Novel Ad5 / 35 chimeric oncolytic adenovirus vector as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biological medicine, in particular to a novel Ad5 / 35 chimeric oncolytic adenovirus vector as well as a preparation method and application thereof. The recombinant plasmid comprises a type-5 adenovirus plasmid skeleton and a hexon nucleotide sequence, wherein the hexon nucleotide sequence comprises a nucleotide sequence for coding a hypervariable region of type-5 adenovirus hexon protein. The hexon protein hypervariable region amino acid sequence of the novel Ad5 / 35 chimeric oncolytic adenovirus vector comprises amino acid sequences as shown in SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7. The invention further discloses a preparation method of the novel Ad5 / 35 chimeric oncolytic adenovirus vector. The adenovirus vector can be applied to preparation of cancer treatment preparations. The adenovirus vector can effectively resist the influence of a pre-stored neutralizing antibody, and has good anti-tumor capability.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a novel Ad5 / 35 chimeric oncolytic adenovirus vector, a preparation method and an application thereof. Background Art

[0002] Oncolytic viruses (OV) are a type of virus that can selectively infect and kill tumor cells. In recent years, they have gradually become an important means of anti-tumor immunotherapy. Following surgery, radiotherapy, chemotherapy and targeted therapy, they have been widely studied and a variety of drugs have been approved in Europe, the United States and China. Among them, adenovirus vectors have received special attention due to their wide application and significant therapeutic potential, and currently occupy a dominant position in oncolytic virus products in clinical trials.

[0003] Adenovirus is a non-enveloped, non-integrated double-stranded DNA virus with a genome length ranging from 30 to 38 kilobase pairs (kb) and a virus particle diameter of about 80 to 110 nanometers. The outer shell of adenovirus particles is an icosahedral structure composed of 240 hexons and 12 pentons, showing its morphological complexity and specificity. In particular, type 5 adenovirus vectors are particularly prominent in the field of gene therapy. A variety of drugs based on type 5 adenovirus vectors have been successfully developed and approved for marketing. These drugs have shown significant therapeutic effects in cancer treatment and vaccine development. Through specific gene modification technology, type 5 adenovirus vectors can accurately encode and deliver a variety of immune-related genes, activate host immune responses, and accurately target tumor cells.

[0004] However, oncolytic adenovirus therapy still faces many challenges in clinical application, including limitations in administration methods, the presence of pre-existing adenovirus neutralizing antibodies, and unclear host immune response mechanisms.

[0005] In particular, the application of adenovirus type 5 vectors is limited by the high proportion of pre-existing neutralizing antibodies, especially after the widespread vaccination of the new crown vaccine, the immune response to adenovirus type 5 is more significant. The pre-existing antiviral immunity in cancer patients is considered to be one of the key factors limiting the efficacy of oncolytic virus therapy, which has led to the poor effect of existing adenovirus type 5 vectors and severely limited application scope. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a novel Ad5 / 35 chimeric oncolytic adenovirus vector, a preparation method and an application thereof.

[0007] The technical solution of the present invention to solve the above technical problems is as follows:

[0008] The invention provides a recombinant plasmid, which comprises a type 5 adenovirus plasmid skeleton and a hexon nucleotide sequence, wherein the hexon nucleotide sequence comprises a nucleotide sequence for encoding a type 35 adenovirus hexon protein hypervariable region.

[0009] Furthermore, the hexon nucleotide sequence includes the nucleotide sequences shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.

[0010] Further, the hexon nucleotide sequence includes hypervariable region 1, hypervariable region 2 and hypervariable region 5, the nucleotide sequence shown in SEQ ID No.1 is located in the hypervariable region 1, the nucleotide sequence shown in SEQ ID No.2 is located in the hypervariable region 2, and the nucleotide sequence shown in SEQ ID No.3 is located in the hypervariable region 5.

