A method for constructing PRMT4 gene knockout cell line based on flow cytometry

Abstract

The present invention discloses a method for constructing a PRMT4 gene knockout cell line based on flow cytometry, which relates to the field of genetic engineering technology; comprising the following steps: S1: design and synthesis of guide RNA; S2: construction of recombinant plasmid; S3: packaging of virus; S4: infection of cell line; S5: sorting of positive cells by flow cytometry; S6: single cell culture after sorting; S7: sequencing to verify knockout; S8: WB detection to verify the expression of PRMT4 protein in knockout CH12F3 cell line. The present invention can quickly and accurately screen out monoclonal cells with GFP labels by sorting positive cells by flow cytometry, thereby improving experimental efficiency; and utilizes CRISPR / Cas9 technology for gene knockout, which is highly specific and accurate and can accurately knock out the target gene PRMT4.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a method for constructing a PRMT4 gene knockout cell line based on flow cytometry. Background Art

[0002] Protein arginine methyltransferase 4, also known as CARM1, is a protein arginine methyltransferase that is mainly responsible for catalyzing the monomethylation and asymmetric dimethylation of arginine residues in proteins. It plays a key regulatory role in a variety of cellular physiological activities, including transcriptional regulation, DNA damage response, RNA splicing, cell cycle regulation, and cell differentiation. The role of PRMT4 in various cancers has been widely studied. For example, in breast cancer, PRMT4 promotes the expression of cell cycle-related genes by highly methylating GATAD2A / B, a member of the NuRD chromatin remodeling complex, thereby promoting the development of breast cancer. In liver cancer, PRMT4 promotes the proliferation, migration, and invasion of cancer cells by activating the AKT / mTOR signaling pathway. In addition, PRMT4 also plays an important role in the self-renewal of leukemia stem cells, maintaining the stemness of leukemia stem cells by regulating protein synthesis. Studies have shown that PRMT4 plays a protective role in cisplatin-induced acute kidney injury. PRMT4 inhibits ferritin autophagy by interacting with NCOA4, thereby alleviating oxidative stress and cell death. In doxorubicin-induced cardiomyopathy, PRMT4 promotes ferroptosis by inhibiting the Nrf2 / Gpx4 signaling pathway, thereby aggravating myocardial injury. The role of PRMT4 in acute lung injury has also attracted attention. Bacterial endotoxins trigger lung epithelial cell death by reducing SCFFBXO9 levels and stabilizing PRMT4 protein.

[0003] CRISPR / Cas9 is a widely used gene editing technology. Its basic principle is to guide the Cas9 protein to a specific DNA sequence through guide RNA (gRNA), cut it, and then achieve gene knockout or insertion through the repair mechanism in the cell. In the construction of knockout cell lines, it has the advantages of high efficiency, accuracy, flexibility, scalability, simplicity, and wide applicability. At present, most laboratories connect the designed sgRNA with a CRISPR-related vector (such as PX458 or lentiCRISPRv2, etc.) to construct a vector-sgRNA knockout recombinant plasmid, and then introduce the recombinant plasmid into the virus packaging cell, collect the virus supernatant and transfect the cell. Then use antibiotics such as puromycin for screening. Then, through genome sequencing, select the cells with successful knockout, and then divide the cells with successful knockout into single clones by limiting dilution method, and finally culture them in 96-well plates. This method is too complicated to operate and requires relatively comprehensive technology and a high-demand experimental platform. For example, the lentiviral infection method requires virus manipulation and cannot be performed in a general laboratory. The limiting dilution method not only requires a lot of repetitive work, but also cannot guarantee that all cells can be divided into single clones.

