Application of lentiviral vector overexpressing cygb in repairing engineered materials

Abstract

The application provides application of a lentivirus vector overexpressing CYGB in repairing engineering materials. Specifically relates to application of the lentivirus vector overexpressing CYGB in repairing tissue defect engineering materials, and application of adipose-derived stem cells containing the lentivirus vector overexpressing CYGB in repairing tissue defect engineering materials. The lentivirus vector overexpressing CYGB is used to transfect adipose-derived stem cells, and the obtained adipose-derived stem cells containing the lentivirus vector overexpressing CYGB can promote proliferation and adipogenic differentiation of the adipose-derived stem cells, form tissue engineering fat, and be filled into a tissue defect site as an implant material to repair the tissue defect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a lentivirus vector overexpressing CYGB in repairing engineering materials. BACKGROUND

[0002] Adipose tissue is the largest endocrine organ in the human body, plays a core role in regulating energy balance and lipid homeostasis, and is involved in various physiological processes such as protecting internal organs, regulating metabolism and immunity; therefore, adipose tissue is also an ideal material for soft tissue repair and reconstruction. At present, adipose transplantation is widely used in the repair of postoperative or traumatic defects, scar treatment, but there are still problems such as low survival rate of grafts, high technical requirements, uncontrollable complications, and poor long-term stability. The emergence of adipose tissue engineering is considered as a very promising new treatment strategy, which has strong plasticity in implant function and graft survival rate, and how to form tissue engineering fat similar to normal adipose tissue in vivo is a clinical problem to be overcome.

[0003] Adipose tissue engineering is mainly composed of seed cells, inducing factors and scaffolds. Adipose-derived stem cells (ADSCs) are considered to be the best choice for seed cells in adipose tissue engineering due to their ability to preferentially differentiate into adipocytes, and their excellent self-proliferation activity and adipogenesis are essential for maintaining tissue homeostasis, promoting cell renewal and promoting self-repair.

[0004] The cytoglobin (CYGB) gene is an inherent protective protein of the human body and has no toxic side effects on the body. Cytoglobin was first discovered in rat HSCs by Kawada et al., and its expression was significantly increased in fibrotic liver stellate cells (HSCs) induced by thioacetamide stress, so it was initially named stellate cell activation-associated protein (STAP). Protein sequencing showed that it belongs to a new class of hexacoordinate globin superfamily, and is one of the four globins in mammals. Further studies have found that STAP not only exists in HSCs, but also exists universally in various human organs and tissues, and in kidney and pancreas fibroblast-like cells, so it is collectively referred to as cytoglobin. SUMMARY

[0005] The purpose of the present application is to use a lentivirus vector overexpressing CYGB to modify adipose-derived stem cells, promote the proliferation and adipogenic differentiation of adipose-derived stem cells, form tissue engineering fat, and repair tissue defects as an implant material.

[0006] The application provides application of a lentivirus vector overexpressing CYGB in engineering materials for repairing tissue defects.

[0007] In a specific embodiment, the tissue defect is a skin and soft tissue defect.

[0008] In a specific embodiment, the lentivirus vector overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentivirus vector, CYGB is expressed under the driving of a CMV promoter, and EGFP-2A-PURO is expressed under the driving of an EF1a promoter, and has green fluorescence and puromycin resistance.

[0009] In a specific embodiment, the sequence of CYGB is shown as SEQ ID NO. 1, and the sequence of the lentivirus vector overexpressing CYGB is shown as SEQ ID NO. 2.

[0010] In a specific embodiment, the construction method of the lentivirus vector overexpressing CYGB is as follows: human CYGB is connected to a pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentivirus vector by homologous recombination to construct the lentivirus vector overexpressing CYGB.

[0011] The application further provides application of adipose-derived stem cells containing a lentivirus vector overexpressing CYGB in engineering materials for repairing tissue defects.

[0012] In a specific embodiment, the lentivirus vector overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentivirus vector, CYGB is expressed under the driving of a CMV promoter, and EGFP-2A-PURO is expressed under the driving of an EF1a promoter, and has green fluorescence and puromycin resistance.

