from Jinmai 47 wheat at the heading stage as a template, and use primers composed of M and N to amplify the TaSK41-1A gene without the stop codon.

[0092] L: 5'-ATGGCGTATTCTGGGCAGAG-3' (SEQ ID No. 19)

[0093] R: 5'-GGTGCGGAGCGCCATGAACA-3' (SEQ ID No. 20)

[0094] 2. Using the PCR product of step 1 as a template, use KOD-FX high-fidelity enzyme and a primer pair consisting of SF and SR to perform PCR amplification to obtain a PCR amplification product.

[0095] SF: 5'-TGCCTGCAGGTCGAC GATATC ATGGCGTATTCTGGGCAGAG-3' (the underline marks EcoRV, and the following sequence is the 1st to 20th position of sequence 1 in the sequence list) (SEQ ID No. 21)

[0096] SR: 5'-GCCCTTGCTCACCAT GGATCC GGTGCGGAGCGCCATGAACA-3': (the underline marks BamHI, and the following sequence is the reverse interaction sequence of position 1259-1278 of sequence 1 in the sequence list) (SEQ ID No. 22)

[0097] 3. Double-digest the plasmid 16318-hGFP with restriction endonucleases EcoRV and BamHI, purify and recover the digestion products, and obtain a linearized vector backbone.

[0098] 4. The digestion product of step 3 and the purified and recovered product of step 2 were connected using homologous recombination infusion enzymes to obtain the recombinant vector 16318-hGFP-35S::TaSK41. According to the sequencing results, the recombinant vector 16318-hGFP-35S::TaSK41 is described as follows, and the DNA molecule represented by the nucleotides 1-1278 from the 5' end of sequence 1 is replaced by a small fragment of the sequence EcoRV and BamHI digestion sites of the 16318-hGFP-35S vector. The recombinant vector 16318-hGFP-35S::TaSK41 expresses the TaSK41 fusion protein.

[0099] (II) Localization of TaSK41 in wheat protoplasts

[0100] Jinmai 47 wheat seeds with full grains were selected, vernalized at 4°C for two days, added with distilled water, and cultured in a light incubator for about 10 days. Wheat leaves were taken to prepare protoplasts for subcellular localization of TaSK41.

[0101] Follow the steps below:

[0102] 1. Take 20 wheat leaves of the same growth and place them on filter paper. Cut the leaf bundle into thin strips with a width of 0.5-1 mm. Put the cut strips into a culture dish, add 30 ml of mannitol solution, and place them in the dark at room temperature for 10 minutes.

[0103] 2. Collect the leaf strips with a sterile 40-micron nylon mesh and gently squeeze out the remaining liquid to prevent changes in the osmotic pressure of the lytic enzyme solution;

[0104] The collected leaves were placed in the enzymatic hydrolysis solution and enzymatically hydrolyzed for 3-5 h at 28°C and 60 rpm in the dark. After enzymatic digestion, an equal amount of W5 solution was added to the flask;

[0105] 3. Wet a 200-500 mesh sieve with W5 solution, then filter the mixture into a 50 ml round-bottom centrifuge tube and centrifuge at 1500 rpm for 5 min.

[0106] 4. Discard the supernatant, resuspend the precipitate with 5 ml W5 solution, centrifuge again at 100 g for 2 min, discard the supernatant, resuspend the precipitate with 2 ml W5 solution and let it stand on ice for 30 min;

[0107] 5. Remove as much supernatant as possible with a pipette without damaging the cells, gently resuspend the protoplasts with 5 ml of pre-cooled MMG solution, check the integrity and concentration of the protoplasts in the MMG solution under a microscope, and adjust the concentration to a final value of 2.5X10 6 cells per ml.

[0108] 6. Add 10 μL of the recombinant vector pJIT163-35S::TaSK41::GFP to a sterile 2 ml round-bottom microcentrifuge tube. Carefully add 200 μL of protoplasts to the tube and mix gently to fully mix the protoplasts and plasmid.

[0109] 7. Slowly add 250 μL of PEG solution to the mixture of plasmid and protoplasts, gently invert to mix, and then incubate the test tube at room temperature in the dark for 30 minutes.

[0110] 8. Slowly add 880 μL of W5 solution to the test tube to terminate the transformation reaction. Centrifuge at 80 x g for 3 minutes at room temperature.

[0111] 9. Carefully aspirate the supernatant and resuspend the protoplasts with 1 ml of W5 solution.

[0112] 10. Transfer the protoplasts to a 6-well cell culture plate using a cut pipette tip. After incubation at room temperature in the dark for at least 16 hours, GFP fluorescence can be detected under a fluorescence microscope.