[0004] At present, there are no reports on the use of CRISPR / Cas9 system to knock out the PRMT4 gene. Therefore, it is necessary to study a method to construct a PRMT4 gene knockout cell line based on the CRISPR / Cas9 system and to quickly screen out PRMT4 gene knockout cells using flow cytometry. Summary of the invention

[0005] The purpose of the present invention is to solve the shortcomings of the prior art and propose a method for constructing a PRMT4 gene knockout cell line based on flow cytometry.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A method for constructing a PRMT4 gene knockout cell line based on flow cytometry comprises the following steps:

[0008] S1: Design and synthesis of guide RNA;

[0009] S2: Construction of recombinant plasmids;

[0010] S3: Virus packaging;

[0011] S4: infection of cell lines;

[0012] S5: flow cytometry to sort positive cells;

[0013] S6: single cell culture after sorting;

[0014] S7: Sequencing to verify the knockout;

[0015] S8: WB detection verified the expression of PRMT4 protein in the knockout CH12F3 cell line.

[0016] Preferably, in S1:

[0017] Gene name: histone arginine methyltransferase PRMT4 / CARM1

[0018] Gene ID:59035

[0019] Design and synthesis of guide RNA include:

[0020] S11: Selection of guide RNA: TAGAGCTGTTCATCAGTGAA;

[0021] S12: Synthesize guide RNA primers: Design two guide RNA primers and make them form sticky ends with BsmBI-v2 restriction endonuclease to send to the bioengineering biosynthesize single nucleotide chain; the details are as follows:

[0022] SgmP4_1F:5'-CACCGTAGAGCTGTTCATCAGTGAA-3'

[0023] SgmP4_1R: 5'-AAACTTCACTGATGAACAGCTCTAC-3'.

[0024] Preferably: in said S2, the construction of the recombinant plasmid comprises:

[0025] S21: Enzyme digestion of CRISPR plasmid vector

[0026] Prepare 30 μl enzyme digestion reaction system

[0027] pL-CRISPR-EFS-GFP plasmid: 20 μl

[0028] BsmBI-v2: 1 μl

[0029] 10×cutsmart buffer: 3μl

[0030] PCR grade water: 6μl

[0031] After constant temperature enzyme digestion at 55℃ for 2-3h using a PCR instrument, perform agarose gel electrophoresis using 1% agarose gel, then cut out the gel block containing the target size band, and use an agarose gel recovery kit to recover and purify the enzyme-digested vector;

[0032] S22: Annealing of guide RNA primer

[0033] Prepare the annealed primer complex system:

[0034] 100μM Forward Primer: 11.25μl

[0035] 100μM Reverse Primer: 11.25μl

[0036] 10×Annealing buffer: 2.5μl

[0037] Wherein: 10×Annealing buffer contains 1M NaCl and 100mM Tris-HCl;

[0038] Take a 2L beaker and put 800ml ddH2O in it. Heat it to above 95℃ on an electric heater. Insert the prepared annealing primer complex system on the float and put it in hot water. Heat it for 3 minutes to simulate the PCR denaturation process so that the primers can fully become single-stranded nucleotide sequences. Then turn off the heater to allow the primers to slowly anneal into double-stranded DNA with sticky ends and cool it down to 20-30℃.

[0039] After annealing, dilute the annealed primers at a ratio of 1:400 with 0.5× Annealing buffer for later use;

[0040] S23: connect the digested vector and the diluted annealed primer together;

[0041] Prepare 10 μl ligation system

[0042] 20-40ng Vector:1.3μl

[0043] diluted and annealed oligo: 1μl

[0044] 10×T4 DNA ligase buffer: 1μl

[0045] T4 DNA ligase: 1 μl

[0046] PCR grade water: 6.2 μl

[0047] Incubate at room temperature for 30 min.

[0048] S24: transformation;

[0049] Take 5 μl of the ligation product and add it to 50 μl of competent cells. Mix it by blowing gently and place it in an ice bath for 30 minutes. Then activate it in a 42°C water bath for 1 minute and 30 seconds. After another 3 minutes of ice bath, add 500 μl of LB liquid culture medium without any resistance and culture it at 37°C with shaking for 1 hour. After instant centrifugation, discard part of the supernatant, resuspend the remaining part and evenly spread it on the LB plate, and culture it in a 37°C constant temperature incubator overnight.