[0013] In a specific embodiment, the sequence of CYGB is shown as SEQ ID NO. 1, and the sequence of the lentivirus vector overexpressing CYGB is shown as SEQ ID NO. 2.

[0014] In a specific embodiment, the preparation method of the adipose-derived stem cells containing the lentivirus vector overexpressing CYGB comprises the following steps:

[0015] Step (1), human CYGB is connected to a pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentivirus vector by homologous recombination to construct a lentivirus vector overexpressing CYGB;

[0016] Step (2), packaging the CYGB overexpressing lentivirus vector by using pSPAX2 and pMD2.G;

[0017] Step (3), transfecting the fat stem cells by using the packaged CYGB overexpressing lentivirus vector to obtain the fat stem cells containing the CYGB overexpressing lentivirus vector.

[0018] In a specific embodiment, the lentivirus transfection multiplicity MOI in step (3) is 50.

[0019] The beneficial effects of the present application at least include:

[0020] Firstly, the present application firstly discovers that the CYGB protein is significantly up-regulated in the adipogenic differentiation process of ADSCs, so that the CYGB gene overexpressing modified ADSCs have application potential in serving as seed cells of adipose tissue engineering.

[0021] Secondly, the present application transfects the fat stem cells by using the CYGB overexpressing lentivirus vector, and the obtained fat stem cells containing the CYGB overexpressing lentivirus vector can promote the proliferation and adipogenic differentiation of the fat stem cells, so that on one hand, the fat stem cells containing the CYGB overexpressing lentivirus vector can form tissue engineering fat, which is filled into the site of tissue defect as an implant material to repair the tissue defect, and on the other hand, can provide a reference basis for the optimization of the function of the seed cells of adipose tissue engineering. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Comparison chart of PPAR-γ, CEBP-α and CYGB gene expression levels in ADSCs during adipogenic differentiation for 0-5 days;

[0023] Figure 2 Western blot corresponding band chart of PPAR-γ, CEBP-α, CYGB and GAPDH protein expression in ADSCs during adipogenic differentiation for 0-14 days;

[0024] Figure 3 Diagram of the CYGB overexpressing lentivirus vector constructed in the present application;

[0025] Figure 4 Cell fluorescence expression of the empty CYGB lentivirus transfected fat stem cell group and the CYGB overexpressing lentivirus transfected fat stem cell group under a microscope, Figure 4 a in the figure is the cell condition under natural light after the empty CYGB lentivirus transfected fat stem cells, Figure 4 b in the figure is the cell condition under natural light after the CYGB overexpressing lentivirus transfected fat stem cells, Figure 4c is the cell condition under blue light (excitation of green fluorescence) after lentivirus transfection of adipose-derived stem cells with empty CYGB, Figure 4 d is the cell condition under blue light (excitation of green fluorescence) after lentivirus transfection of adipose-derived stem cells with overexpressed CYGB;

[0026] Figure 5 Western blot corresponding band diagram of CYGB, GAPDH protein expression of the lentivirus transfection of adipose-derived stem cells with empty CYGB group and the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group;

[0027] Figure 6 Comparison diagram of CCK-8 cell proliferation activity of the lentivirus transfection of adipose-derived stem cells with empty CYGB group (CYGB-OE) and the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group (CYGB-NC);

[0028] Figure 7 Comparison diagram of crystal violet staining images of the lentivirus transfection of adipose-derived stem cells with empty CYGB group and the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group on the 14th day, Figure 7 a is the image of crystal violet staining observation of the lentivirus transfection of adipose-derived stem cells with empty CYGB group, Figure 7 b is the image of crystal violet staining macroscopic observation of the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group, Figure 7 c is the image of crystal violet staining under microscope of the lentivirus transfection of adipose-derived stem cells with empty CYGB group, Figure 7 d is the image of crystal violet staining under microscope of the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group;

[0029] Figure 8 Comparison diagram of cell cycle fitting diagrams after lentivirus transfection of adipose-derived stem cells with empty CYGB and after lentivirus transfection of adipose-derived stem cells with overexpressed CYGB, Figure 8 (a) is the cell cycle fitting diagram after lentivirus transfection of adipose-derived stem cells with empty CYGB, Figure 8 (b) is the cell cycle fitting diagram after lentivirus transfection of adipose-derived stem cells with overexpressed CYGB;