[0011] The present invention also provides a novel Ad5 / 35 chimeric oncolytic adenovirus vector, which is prepared using the above-mentioned recombinant plasmid.

[0012] Furthermore, the amino acid sequence of the hexon protein hypervariable region of the novel Ad5 / 35 chimeric oncolytic adenovirus vector includes the amino acid sequences shown in SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7.

[0013] Furthermore, the nucleotide sequence of the novel Ad5 / 35 chimeric oncolytic adenovirus vector is shown in SEQ ID No.4.

[0014] The present invention also provides a method for preparing the novel Ad5 / 35 chimeric oncolytic adenovirus vector as described above, comprising the following steps:

[0015] S1, synthesizing the recombinant plasmid containing the hexon nucleotide sequence;

[0016] S2, the type 5 adenovirus plasmid backbone and the recombinant plasmid of step S1 are used to obtain the novel Ad5 / 35 chimeric oncolytic adenovirus vector by homologous recombination;

[0017] S3. Perform enzyme digestion, transfection, amplification and purification on the novel Ad5 / 35 chimeric oncolytic adenovirus vector.

[0018] Furthermore, the homologous recombination is performed by co-transforming the linearized adenovirus type 5 plasmid backbone and the amplified hexon sequence into the homologous recombination competent BJ5183.

[0019] The present invention also provides the use of the novel Ad5 / 35 chimeric oncolytic adenovirus vector as described above in the preparation of a cancer treatment preparation, wherein the cancer treatment preparation is selected from drugs, pharmaceutical raw materials, vaccines, targeted inhibitors, gene therapy vectors, and biological preparations.

[0020] The present invention also provides a preparation for treating cancer, wherein the preparation comprises the above-mentioned recombinant plasmid and / or the above-mentioned novel Ad5 / 35 chimeric oncolytic adenovirus vector.

[0021] The beneficial effects of the present invention are:

[0022] (1) The novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention uses the HVR region of adenovirus type 35 to replace the HVR region of adenovirus type 5, which can effectively resist the influence of pre-existing neutralizing antibodies;

[0023] (2) The novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention has stronger resistance and more efficient gene delivery effect in the presence of neutralizing antibodies;

[0024] (3) The novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention can effectively resist the effects of neutralizing antibodies in vitro and exhibit superior anti-tumor ability;

[0025] (4) The novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention has good safety, is suitable for use in preparations for treating cancer, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention. In Example 3, a comparison chart of the cell viability of oAd5 / 35-H (1+2+5) on different tumor cell lines; Figure 1 A in the middle is A549 cell line, Figure 1 B in the middle is the PANC1 cell line, Figure 1 C in the middle is He la cell line, Figure 1 D in the middle is the HepG2 cell line, Figure 1 Middle E is SK-OV-3 cell line, Figure 1 Middle F is the MKN45 cell line;

[0027] Figure 2 This is a novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention. In Example 4, after each oncolytic adenovirus was co-incubated with the Ad5 neutralizing antibody and infected different cells, a comparison chart of the relative expression levels of the viral Hexon gene was obtained. Figure 2 A in the middle is HEK293 cells, Figure 2 Middle B is A549 cells;

[0028] Figure 3 This is a novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention. In Example 4, after each oncolytic adenovirus was co-incubated with Ad5 neutralizing antibodies (NABs), HEK293 cells were infected, and the expression ratio of EGFP-positive cells detected was compared;

[0029] Figure 4 This is a novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention. In Example 4, after each oncolytic adenovirus was co-incubated with the Ad5 neutralizing antibody, the cell killing ability was detected after infecting A549 or PANC-1 cells;

[0030] Figure 5 This is a novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention. In Example 5, the anti-tumor effect diagram of passive immunization of nude mice in different experimental groups is shown. Figure 5 A in the middle is the graph of the weight change of mice. Figure 5 Middle B is a graph showing the changes in mouse tumor volume. DETAILED DESCRIPTION

[0031] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0032] The recombinant plasmid of the present invention is used to prepare a novel Ad5 / 35 chimeric oncolytic adenovirus vector. The recombinant plasmid includes a type 5 adenovirus plasmid backbone and a hexon nucleotide sequence, wherein the hexon nucleotide sequence includes a nucleotide sequence for encoding a type 35 adenovirus hexon protein hypervariable region.