[0050] S25: sequencing;

[0051] Three single clones were selected from each plate for bacterial enrichment culture for at least 6 hours and sequencing. After the results came out, the successfully constructed plasmid was expanded and the plasmid was extracted for later use.

[0052] Preferably: in said S3, the virus packaging comprises:

[0053] S31: Count and plate 293T cells, with 1.5 million cells per well in a 6-well plate, with an error of ±5%, and culture overnight in a cell culture incubator;

[0054] S32: Plasmid transfection.

[0055] Preferably: in said S32, the plasmid transfection comprises the following steps:

[0056] S321: prepare transfection system;

[0057] Opti-MEM: 100 μl

[0058] pL-CRISPR-EFS-sgRNA-GFP: 1μg

[0059] pCMV-VSV-G: 0.5 μg

[0060] pMDLg / pRRE: 0.5 μg

[0061] pRSV / REV: 0.5 μg

[0062] Lipo8000: 4μl

[0063] After mixing, let stand for 15 minutes;

[0064] S322: Change the medium of 293T cells, add 2 ml of fresh DMEM full medium to each well, then evenly add the prepared transfection system to the corresponding cell wells, mix well using the figure-8 method, and culture in a cell culture incubator for 48 hours;

[0065] S323: Collect the virus; carefully aspirate the culture medium supernatant with a 5 ml syringe and filter it with a 0.45 μm filter to obtain the virus supernatant.

[0066] Preferably: in said S4, the infection of the cell line comprises:

[0067] S41: Take 500 μl of virus supernatant and mix with an equal amount of CH12F3 cell suspension;

[0068] S42: add 2 μl 1000×polybrene, mix thoroughly and centrifuge at 1500 g for 30 min;

[0069] S43: Resuspend the cells, add 1 ml of fresh 1640full culture medium, mix well, and culture in a cell culture incubator for 2-3 days.

[0070] Preferably: in said S5, sorting positive cells by flow cytometry comprises:

[0071] S51: Collect cells, rinse twice with PBS, then prepare PBS containing 10% FBS, resuspend the cells with PBS and add them to a sterile flow tube, and mix gently before loading;

[0072] S52: Set the relevant parameters of the flow cytometry instrument to ensure that the sorted monoclonal cells can be stably injected into the 96-well plate;

[0073] S53: Start sorting, set the gate, and place single cells with GFP labels into a 96-well plate; 150 μl 1640 full culture medium is pre-added into the 96-well plate.

[0074] Preferably: in said S6, the culturing of the single cells after sorting comprises:

[0075] The selected monoclonal cells were cultured in 96-well plates in 1640full culture medium for 7-14 days, the grown cells were expanded and frozen for seed preservation, and samples were collected for extraction of genomic DNA for sequencing.

[0076] Preferably: in S7, the knockout verification by sequencing includes:

[0077] The cells in the 96-well plate were collected, the genome of the knockout CH12F3 cells was extracted, PCR amplification was performed, and the PCR amplification products were sequenced;

[0078] Cell lines that underwent frameshift mutations after editing were screened and expanded for culture.

[0079] Preferably: In S8, WB detection and verification of the expression of PRMT4 protein in the knockout CH12F3 cell line includes:

[0080] Sequencing detection showed the expression of PRMT4 protein in the successfully constructed CH12F3 cell line and the effect of PRMT4 knockout on ADMA and MMA signals.