[0030] Figure 9 Comparison diagram of Nile red staining under microscope images of the lentivirus transfection of adipose-derived stem cells with empty CYGB group and the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group on the 5th day, Figure 9 (a) is the Nile red staining under microscope image of the lentivirus transfection of adipose-derived stem cells with empty CYGB group on the 5th day, Figure 9 (b) is the Nile red staining under microscope image of the lentivirus transfection of adipose-derived stem cells with overexpressed CYGB group on the 5th day;

[0031] Figure 10 This is a comparison of Oil Red O stained microscopic images on day 5 of adipose-derived stem cell groups transfected with lentivirus carrying empty CYGB and adipose-derived stem cell groups transfected with lentivirus overexpressing CYGB. Figure 10 (a) is the lower image of an adipose-derived stem cell group transfected with lentivirus containing empty CYGB on day 5 after Oil Red O staining. Figure 10 (b) The following image is an Oil Red O staining microscope image of an adipose stem cell group transfected with a lentivirus overexpressing CYGB on day 5. Detailed Implementation

[0032] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. However, the present invention may be implemented in many different ways as limited and covered by the claims.

[0033] Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0034] Example 1

[0035] CYGB participates in adipogenic differentiation of ADSCs

[0036] (1) RT-qPCR detection

[0037] Reagents: Adipogenic induction medium was purchased from Apex Gene; Trizol, reverse transcription kit, and PCR kit were purchased from Vazyme; primers were purchased from Shanghai Sangon Biotech.

[0038] Specific steps: 7.5 × 10 4 Adipose-derived stem cells were seeded into 6-well plates and cultured in adipogenic induction medium for 2 days, followed by culture in 10 μg / ml insulin medium for 1 day, alternating the culture cycle until day 5. During days 1 to 5 of adipogenic induction, total RNA was extracted from one well each day using TRIzol reagent, reverse transcribed into cDNA using a reverse transcription kit, and amplified using a PCR kit and a fluorescent qPCR instrument (QuantStudio 3). The primer sequences used for amplification are shown in Table 1.

[0039] Table 1. Primers for RT-qPCR detection of PPAR-γ, CEBP-α, and CYGB gene expression levels.

[0040] Primer name Primer sequence Primer sequence PPAR-γ-F SEQ ID NO. 3 5'-GAACGGCAATCCTTGGTGTCTAC-3' PPAR-γ-R SEQ ID NO. 4 5'-CACTTGGCTGGTTCTTACTACTGTC-3' CEBP-α-F SEQ ID NO. 5 5'-GCGAGCCAGGACTAGGAGATTC-3' CEBP-α-R SEQ ID NO. 6 5'-AGTAGGCATTGGAGCGGTGAG-3' CYGB-F SEQ ID NO. 7 5'-TGGCCATCCTGGTGAGGTT-3' CYGB-R SEQ ID NO. 8 5'-CAGGCGTGCTTCCGCAGCT-3'

[0041] Results: For details on the relative expression levels of PPAR-γ, CEBP-α, and CYGB gene mRNA detected by RT-qPCR, please refer to [link to relevant documentation]. Figure 1 As shown. From Figure 1It can be seen that during days 0-5 of adipogenic differentiation, as the mRNA levels of key adipogenic differentiation signals PPAR-γ and CEBP-α significantly increased, CYGB mRNA was significantly upregulated on days 3 and 5, indicating that CYGB is involved in the regulation of adipogenic differentiation.

[0042] (2) Western blot detection

[0043] Reagents: Polyacrylamide gel (SDS-PAGE) was purchased from ACE; BCA assay kit and protein ladder were purchased from Bioss; anti-PPAR-γ (WL01800) and anti-CEBP-α (WL01899) were purchased from Vancomyne; CYGB (13317-1-AP) was purchased from Proteintech; HRP Goat anti Rabbit IgG (HL) was purchased from AntGene; TBST, ECL chemiluminescence solution, and PVDF membrane were purchased from ECOTOP.