[0033] The novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention replaces the HVR region of adenovirus type 5 with the HVR region of adenovirus type 35, can effectively resist the influence of pre-existing neutralizing antibodies, and greatly enhances the application potential of oncolytic adenovirus in the preparation of preparations for treating cancer.

[0034] Specifically, the principle of the present invention is that immune mechanisms such as neutralizing antibodies (NAbs) significantly reduce the anti-tumor effect of oncolytic viruses by neutralizing viral infection. The hexon protein (Hexon) of adenovirus is highly conserved between serotypes, and the hypervariable region (HVR) is the main difference between different serotypes. Most serotype-specific NAbs mainly target hexons and fibrin, and hexon-specific NAbs are the most common and effective in vivo. The epitopes recognized by these NAbs are concentrated in the hypervariable domain of the hexon protein, which is located on the exposed loop on the capsid surface. The seroprevalence of Ad35 in the population is low, and the HVR region of type 5 adenovirus is replaced by the HVR region of Ad35, which can effectively improve the anti-tumor effect of oncolytic viruses.

[0035] Preferably, the hexon nucleotide sequence includes the nucleotide sequences shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.

[0036] Preferably, the hexon nucleotide sequence includes hypervariable region 1, hypervariable region 2 and hypervariable region 5, the nucleotide sequence shown in SEQ ID No.1 is located in the hypervariable region 1, the nucleotide sequence shown in SEQ ID No.2 is located in the hypervariable region 2, and the nucleotide sequence shown in SEQ ID No.3 is located in the hypervariable region 5.

[0037] The novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention has an amino acid sequence in the hypervariable region of the hexon protein including the amino acid sequences shown in SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7.

[0038] Preferably, the nucleotide sequence of the novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention is shown in SEQ ID No.4.

[0039] The preparation method of the novel Ad5 / 35 chimeric oncolytic adenovirus vector of the present invention comprises the following steps:

[0040] S1, synthesizing a plasmid containing a hexon nucleotide sequence;

[0041] S2, the type 5 adenovirus plasmid backbone and the plasmid of step S1 are used to obtain an oncolytic adenovirus vector by homologous recombination; homologous recombination is to co-transform the linearized type 5 adenovirus plasmid backbone and the amplified hexon sequence into the homologous recombination competent BJ5183.

[0042] S3. Perform enzyme digestion, transfection, amplification and purification of oncolytic adenoviral vector.

[0043] The novel Ad5 / 35 chimeric oncolytic adenovirus vector described above can be used in the preparation of cancer treatment preparations, which are drugs, pharmaceutical raw materials, vaccines or targeted inhibitors.

[0044] The preparation for treating cancer of the present invention comprises the above-mentioned recombinant plasmid and / or the above-mentioned novel Ad5 / 35 chimeric oncolytic adenovirus vector.

[0045] The present invention is described below by means of specific examples.

[0046] Example 1 Preparation of oncolytic adenovirus

[0047] The plasmid backbone used in this embodiment is a chimeric oncolytic adenovirus, which is modified by type 5 adenovirus genetic engineering.

[0048] Specifically, the plasmid backbone is a type 5 adenovirus backbone, the nucleotide sequence of which lacks positions 920 to 946 in the E1A CR2 region, partially deletes the Gp19k and ADP regions in the E3 region, inserts the EGFP gene in the Gp19k region, and inserts the luciferase gene in the ADP region.