[0081] The beneficial effects of the present invention are:

[0082] 1. The present invention can quickly and accurately screen out monoclonal cells with GFP tags by sorting positive cells by flow cytometry, thereby improving experimental efficiency; and utilize CRISPR / Cas9 technology for gene knockout, which is highly specific and accurate and can accurately knock out the target gene PRMT4. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 This is a fluorescence signal diagram of 293T cells after virus transfection in the present invention;

[0084] Figure 2 It is a schematic diagram of the sequencing results in S7 of the present invention;

[0085] Figure 3 This is a schematic diagram of the WB verification of PRMT4 protein expression in PRMT4 KO cells in the present invention;

[0086] Figure 4 Schematic diagram of the effect of PRMT4 KO on ADMA and MMA signals detected by WB in the present invention. DETAILED DESCRIPTION

[0087] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0088] Embodiment 1:

[0089] A method for constructing a PRMT4 gene knockout cell line based on flow cytometry, comprising:

[0090] S1: Design and synthesis of guide RNA;

[0091] S2: Construction of recombinant plasmids;

[0092] S3: Virus packaging;

[0093] S4: infection of cell lines;

[0094] S5: flow cytometry to sort positive cells;

[0095] S6: single cell culture after sorting;

[0096] S7: Sequencing to verify the knockout;

[0097] S8: WB detection verified the expression of PRMT4 protein in the knockout CH12F3 cell line.

[0098] Wherein, in said S1, the design and synthesis of guide RNA includes:

[0099] Gene name: histone arginine methyltransferase PRMT4 / CARM1

[0100] Gene ID:59035

[0101] For more information on the gene, see (https: / / www.ncbi.nlm.nih.gov / gene / 59035)

[0102] S11: Selection of guide RNA;

[0103] Find the sgRNA list of PRMT4 on https: / / bioinformatics.mdanderson.org / apps / GuidePro / , download it, and select the one with the highest comprehensive score, which is TAGAGCTGTTCATCAGTGAA;

[0104] S12: synthetic guide RNA primer;

[0105] Design two guide RNA primers and make them form sticky ends with BsmBI-v2 restriction endonuclease to send them to the bioengineering biosynthetic single nucleotide chain; the details are as follows:

[0106] SgmP4_1F:5'-CACCGTAGAGCTGTTCATCAGTGAA-3'

[0107] SgmP4_1R: 5'-AAACTTCACTGATGAACAGCTCTAC-3'.

[0108] Wherein, in said S2, the construction of the recombinant plasmid includes:

[0109] S21: Enzyme digestion of CRISPR plasmid vector (pL-CRISPR-EFS-GFP)

[0110] Prepare 30 μl enzyme digestion reaction system

[0111] pL-CRISPR-EFS-GFP plasmid (3 μg): 20 μl

[0112] BsmBI-v2 (NEB): 1 μl

[0113] 10×cutsmart buffer: 3μl

[0114] PCR grade water: 6μl (add to 30μl)

[0115] After constant temperature enzyme digestion at 55°C for 2-3h using a PCR instrument, perform agarose gel electrophoresis (100V30min) with 1% agarose gel, then cut out the gel block containing the target size band, and use an agarose gel recovery kit to recover and purify the enzyme-digested vector. For specific experimental steps, see the instruction manual of the ordinary agarose gel DNA recovery kit (TIANGEN DP209).

[0116] S22: Annealing of guide RNA primer

[0117] Prepare annealed primer complex system (25 μl)

[0118] 100μM Forward Primer: 11.25μl

[0119] 100μM Reverse Primer: 11.25μl

[0120] 10×Annealing buffer: 2.5μl

[0121] Note: 10×Annealing buffer contains 1M NaCl and 100mM Tris-HCl (pH7.4);

[0122] Take a 2L beaker and fill it with about 800ml ddH2O. Heat it to above 95℃ on an electric heater. Insert the prepared annealing primer complex system on the float and put it in hot water. Heat it for 3 minutes to simulate the PCR denaturation process so that the primers can fully become single-stranded nucleotide sequences. Then turn off the heater to allow the primers to slowly anneal into double-stranded DNA with sticky ends. Cool it down to 20-30℃ (about 2-3h).