[0044] Specific procedures: Total protein was extracted from cells using RIPA cell lysis buffer. Protein concentration was determined using a BCA kit. 20 μg of protein was loaded onto a PVDF membrane and subjected to 12% polyacrylamide gel electrophoresis (SDS-PAGE) at 400 mA for 0.5 h. The membrane was blocked at room temperature for 1 h with blocking buffer, eluted with TBST, and incubated overnight at 4°C with primary antibody. The membrane was washed three times with TBST for 5 min each time, incubated with the corresponding secondary antibody at room temperature for 1 h, and then eluted three times for 5 min each time. Antigen-antibody complexes were visualized using enhanced chemiluminescence (ECL) with X-ray film exposed and scanned in a dark room. Protein quantification was performed by analyzing the gray values ​​of the target bands, and the relative expression level of the target protein was expressed as the gray value of the target band / internal control band.

[0045] Results: For details on the protein expression levels of PPAR-γ, CEBP-α, and CYGB genes detected by Western blot, please refer to [link to results]. Figure 2 As shown. From Figure 2 It can be seen that during days 0-14 of adipogenic differentiation induction, as the key adipogenic differentiation proteins PPAR-γ and CEBP-α increased, CYGB mRNA was significantly upregulated on days 5 and 7, indicating that CYGB is involved in the adipogenic differentiation process.

[0046] Example 2

[0047] Construction of lentiviral vectors overexpressing CYGB

[0048] The application connects the human CYGB (NM_134268) sequence to the PLVX-EF1A-EGEP-2A-PURO-CMV-MCS lentivirus vector by homologous recombination connection, constructs a CYGB overexpression lentivirus vector, and then performs lentivirus packaging by using a pSPAX2+pMD2.G system, so as to carry purinomycin resistance and green fluorescence, wherein the CYGB overexpression lentivirus vector is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, and a diagram thereof is shown in Figure 3

[0049] The sequence of the CYGB is shown as SEQ ID NO. 1, and the sequence of the CYGB overexpression lentivirus vector (H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA) is shown as SEQ ID NO. 2.

[0050] In the application, the pLVX in the CYGB overexpression lentivirus vector is a lentivirus vector, the CYGB is driven to express by a CMV promoter, the EGEP-2A-PURO gene is driven to express by an EF1a promoter, and there is green fluorescence and purinomycin resistance.

[0051] In the application, the linearized PLVX-EF1A-EGEP-2A-PURO-CMV-MCS vector is obtained by an enzyme digestion method.

[0052] The sequence of SEQ ID NO. 1 is:

[0053] ​ATGGAGAAAGTGCCAGGCGAGATGGAGATCGAGCGCAGGGAGCGGAGCGAGGAGCTGTCCGAGGCGGAGAGGAAGGCGGTGCAGGCTATGTGGGCCCGGCTCTATGCCAACTGCGAGGACGTGGGGGTGGCCATCCTGGTGAGGTTCTTTGTGAACTTCCCCTCGGCCAAGCAGTACTTCAGCCAGTTCAAGCACATGGAGGATCCCCTGGAGATGGAGCGGAGCCCCCAGCTGCGGAAGCACGCCTGCCGAGTCATGGGGGCCCTCAACACTGTCGTGGAGAACCTGCATGACCCCGACAAGGTGTCCTCTGTGCTCGCCCTTGTGGGGAAAGCCCACGCCCTCAAGCACAAGGTGGAACCGGTGTACTTCAAGATCCTCTCTGGGGTCATTCTGGAGGTGGTCGCCGAGGAATTTGCCAGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGCGTGGCCTCATCTACAGCCACGTGACCGCTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGGTCCCCAACGCCACCACCCCACCGGCCACACTGCCCTCTTCGGGGCCGTAG

[0054] The sequence of SEQ ID NO. 2 is:

[0055]