[0049] At the same time, the fiber protein was replaced with the fiber protein of adenovirus type 35 to change the virus's invasion mechanism. The fiber protein replacement also has a partial effect of resisting neutralizing antibodies, but the effect is weaker than hexon. The fiber protein replacement allows the adenovirus to enter the cell with CD46 instead of the original Coxsackie receptor (CAR). The adenovirus backbone of other serotypes has a similar effect.

[0050] The modified viral plasmid backbone was named CRAd5.

[0051] The preparation process of this embodiment is:

[0052] First, we commissioned GenScript Biotech Inc. to synthesize a complete adenovirus type 5 hexon sequence plasmid in which the corresponding adenovirus type 5 hexon hypervariable region was partially replaced with adenovirus type 35 sequence. The replaced nucleotide sequences were the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3. The specific amino acid sequences encoded by the above sequences are shown in Table 1.

[0053] Table 1 Recombinant amino acid replacement sequence list

[0054]

[0055] The chimeric hexon sequence was amplified by polymerase chain reaction (PCR). Subsequently, the CRAd5 backbone plasmid was linearized using restriction endonuclease Asis I, and co-transformed with the PCR recovery product into homologous recombination competent BJ5183 to obtain the oAd5 / 35-H (1+2+5) recombinant plasmid, the nucleotide sequence of which is shown in SEQ ID No. 4.

[0056] Next, the recombinant plasmid was digested with PacI endonuclease and transfected into HEK-293 cells using Lipo3000 (Thermofisher, USA) for further amplification.

[0057] Virus purification was performed by CsCl density gradient ultracentrifugation to ensure high purity of virus particles. Finally, 15 kilodalton dialysis bags (Solerbo, China) were used for impurity removal, and the virus was dissolved in storage buffer and stored at -80°C for a long time.

[0058] Example 2 Adenovirus Titer Determination

[0059] In this example, the Adeno-X rapid titer kit (Takara, Japan) was used to measure the titer of the adenovirus prepared in Example 1, and the operation process was strictly in accordance with the instructions.

[0060] HEK293 cells were mixed with virus solutions of different dilutions and cultured in cell culture plates for 48 hours. After the culture, cells were fixed with pre-cooled methanol at -20°C for 30 minutes, followed by washing, incubation with primary and secondary antibodies, washing, color development, and counting of positive spots under a microscope. Virus titer was calculated using the corresponding formula in the kit manual.

[0061] According to the above detection scheme, a 20x objective lens was used and -6 The titer of the Ad5 / 35 chimeric oncolytic adenovirus vector prepared in Example 1 was calculated in the wells with the dilution multiple. The calculation method is as follows:

[0062] Five areas were randomly selected for microscopic observation, and the numbers of positive spots recorded were 16, 13, 18, 16, and 21, respectively, with an average of 16.8.

[0063] The virus titer was calculated according to formula (1):

[0064] Formula (1): Virus titer (pfu) = (number of infected cells x coefficient) / (virus volume (mL) x dilution factor)

[0065] Substitute the specific value calculated by the above formula into formula (2):

[0066] Formula (2): Virus titer (pfu) = (16.8 × 313) / (5x10 -2 ×10 -6 )=1.058×10 11 pfu

[0067] Therefore, the calculated titer of the Ad5 / 35 chimeric oncolytic adenoviral vector was 1.058×10 11 pfu.

[0068] Example 3 Cell Viability Analysis

[0069] In this example, CCK-8 kit (Vazyme, China) was used to detect the cell viability of six tumor cell lines, and the detection process was strictly carried out according to the operating instructions of the kit.

[0070] The six tumor cell lines were A549, PANC1, He la, HepG2, SK-OV-3 and MKN45.

[0071] The experimental steps of this example are as follows: cells are inoculated in a 96-well plate, and after the cells adhere to the wall, oAd5 / 35-H (1+2+5) virus dilutions with different MOIs are added for treatment. The MOIs of this example are 0 PFU / cel, 0.1 PFU / cel, 1 PFU / cel, 2 PFU / cel, 5 PFU / cel, 10 PFU / cel, 20 PFU / cel, 50 PFU / cel, 100 PFU / cel and 500 PFU / cel.