[0123] After annealing, dilute the annealed primers at a ratio of 1:400 with 0.5× Annealing buffer for later use;

[0124] S23: connect the digested vector and the diluted annealed primer together;

[0125] Prepare 10 μl ligation system

[0126] 20-40ng Vector (30ng): 1.3μl

[0127] diluted and annealed oligo: 1μl

[0128] 10×T4 DNA ligase buffer: 1μl

[0129] T4 DNA ligase (NEB): 1 μl

[0130] PCR grade water: 6.2μl (add to 10μl)

[0131] Incubate at room temperature for 30 min.

[0132] S24: transformation;

[0133] Take 5μl of the ligation product and add it to 50μl of competent cells (stbl3), gently blow and mix, then place on ice for 30min, then activate in a 42℃ water bath for 1min30s, and then place on ice for 3min, then add 500μl of LB liquid medium without any resistance and culture at 37℃ for 1h. After instant centrifugation, discard part of the supernatant, resuspend the remaining part and evenly spread it on the LB plate (Amp+), and culture it in a 37℃ constant temperature incubator overnight (12-16h);

[0134] S25: sequencing;

[0135] Pick 3 single clones from each plate for bacterial enrichment culture for at least 6 hours and send them to Qingke Biotechnology for sequencing. After the results come out, the successfully constructed plasmid will be expanded and the plasmid will be extracted for later use.

[0136] Wherein, in said S3, the virus packaging includes:

[0137] S31: Count and plate 293T cells, with approximately 1.5 million cells per well in a 6-well plate, and culture overnight in a cell culture incubator;

[0138] S32: Plasmid transfection (including virus)

[0139] S321: Prepare transfection system

[0140] Opti-MEM: 100 μl

[0141] pL-CRISPR-EFS-sgRNA-GFP (target plasmid): 1 μg

[0142] pCMV-VSV-G: 0.5 μg

[0143] pMDLg / pRRE: 0.5 μg

[0144] pRSV / REV: 0.5 μg

[0145] Lipo8000 (Biyuntian): 4μl

[0146] After mixing, let stand for about 15 minutes;

[0147] S322: Change the medium of 293T cells (be careful not to blow up the cells), add 2 ml of fresh DMEM full medium to each well, then evenly add the prepared transfection system to the corresponding cell wells, mix well using the figure-8 method, and culture in a cell culture incubator for 48 hours; Figure 1 As shown;

[0148] S323: Collect viruses;

[0149] Carefully remove the culture medium supernatant with a 5 ml syringe and filter it with a 0.45 μm filter (to remove cells in the supernatant). The obtained virus supernatant can be used to infect CH12F3 cells.

[0150] Wherein, in said S4, the infection of the cell line comprises:

[0151] S41: Take 500 μl of virus supernatant and mix with an equal amount of CH12F3 cell suspension;

[0152] S42: Add 2 μl 1000× polybrene, mix thoroughly and centrifuge at 1500 g for 30 min. The purpose of this step is to allow cells to fully contact with viruses to increase the success rate of infection;

[0153] S43: Resuspend the cells, add 1 ml of fresh 1640full culture medium, mix well, and culture in a cell culture incubator for 2-3 days.

[0154] Wherein, in said S5, sorting positive cells by flow cytometry comprises:

[0155] S51: Collect cells, rinse twice with PBS, then prepare PBS containing 10% FBS, resuspend the cells with PBS (containing 10% FBS) and add them to a sterile flow tube, and mix gently before loading;

[0156] S52: Set the relevant parameters of the flow sorter, such as flow rate and voltage, to ensure that the sorted monoclonal cells can be stably injected into the 96-well plate;

[0157] S53: Start sorting, set the gate, and place single cells with GFP label (green fluorescence) into a 96-well plate; 150 μl 1640 full culture medium is pre-added into the 96-well plate;

[0158] The 1640full culture medium used here contains 50% of the used and then filtered 1640full culture medium. This is because the culture medium used may contain cytokines required for cell growth and can increase the survival rate of cells.