[0056] Example 3

[0057] Preparation of CYGB-overexpressing ADSCs cell line

[0058] 3.1 Infection method

[0059] After the construction of the CYGB-overexpressing lentiviral vector, the virus was packaged using the pSPAX2 and pMD2.G packaging system, and then transfected into adipose-derived stem cells to construct a CYGB-overexpressing ADSCs cell line. The specific operation is as follows: Day 1: group the cell plating of ADSCs, and the cell number is expected to reach the ideal confluence rate (about 50-60%) on the second day; Day 2: thaw the virus liquid on ice; calculate the required volume of virus liquid per well, dilute it in the required volume of medium for the well, and prepare the infection liquid; add a certain volume ratio of polybrene (final concentration: 2-10 μg / mL) to enhance the infection efficiency; aspirate the medium in the well, and add the infection liquid; incubate overnight; Day 3: replace the fresh medium, and continue to culture in a 37°C, 5% CO2 incubator. Observe the green fluorescence expression of the cells on the fourth and fifth days under a fluorescence microscope, and take pictures to determine the lentiviral infection efficiency. When the cells expressing green fluorescence reach more than 80%, collect the cells for related experimental detection.

[0060] In this example, the MOI value of the infection experiment is set to 50, and the virus liquid volume V (μL) = N x MOI / T, where N is the cell number, and T is the virus titer (TU / ml).

[0061] 3.2 Infection efficiency identification results

[0062] The fluorescence expression of cells under a microscope in the CYGB-empty lentivirus-transfected adipose-derived stem cell group and the CYGB-overexpressing lentivirus-transfected adipose-derived stem cell group is shown in Figure 4 , Figure 4 a in the figure is the cell condition under natural light after the CYGB-empty lentivirus-transfected adipose-derived stem cells under a microscope, Figure 4 b in the figure is the cell condition under natural light after the CYGB-overexpressing lentivirus-transfected adipose-derived stem cells, Figure 4 c in the figure is the cell condition under blue light (exciting green fluorescence) after the CYGB-empty lentivirus-transfected adipose-derived stem cells under a microscope, Figure 4 d in the figure is the cell condition under blue light (exciting green fluorescence) after the CYGB-overexpressing lentivirus-transfected adipose-derived stem cells. It can be seen from Figure 4 that the cells express green fluorescence after being transfected with the constructed CYGB-overexpressing lentivirus, indicating that the lentivirus can be taken up by the cells.

[0063] 3.3 Verification of high expression of CYGB in ADSCs by Western blot

[0064] The Western blot method is described above in the Western blot detection method of Example 1, and will not be repeated here.

[0065] The CYGB expression in the lentivirus transfection adipose stem cell group of empty CYGB (empty lentivirus) and the negative control group of lentivirus transfection adipose stem cells overexpressing CYGB (overexpressing CYGB) was analyzed by Western blot, and the results showed that compared with the empty lentivirus transfection group, CYGB was highly expressed in ADSCs after transfection of the lentivirus vector overexpressing CYGB, as shown in detail in Figure 5 .

[0066] Example 4

[0067] Evaluation of the proliferation activity of ADSCs cell lines overexpressing CYGB

[0068] After the construction of the ADSCs cell line overexpressing CYGB, the cell proliferation ability was evaluated by CCK-8, flow cytometry PI staining, and flow cytometry cycle PI staining, and the results are shown in detail in Figure 6 to Figure 8 .

[0069] (1) CCK-8 detection

[0070] Method: 2x103 adipose stem cells were inoculated into a 96-well plate and cultured for 1-3 days, with medium replacement every 2 days. At the time of detection, 10 μl of CCK-8 reagent was added to each well of the original culture medium, mixed, and then placed in a 37°C constant temperature incubator for 30 minutes. The enzyme-linked immunoassay instrument was used to read the OD value at 450 nm.

[0071] Detection results: The detection results are shown in detail in Figure 6 , Figure 6 CYGB-OE corresponds to the lentivirus transfection adipose stem cell group of empty CYGB, and CYGB-NC corresponds to the lentivirus transfection adipose stem cell group overexpressing CYGB, from Figure 6 it can be seen that after transfection of the lentivirus vector overexpressing CYGB, the ADSCs cell line overexpressing CYGB has improved proliferation activity at 1, 2, and 3 days.

[0072] (2) Crystal violet staining detection

[0073] Method: 2x10 3 ADSCs were inoculated into a 6-well plate and cultured for 14 days, with medium replacement every 3 days. 4% paraformaldehyde treatment for 20 minutes. After washing, 1 ml of crystal violet staining solution was added to each well for staining for 15-20 minutes, and observed under a microscope.