[0113] (1) Enzyme hydrolysate

[0114]

[0115] (2)W5 solution

[0116] NaCl 4.50g

[0117] CaCl2 2H2O 9.19g

[0118] KCl 0.19g

[0119] MES 0.21g

[0120] Add the above drugs to 400 ml ultrapure water and adjust the pH to 5.7 with 1 mol NaOH. Add additional ultrapure water to 500 ml and filter into a sterile container using a 0.22 micron filter.

[0121] (3)MMG solution

[0122] Mannitol 0.8mol 5ml

[0123] MgCl2 1mol 0.15ml

[0124] MES 0.2mol 0.2ml

[0125] The above solution was placed in a sterile container and additional ultrapure water was added to the container to 10 ml before filter sterilization using a 0.22 micron filter.

[0126] The results are as follows Figure 2 As shown, laser confocal microscopy was used to observe that GFP was distributed in the cytoplasm, cell membrane and nucleus, while the TaSK41-GFP fusion protein was mainly localized in the cytoplasm and nucleus.

[0127] Example 4: Phenotypic analysis of wheat TaSK41 gene knockout strains

[0128] Design of gRNA for TaSK41 gene: Primers were designed based on the cDNA and gDNA of four partial homologous genes of wheat TaSK41 gene, TaSK41-1A, TaSK41-4A, TaSK41-5B and TaSK41-5D. According to the conserved sequence of TaSK41 on four chromosomes, two sgRNA sequences were designed at the second and third exons respectively using the website http: / / crispr.dbcls.jp / , named sgRNA1 and sgRNA2 ( Figure 3 sgRNA1 is nucleotides 217-236 shown in SEQ ID No.2, and sgRNA2 is nucleotides 277-296 shown in SEQ ID No.2.

[0129] gRNA1: ACCACAATCCGTGGTCGAAA (SEQ ID No. 23)

[0130] gRNA2: GTGGTTGGAACTGGTTCTTT (SEQ ID No. 24)

[0131] Construction of TaSK41 gene editing vector: Using wheat U3 promoter to drive sgRNA expression. First, using the intermediate vector MTIT2 as a template and the sequence containing sgRNA as four primers, KOD-FX was used to amplify the target fragment containing two gRNAs and part of the MTIT2 sequence, and the fragment was connected to the final Crispr / Cas9pBUE411 (TaU3p) vector using BsaI enzyme.

[0132] Connection system:

[0133] PCR fragment (964 bp) (50 ng) 2μL pBUE414 (200 ng) 1μL 10xNEBT4Buffer 1.5μL CutSmartBuffer 1.5μL BsaI(NEB) 1μL T4Ligase(NEB) / High concentration 1μL ddH2O 6μL Total 15μL

[0134] The expression vector was transferred into Agrobacterium: the constructed Crispr / Cas9 recombinant plasmid was added to EHA105 competent cells, placed on ice for 30 minutes, quick-frozen in liquid nitrogen for 5 minutes, incubated at 37°C for 5 minutes, placed on ice for 2 minutes, added to YEP medium containing rifampicin, and incubated at 28°C for 24 hours. Single colonies were selected for colony PCR identification. Positive clones were shake-cultured for subsequent infection of wheat callus.

[0135] Agrobacterium-mediated genetic transformation of wheat: Take immature embryos of wheat 14 days after flowering, disinfect with 70% ethanol for 1 min, 1% NaClO for 10 min, and rinse with distilled water 3 times. Separate immature embryos from immature seeds. Refer to the method of WANG et al. (2017) for Agrobacterium-mediated genetic transformation of wheat. Transfer into the callus tissue of wheat Fielder material by Agrobacterium-mediated method, and obtain T0 generation transgenic positive strains through resistance screening, differentiation, rooting, and seedling strengthening.

[0136] Detection of gene editing sites: Take 2-3 cm long leaves of edited plants and controls, and use the CTAB method to extract DNA from wild type and each edited strain. At the same time, design genome-specific primers at both ends of the TaSK41 editing site. The primers for the gRNA1 detection site are J1 and J2, and the primers for the gRNA2 detection site are J3 and J4.

[0137] J1: 5'-GGAGTGAGTACGGTGTGCGATTCTGGTTCTGAAGCTGG-3' (SEQ ID No. 25);

[0138] J2: 5'-GAGTTGGATGCTGGATGGCTGTTTCATTAACCACCATATC-3' (SEQ IDNo. ​​26):

[0139] J3: 5'-GGAGTGAGTACGGTGTGCCTGATATGGTGGTTAATGAAAC-3' (SEQ ID No. 27);

[0140] J4: 5'-GAGTTGGATGCTGGATGGCTCCCGTTTCTCGACATTTG-3' (SEQ ID No. 28):