[0072] After 72 hours of culture, the original culture medium was removed and replaced with 100 μl of culture medium containing 10% CCK-8 per well. Subsequently, the culture plate was placed in an incubator and incubated for 1 to 4 hours. After the incubation, the absorbance was measured at a wavelength of 450 nm using an ELISA reader (Bio-Rad, USA), and the cell inhibition rate was calculated according to the corresponding formula.

[0073] Figure 1 For the test results, according to Figure 1 It can be seen that in the six tumor cell lines tested, the IC 50 There was no significant decrease in the values, indicating that the modifications to the adenovirus type 5 Hexon HVRs 1, 2, and 5 did not negatively affect its antitumor efficacy.

[0074] Example 4 Adenovirus Type 5 Neutralizing Antibodies Inhibit Adenovirus Infection and Cytotoxicity Test

[0075] This example tests the infectivity and cytotoxicity of the modified oncolytic virus oAd5 / 35-H (1+2+5) in vitro in the presence of neutralizing antibodies.

[0076] The specific experimental process is:

[0077] The commercial neutralizing antibody ab6982 (Abcam, USA) against adenovirus type 5 was mixed with serum-free DMEM medium at different dilution ratios, and then oncolytic adenovirus (MOI was determined according to different cell lines) was added and mixed thoroughly. After the mixture was incubated in a 37°C incubator for 1 hour, it was added to the pre-attached target cells.

[0078] Among them, the oncolytic adenovirus was co-incubated with Ad5 neutralizing antibody and used to infect HEK293 cells (MOI=2) and A549 cells (MOI=5). After 4 hours of infection, the relative expression level of the viral Hexon gene was detected by qRT-PCR to evaluate the infection ability of the oncolytic adenovirus. The results are as follows: Figure 2 shown.

[0079] The qRT-PCR analysis process of this example is as follows:

[0080] DNA was extracted from tissue or cell samples using the FastPure Cell / Tissue DNA Isolation Mini Kit (Vazyme, China) according to the manufacturer's instructions. After extraction, DNA was quantified using NanoDrop (Thermo, USA). Subsequently, qRT-PCR analysis was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) and CFX96 (Bio-Rad, USA).

[0081] The primer sequences used in this example are as follows:

[0082] GAPDH forward primer (F): GGAGCGAGATCCCTCCAAAAT;

[0083] GAPDH rear primer (R): GGCTGTTGTCATACTTCTCATGG.

[0084] Hexon forward primer (F): ACTATATGGACAACGTCAACCCATT;

[0085] Hexon post primer (R): AACTTCTGAGGCACCTGGATGT.

[0086] After incubation with Ad5 neutralizing antibodies (NABs), the oncolytic adenovirus was used to infect HEK293 cells (MOI = 2). 48 hours after infection, the proportion of EGFP-positive cells was detected by flow cytometry to evaluate the ability of oncolytic adenovirus to deliver exogenous genes. Figure 3 shown.

[0087] After incubation with Ad5 neutralizing antibody, A549 or PANC-1 cells were infected with tumor lytic adenovirus at an MOI of 10. After 72 hours of infection, the viability of tumor cells was evaluated using CCK-8 assay. The results are shown in Figure 4 shown.

[0088] According to the above results, in the presence of neutralizing antibodies, the anti-tumor effect of oAd5 / 35-H125 was significantly better than that of CRAd5 ( Figure 4 ). It can be seen that compared with CRAd5, oAd5 / 35-H(1+2+5) can effectively resist the effects of neutralizing antibodies in vitro and show better anti-tumor ability.