[0074] Detection results: see Figure 7 indicated, from Figure 7 It can be seen that the CYGB-overexpressing ADSCs cell line has enhanced colony formation ability.

[0075] (3) Flow cytometry PI staining detection

[0076] Method: Trypsin digestion of adipose stem cells, 1000 r / min centrifugation for 5 minutes to collect cells, 75% alcohol resuspension to fix cells, 4°C overnight, 1000 r / min centrifugation for 5 minutes to remove alcohol, add 200 μl PBS, 10 μl RNase A, 200 μl propidium iodide PI solution, incubate at 37°C for 30 minutes, mix well, pass through a 200-mesh cell sieve, and transfer to a 5-ml flow tube for flow cytometry detection.

[0077] Detection results: see Figure 8 indicated, from Figure 8 It can be seen that flow cytometry PI staining shows that the number of S phase (proliferation phase) cells increases after overexpression of CYGB.

[0078] Example 5

[0079] Evaluation of the adipogenic differentiation level of CYGB-overexpressing ADSCs cell line

[0080] After constructing the CYGB-overexpressing ADSCs cell line, the adipogenic differentiation level of the cells was evaluated using oil red O staining and Nile red staining. Among them:

[0081] (1) Nile red staining detection

[0082] Method: Clean adherent cells, fix with 4% paraformaldehyde for 20 minutes. Add Nile red staining solution (Solarbio, China), and stain for 10 minutes. Observe lipid droplet staining and nuclear staining under a fluorescence microscope (excitation wavelength 543 nm, emission wavelength 598 nm).

[0083] Detection results: see Figure 9 , from Figure 9 It can be seen that the CYGB-overexpressing ADSCs cell line has increased adipogenic differentiation level.

[0084] (2) Oil red O staining detection

[0085] Method: 7.5 x 10 4 Adipose stem cells were seeded into 6-well plates, cultured in adipogenic induction medium for 2 days, cultured in 10 μg / ml insulin medium for 1 day, and alternately cultured for 5 days. Oil red O staining kit was used for staining detection.

[0086] Detection results: seeFigure 10 From Figure 10 It can be seen that the overexpression of CYGB increases the level of lipid droplet formation in ADSC cell lines.

[0087] The above content is a further detailed description of the present application in combination with specific preferred embodiments, and cannot be considered as limiting the specific implementation of the present application to these descriptions. For ordinary skilled persons in the technical field to which the present application belongs, several simple deductions and replacements can be made without departing from the concept of the present application, and all of them shall be considered as falling within the protection scope of the present application.

Claims

1. Use of a lentiviral vector overexpressing CYGB in the preparation of an engineered material that promotes the proliferation and adipogenic differentiation of adipose stem cells, characterized in that, The adipose-derived stem cells are transfected with the lentiviral vector overexpressing CYGB to promote proliferation and adipogenic differentiation of the adipose-derived stem cells.

2. Use according to claim 1, characterized in that, The lentiviral vector overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentiviral vector, CYGB is expressed by a CMV promoter, and EGFP-2A-PURO is expressed by an EF1a promoter, and the lentiviral vector has green fluorescence and puromycin resistance.

3. Use according to claim 2, characterized in that, The sequence of CYGB is shown as SEQ ID NO. 1, and the sequence of the lentiviral vector overexpressing CYGB is shown as SEQ ID NO.

2.

4. Use according to any one of claims 1 to 3, characterized in that, The lentiviral vector overexpressing CYGB is constructed by connecting human CYGB to a pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentiviral vector by homologous recombination.

5. Use according to claim 4, characterized in that, The step of transfecting the adipose-derived stem cells with the lentiviral vector overexpressing CYGB comprises: Step (1), packaging the lentiviral vector overexpressing CYGB by using pSPAX2 and pMD2.G; Step (2), transfecting the adipose-derived stem cells with the packaged lentiviral vector overexpressing CYGB to obtain adipose-derived stem cells containing the lentiviral vector overexpressing CYGB, wherein the lentivirus transfection multiplicity MOI is 50.

Images