[0159] Wherein, in said S6, the single cell culture after sorting comprises:

[0160] The selected monoclonal cells are cultured in 1640full culture medium (containing 50% used and then filtered 1640full culture medium) in a 96-well plate for 7-14 days, the grown cells can be expanded and frozen for seed preservation, and samples are collected to prepare for extraction of genomic DNA for sequencing.

[0161] Among them, in said S7, the knockout situation verified by sequencing includes:

[0162] The cells in the 96-well plate were collected, and the genome of the knockout CH12F3 cells was extracted. After PCR amplification, the PCR amplification products were sent to Sangon Biotech for sequencing. The sequencing results were as follows: Figure 2 As shown;

[0163] The cell lines that underwent frameshift mutations after editing were screened out, and the cells were expanded and cultured, a batch was frozen, and then subsequent related experimental research was carried out.

[0164] Among them, in S8, WB detection verifies the expression of PRMT4 protein in the knockout CH12F3 cell line, including:

[0165] Sequencing showed the expression of PRMT4 protein in the successfully constructed CH12F3 cell line and the effect of PRMT4 knockout on ADMA (asymmetric dimethylation) and MMA (monomethylation) signals. The results are as follows Figure 3 , Figure 4 As shown, it is confirmed that the knockout of PRMT4 gene is successful and it does affect the methylation of some proteins in the cells. These cells can be used to further verify the function of PRMT4 gene.

[0166] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for constructing a PRMT4 gene knockout cell line based on flow cytometry, characterized in that: The steps include: S1: Design and synthesis of guide RNA; S2: Construction of recombinant plasmids; S3: Virus packaging; S4: infection of cell lines; S5: flow cytometry to sort positive cells; S6: single cell culture after sorting; S7: Sequencing to verify the knockout; S8: WB detection verified the expression of PRMT4 protein in the knockout CH12F3 cell line.

2. A method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 1, characterized in that: In S1: Gene name: histone arginine methyltransferase PRMT4 / CARM1 Gene ID:59035 Design and synthesis of guide RNA include: S11: Selection of guide RNA: TAGAGCTGTTCATCAGTGAA; S12: Synthesize guide RNA primers: Design two guide RNA primers and make them form sticky ends with BsmBI-v2 restriction endonuclease to send to the bioengineering biosynthesize single nucleotide chain; the details are as follows: SgmP4_1F:5'-CACCGTAGAGCTGTTCATCAGTGAA-3' SgmP4_1R: 5'-AAACTTCACTGATGAACAGCTCTAC-3'.

3. A method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 2, characterized in that: In S2, the construction of the recombinant plasmid includes: S21: Enzyme digestion of CRISPR plasmid vector Prepare 30 μl enzyme digestion reaction system pL-CRISPR-EFS-GFP plasmid: 20 μl BsmBI-v2: 1 μl 10×cutsmart buffer: 3μl PCR grade water: 6μl After constant temperature enzyme digestion at 55℃ for 2-3h using a PCR instrument, perform agarose gel electrophoresis using 1% agarose gel, then cut out the gel block containing the target size band, and use an agarose gel recovery kit to recover and purify the enzyme-digested vector; S22: Annealing of guide RNA primer Prepare the annealed primer complex system: 100μM Forward Primer: 11.25μl 100μM Reverse Primer: 11.25μl 10×Annealing buffer: 2.5μl Wherein: 10×Annealing buffer contains 1M NaCl and 100mM Tris-HCl; Take a 2L beaker and put 800ml ddH2O in it. Heat it to above 95℃ on an electric heater. Insert the prepared annealing primer complex system on the float and put it in hot water. Heat it for 3 minutes to simulate the PCR denaturation process so that the primers can fully become single-stranded nucleotide sequences. Then turn off the heater to allow the primers to slowly anneal into double-stranded DNA with sticky ends and cool it down to 20-30℃. After annealing, dilute the annealed primers at a ratio of 1:400 with 0.5× Annealing buffer for later use; S23: connect the digested vector and the diluted annealed primer together; Prepare 10 μl ligation system 20-40ng Vector:1.3μl diluted and annealed oligo: 1μl 10×T4 DNA ligase buffer: 1μl T4 DNA ligase: 1 μl PCR grade water: 6.2 μl Incubate at room temperature for 30 min. S24: transformation; Take 5 μl of the ligation product and add it to 50 μl of competent cells. Mix it by blowing gently and place it in an ice bath for 30 minutes. Then activate it in a 42°C water bath for 1 minute and 30 seconds. After another 3 minutes of ice bath, add 500 μl of LB liquid culture medium without any resistance and culture it at 37°C with shaking for 1 hour. After instant centrifugation, discard part of the supernatant, resuspend the remaining part and evenly spread it on the LB plate, and culture it in a 37°C constant temperature incubator overnight. S25: sequencing; Three single clones were selected from each plate for bacterial enrichment culture for at least 6 hours and sequencing. After the results came out, the successfully constructed plasmid was expanded and the plasmid was extracted for later use.

4. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 3, characterized in that: In S3, the virus packaging includes: S31: Count and plate 293T cells, with 1.5 million cells per well in a 6-well plate, with an error of ±5%, and culture overnight in a cell culture incubator; S32: Plasmid transfection.

5. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 4, characterized in that: In the S32, plasmid transfection comprises the following steps: S321: prepare transfection system; Opti-MEM: 100 μl pL-CRISPR-EFS-sgRNA-GFP: 1μg pCMV-VSV-G: 0.5 μg pMDLg / pRRE: 0.5 μg pRSV / REV: 0.5 μg Lipo8000: 4μl After mixing, let stand for 15 minutes; S322: Change the medium of 293T cells, add 2 ml of fresh DMEM full medium to each well, then evenly add the prepared transfection system to the corresponding cell wells, mix well using the figure-8 method, and culture in a cell culture incubator for 48 hours; S323: Collect the virus; carefully aspirate the culture medium supernatant with a 5 ml syringe and filter it with a 0.45 μm filter to obtain the virus supernatant.

6. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 5, characterized in that: In S4, infection of cell lines includes: S41: Take 500 μl of virus supernatant and mix with an equal amount of CH12F3 cell suspension; S42: add 2 μl 1000×polybrene, mix thoroughly and centrifuge at 1500 g for 30 min; S43: Resuspend the cells, add 1 ml of fresh 1640full culture medium, mix well, and culture in a cell culture incubator for 2-3 days.

7. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 6, characterized in that: In S5, sorting positive cells by flow cytometry includes: S51: Collect cells, rinse twice with PBS, then prepare PBS containing 10% FBS, resuspend the cells with PBS and add them to a sterile flow tube, and mix gently before loading; S52: Set the relevant parameters of the flow cytometry instrument to ensure that the sorted monoclonal cells can be stably injected into the 96-well plate; S53: Start sorting, set the gate, and place single cells with GFP labels into a 96-well plate; 150 μl 1640 full culture medium is pre-added into the 96-well plate.

8. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 7, characterized in that: In S6, the single cell culture after sorting includes: The selected monoclonal cells were cultured in 96-well plates in 1640full culture medium for 7-14 days, the grown cells were expanded and frozen for seed preservation, and samples were collected for extraction of genomic DNA for sequencing.

9. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 8, characterized in that: In S7, the knockout conditions verified by sequencing include: The cells in the 96-well plate were collected, the genome of the knockout CH12F3 cells was extracted, PCR amplification was performed, and the PCR amplification products were sequenced; Cell lines that underwent frameshift mutations after editing were screened and expanded for culture.

10. The method for constructing a PRMT4 gene knockout cell line based on flow cytometry according to claim 1, characterized in that: In S8, WB detection verifies the expression of PRMT4 protein in the knockout CH12F3 cell line, including: Sequencing detection showed the expression of PRMT4 protein in the successfully constructed CH12F3 cell line and the effect of PRMT4 knockout on ADMA and MMA signals.

Images