[0089] Example 5o Antitumor effect of Ad5 / 35-H (1+2+5) in the presence of pre-existing neutralizing antibodies against Ad5

[0090] The animal models used in this example were 6-week-old female C57BL / 6 mice and BALB / c nude mice, both purchased from Weitong Lihua Laboratory Animal Technology Co., Ltd. All animal experiments were approved by the Ethics Committee of Tongji Medical College (approval number: 2023-3665) and conducted in a specific pathogen-free (SPF) animal room at the Experimental Animal Center of Tongji Medical College.

[0091] In the experiment, 50 μL of wild-type adenovirus type 5 was injected into the right hind limb muscle or intraperitoneally of each C57BL / 6 mouse, and serum samples were collected by retroorbital bleeding 30 days later for the experiment. BALB / c nude mice were injected subcutaneously with 2×10 6 A549 cell suspension (50 μL serum-free medium) was used to establish a subcutaneous tumor model, and the tumor volume was measured regularly using a digital caliper to monitor tumor growth. When the average tumor volume reached about 100 mm 3 The mice were randomly divided into different experimental groups. In the passive immunization group, 100 μL of adenovirus type 5 neutralizing antibody serum (from C57BL / 6J mice infected with ad5) was injected through the tail vein of the mouse; the control group was injected with 100 μL of PBS. After intravenous injection of C57BL / 6 mouse serum (serum neutralizing antibody titer NT50 was 2725±71, positive control Ab6982 serum neutralizing antibody titer NT50 was 69937±232), each group of mice was injected intratumorally with 5×108 pfu oncolytic virus, 50 μL each time, once every two days, for 5 consecutive injections. The change in tumor volume was measured by caliper until the tumor volume reached 1500 mm 3 At , mice were euthanized, and tumor tissues were immediately removed for further analysis.

[0092] In this embodiment, the specific experimental process of the adenovirus type 5 neutralizing antibody titer determination is as follows: First, the serum sample to be tested is heated in a 56°C water bath for 30 minutes for heat inactivation. Subsequently, the heat inactivated serum sample diluted in a certain ratio is mixed with an equal volume of serum-free DMEM medium and added to a 96-well plate.

[0093] Next, CRAd5 virus was added at an MOI of 2, mixed evenly, and incubated in a 37°C incubator for 1 hour. After incubation, 1.5×10 5 HEK293 cells were added and cultured for 24 hours. After the culture, the cells were lysed using a one-step luciferase lysis buffer (Beyotime, China), and the fluorescence signal was then measured using a microplate reader (Bio-Rad, USA). Finally, nonlinear regression analysis was performed using GraphPad software to calculate the cell inhibition rate. The neutralizing antibody level was expressed by the 50% inhibition rate (IC 50 ) to measure.

[0094] The analysis results are as follows Figure 5 As shown, according to Figure 5 It can be seen that after serum injection, the anti-tumor effect of oAd5 was significantly inhibited ( Figure 5 In contrast, the presence of neutralizing antibodies had little effect on the antitumor effect of ooAd5 / 35-H125, showing its advantage in resisting neutralizing antibodies. It is worth noting that the body weight of mice did not change significantly during the entire treatment process, regardless of whether the mice were treated with CRAd5 or oAd5 / 35-H ( Figure 5 Middle A), further demonstrating the safety of this therapeutic vector.

[0095] It can be seen from the above examples that the present invention successfully constructed and prepared the chimeric oncolytic adenovirus oAd5 / 35-H after Hexon HVR modification. By testing its killing ability in a variety of tumor cell lines, it was found that the anti-tumor efficacy of the virus was not reduced due to HVR modification. In addition, in the presence of neutralizing antibodies, the infection efficiency and gene delivery ability of oAd5 / 35-H were significantly better than those of unmodified CRAd. These results were further verified in animal models.