[0141] Using the DNA of the T0 transgenic plant as a template, the J1 and J2 primer pairs were used to amplify the 300bp sequence at both ends of gRNA1, and the J3 and J4 primer pairs were used to amplify the sequence at both ends of gRNA2. The PCR amplification reaction system can be specifically: template DNA 2μL (200ng), 2×TaqMasterMix 15μL, upstream and downstream primers (10umol / L) 2μL, supplemented with ddH2O to a total volume of 50μL; the reaction conditions are: 95℃ pre-denaturation 5min; 95℃ denaturation 30sec, 53℃ annealing 20sec, 72℃ extension 30sec, a total of 35 cycles. The PCR amplification products were separated by electrophoresis on 1% agarose gel. The products with amplified bands were detected, and the mutation sites of TaSK41 on different chromosomes of T0 plants were analyzed using the Hi-TOM gene editing detection kit (Novogene, Beijing), and the transgenic strains in which the TaSK41 gene was successfully edited were obtained.

[0142] The results are as follows Figure 4 As shown: Wheat transgenic lines with different editing types were obtained. Among them, there were two lines in which TaSK41 was knocked out on chromosomes 1A, 4A, 5B and 5D. According to the Hi-tom test results, the gene mutation sites were specifically analyzed. The editing types of the TaSK41 gene on chromosomes 1A, 4A, 5B and 5D at the gRNA1 target site were 1bp insertion, 4bp deletion, 1bp deletion, and 1bp insertion, respectively. At the gRNA2 target site, the editing types on chromosomes 4A and 5D were 1bp insertion and 2bp deletion, respectively. Combining the editing types of gRNA1 and gRNA2, the task41-m1 mutant underwent frameshift mutations on chromosomes 1A, 4A, 5B and 5D.

[0143] Another type of gene editing, task41-m2, has 1bp deletions on chromosomes 1A, 4A, 5B, and 5D at the target site of gRNA1, all of which are base G deletions, causing frameshift mutations in the Task41 gene and terminating translation after encoding 252 amino acids. The editing types of task41-m2 on chromosomes 5B and 5D at the target site of gRNA2 are 1bp and 2bp deletions, respectively ( Figure 4 ).

[0144] Phenotypic identification of transgenic wheat: Wild-type Fielder and gene-edited task41 mutant wheat were planted in a greenhouse. The length of mature wheat spikes, number of spikelets, number of tillers, thousand-grain weight, and yield per plant were measured. The grain length, grain width, grain area, and grain weight were measured using the Wanshen SC-G automatic seed analyzer. Twenty seeds were sown for each strain, and the experiment was repeated three times, and the results were averaged.

[0145] Figure 5 AF are plant height, flag leaf length, number of grains per ear, ear length, number of spikelets, and number of tillers of the control and knockout lines, respectively. Figure 5 The results showed that the number of grains per ear in the homozygous lines of task41-m1 and task41-m2 gene-edited wheat was significantly higher than that in the wild-type Fielder plants. The flag leaf length and ear length of the transgenic plants of the knockout lines were longer than those of the control plants. There were no significant differences in plant height, spikelet number and tiller number between the gene-edited plants task41-m1 and task41-m2 and the wild-type.

[0146] The size of mature seeds of the edited plants task41-m1 and task41-m2 was compared. Figure 6 As shown, the seed size of the gene-edited plants task41-m1 and task41-m2 at 35 days of development was larger than that of the wild-type Fielder material.

[0147] like Figure 7 As shown in the figure, at maturity, the thousand-grain weight of the gene-edited plants task41-m1 and task41-m2 was significantly higher than that of the wild-type plants. In addition, the grain area, grain length and grain width of the gene knockout lines task41-m1 and task41-m2 were significantly higher than those of the wild-type.

[0148] In summary, the present invention provides the application of proteins related to grain size and grain weight in regulating plant growth and seed growth, specifically in increasing the number of grains per ear, flag leaf length, ear length, seed size, thousand-grain weight of seeds, grain area of ​​seeds, grain length of seeds, and grain width of seeds; experimental results show that the number of grains per ear of homozygous strains of gene-edited wheat task41-m1 and task41-m2 is significantly higher than that of wild-type Fielder plants. The flag leaf length and ear length of the transgenic plants of the knockout strain are longer than those of the control plants; the seed size of the gene-edited plants task41-m1 and task41-m2 at 35 days of development is larger than that of the wild-type Fielder material; the thousand-grain weight of the gene-edited plants is significantly higher than that of the wild-type plants. In addition, the grain area, grain length and grain width of the gene knockout strain were significantly higher than those of the wild type; the function of the gene TaSK41 in regulating grain size and plant grain weight was confirmed through the CRISPR-Cas9 system, which not only provides important genetic resources for plant molecular breeding, but also provides an effective means for plant high yield. At the same time, it plays an important role in using genetic engineering technology to increase wheat yield and quickly and efficiently cultivate high-yield wheat varieties, laying the foundation for the application practice of wheat breeding.