[0096] In the above embodiments of the present invention, the human cell lines used include HEK293, A549, PANC1, He la, HepG2, SK-OV-3 and MKN45. HEK293, A549, PANC1, He la and HepG2 cells were grown in DMEM medium (Gibco, USA). MKN45 cell line was cultured in RPMI 1640 medium (Gibco, USA), while SK-OV-3 cells used M5A medium (Gibco, USA). All cell lines were derived from the cell bank of the Chinese Academy of Sciences and cultured in this laboratory. 10% fetal bovine serum (Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA) were added to the culture medium to ensure cell growth and vitality. The cells were cultured in an environment of 37°C and 5% CO2, and the cells were passaged when the cell confluence reached 70-80%, and 0.25% trypsin was used for cell digestion (Gibco, USA).

[0097] In the above examples of the present invention, the experimental data are expressed as mean ± standard deviation (SD). The comparison between two groups was performed by t test, and the comparison between multiple groups was performed by one-way analysis of variance (ANOVA), and Dunnett, Tukey or LSD post hoc test was performed as needed. The changes in tumor growth over time were evaluated by two-way analysis of variance or multiple t test. The statistical significance in the figure is represented by the following symbols: * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A recombinant plasmid, characterized in that: The recombinant plasmid comprises adenovirus type 5 plasmid skeleton and hexon nucleotide sequence, wherein the hexon nucleotide sequence comprises a nucleotide sequence for encoding adenovirus type 35 hexon protein hypervariable region.

2. The recombinant plasmid according to claim 1, characterized in that The hexon nucleotide sequence includes the nucleotide sequences shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.

3.

3. The recombinant plasmid according to claim 2, characterized in that The hexon nucleotide sequence includes hypervariable region 1, hypervariable region 2 and hypervariable region 5. The nucleotide sequence shown in SEQ ID No.1 is located in the hypervariable region 1, the nucleotide sequence shown in SEQ ID No.2 is located in the hypervariable region 2, and the nucleotide sequence shown in SEQ ID No.3 is located in the hypervariable region 5.

4. A novel Ad5 / 35 chimeric oncolytic adenovirus vector, characterized in that: The recombinant plasmid is prepared according to any one of claims 1 to 3.

5. A novel Ad5 / 35 chimeric oncolytic adenoviral vector according to claim 4, characterized in that: The amino acid sequence of the hexon protein hypervariable region of the novel Ad5 / 35 chimeric oncolytic adenovirus vector includes the amino acid sequences shown in SEQ ID No.5, SEQ ID No.6 and SEQ ID No.

7.

6. A novel Ad5 / 35 chimeric oncolytic adenoviral vector according to claim 5, characterized in that: The nucleotide sequence of the novel Ad5 / 35 chimeric oncolytic adenovirus vector is shown in SEQ ID No.

4.

7. A method for preparing a novel Ad5 / 35 chimeric oncolytic adenovirus vector according to any one of claims 4 to 6, characterized in that: The following steps are involved: S1, synthesizing the recombinant plasmid containing the hexon nucleotide sequence; S2, obtaining an adenovirus vector by homologous recombination of the type 5 adenovirus plasmid backbone and the recombinant plasmid of step S1; S3. Perform enzyme digestion, transfection, amplification and purification on the adenoviral vector to obtain the novel Ad5 / 35 chimeric oncolytic vector.

8. The method for preparing the novel Ad5 / 35 chimeric oncolytic adenovirus vector according to claim 7, characterized in that: The homologous recombination is to co-transform the linearized type 5 adenovirus plasmid backbone and the amplified hexon sequence into the homologous recombination competent BJ5183.

9. Use of the novel Ad5 / 35 chimeric oncolytic adenovirus vector according to any one of claims 4 to 6 in the preparation of a preparation for treating cancer, characterized in that: The cancer treatment preparation is selected from drugs, pharmaceutical raw materials, vaccines, targeted inhibitors, gene therapy vectors, and biological preparations.

10. A preparation for treating cancer, characterized in that: The preparation comprises the recombinant plasmid according to any one of claims 1 to 3 and / or the novel Ad5 / 35 chimeric oncolytic adenovirus vector according to any one of claims 4 to 6.

Images