[0149] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. Any of the following uses of a protein related to grain size and grain weight, or a substance that inhibits the expression of a gene encoding the protein related to grain size and grain weight, or a substance that reduces the activity of the protein related to grain size and grain weight, or knocks out the content of the protein related to grain size and grain weight: (1) Increase the number of grains per ear; (2) increase plant spike length; (3) Increase plant seed size; (4) Increase the thousand-grain weight of plant seeds; (5) Plant breeding to increase yield; The grain size and grain weight related proteins are as follows S1), S2) or S3): S1) the amino acid sequence of the protein TaSK41-1A shown in SEQ ID NO.1, the protein TaSK41-4A shown in SEQ ID NO.3, the protein TaSK41-5B shown in SEQ ID NO.5 or the protein TaSK41-5D shown in SEQ ID NO.7; S2) a protein having the same function as described in S1) after one or more amino acid residues are replaced and / or deleted and / or added; S3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of S1) or S2).

2. Any of the following uses of the biological material related to the protein associated with grain size and grain weight according to claim 1: (1) Increase the number of grains per ear; (2) increase plant spike length; (3) Increase plant seed size; (4) Increase the thousand-grain weight of plant seeds; (5) Plant breeding to increase yield; The biological material is any one of the following A1) to A5): A1) a gene TaSK41-1A encoding the protein TaSK41-1A of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.2; A2) a gene TaSK41-4A encoding the protein TaSK41-4A of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.4; A3) a gene TaSK41-5B encoding the protein TaSK41-5B of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.6; A4) a gene TaSK41-5D encoding the protein TaSK41-5D of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.8; A5) an expression cassette containing any one of the genes described in A1) to A4); A6) A recombinant vector containing any one of the genes described in A1)-A4); the recombinant vector is 16318-hGFP-35S::TaSK41; A7) a recombinant vector containing the expression cassette described in A5); A8) A recombinant microorganism containing any one of the genes described in A1) to A4); A9) a recombinant microorganism containing the expression cassette described in A5); A10) a recombinant microorganism containing the recombinant vector described in A6); A11) A recombinant microorganism containing the recombinant vector described in A7).

3. The use according to claim 1 or 2, characterized in that: The plant is any one of m1) to m7): m1) Plants; m2) angiosperms; m3) monocots; m4) plants of the order Poaceae; m5) Gramineae; m6) Triticum plants; m7) Wheat.

4. A method for increasing the number of grains per plant ear / increasing the ear length of a plant / increasing the size of a plant seed / increasing the thousand-grain weight of a plant seed / increasing plant yield breeding, comprising: By inhibiting or reducing the activity and / or content of the grain size and grain weight related proteins described in S1), S2) and / or S3) of claim 1 in the recipient plant, or inhibiting the expression of the genes encoding the grain size and grain weight related proteins described in S1), S2) and / or S3) of claim 1, or knocking out the genes encoding the grain size and grain weight related proteins described in claim 1 by CRISPR-Cas9 gene editing technology, the target plant with increased number of grains per ear / seed size / 1000-grain weight / yield-increasing breeding compared with the recipient plant is obtained.

5. The method according to claim 4, characterized in that The target plant is a target plant obtained by introducing a substance that inhibits or reduces the activity or content of the gene encoding the protein described in S1), S2) and / or S3) in claim 1 into the recipient plant, thereby increasing the number of grains per ear / ear length / seed size / 1000-grain weight / yield-increasing breeding compared to the recipient plant.

6. The method according to claim 5, characterized in that The substance is a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein related to grain size and grain weight described in S1), S2) and / or S3) of claim 1, and the nucleic acid molecule is an sgRNA that expresses and targets the gene encoding the protein related to grain size and grain weight described in S1), S2) and / or S3) of claim 1.

7. The method according to claim 6, characterized in that The sgRNA includes sgRNA1 and sgRNA2, the target sequence of sgRNA1 corresponds to nucleotides 217-236 shown in SEQ ID NO.2, and the target sequence of sgRNA2 corresponds to nucleotides 277-296 shown in SEQ ID NO.

2.

8. The method according to claim 7, characterized in that Knock out the gene encoding the protein related to grain size and grain weight described in claim 1 and perform at least one of the following mutations: 1) inserting a nucleotide T between nucleotides 233-234 of sequence 1 in the plant sequence list; 2) The four nucleotides GTCG at positions 229-234 of Sequence 2 in the plant sequence list are missing; 3) One nucleotide G at position 974-975 of sequence 3 in the plant sequence list is missing; 4) The two nucleotides TC at positions 1005-1008 of sequence 4 in the plant sequence list are missing; 5) The nucleotides 947-948 of sequence 4 in the plant sequence list were deleted and a nucleotide G was inserted between them; 6) A nucleotide G at position 232-233 of sequence 1 in the plant sequence list is missing.

Images