A SNP molecular marker for identifying the spawning rate of female sturgeons and its application

Abstract

A SNP molecular marker for identifying the high and low egg production of female sturgeons and its application belong to the field of sturgeon genetic breeding and sturgeon molecular marker assisted breeding. The specific scheme is: the SNP molecular marker for identifying the high and low egg production of female sturgeons is located at the 333rd bp of the 17β-hsd2 gene nucleotide fragment, its polymorphic form is C / G, and the genotype of its base mutation site includes CC, CG or GG. Female individuals with a genotype of GG belong to low egg production individuals, and female individuals with a genotype of CC or CG belong to high egg production individuals. The molecular marker provided by the present invention can be used for early artificial breeding of the egg production trait of female sturgeons, and can be widely used in a variety of sturgeon female groups such as Acipenser schrenckii, Acipenser dabryanus, Acipenser Siberianus and hybrid sturgeon, thereby significantly accelerating the breeding process of high-egg-producing sturgeon varieties.

Description

Technical Field

[0001] The present invention belongs to the field of sturgeon genetic breeding and sturgeon molecular marker-assisted breeding, and particularly relates to a SNP molecular marker for identifying the spawning amount of female sturgeons and an application thereof. Background Art

[0002] Sturgeon meat is firm, nutritious, and delicious. Sturgeon caviar, prepared from its roe, is a traditional delicacy in Europe and the United States, known as "black gold" and ranked alongside truffles and foie gras as one of the world's three major delicacies. Therefore, female sturgeon egg production, as a crucial economic trait, is closely linked to aquaculture profitability and production costs, directly impacting the economic development of the sturgeon industry. The most direct way to improve the economic efficiency of female sturgeons is to increase their egg production. The egg production difference between high- and low-producing individuals in a population with the same parental origin and culture environment can be as much as 10%. Therefore, research on how to artificially select female sturgeons with high egg production is crucial for improving the efficiency of sturgeon production and reproduction.

[0003] Single nucleotide polymorphism (SNP), first proposed by American scholar Lander in 1996, refers to DNA sequence polymorphism caused by variations in a single base within a genomic DNA sequence. These variations occur through transversions, transitions, deletions, and insertions, with transitions and transversions accounting for the vast majority of mutations, while insertions and deletions are almost negligible. As third-generation molecular markers, SNPs offer high density, low mutation rate, diallelic polymorphism, and strong representativeness. They are currently widely used in animal and plant species identification, kinship analysis, and new breed breeding. In recent years, SNP molecular marker technology has been widely applied in molecular breeding research for aquatic animals, playing a crucial role in the development and cultivation of superior breeds. Therefore, screening molecular markers associated with economic traits and applying them to early breeding selection is crucial for shortening generation intervals and improving the efficiency and accuracy of aquatic animal breeding.

[0004] 17β-hydroxysteroid dehydrogenase (17β-hsd) is a major enzyme involved in estrogen synthesis. Type I 17β-hydroxysteroid dehydrogenase (17β-hsd1) converts the less active estrone (E1) into the more active estradiol (E2), while type II 17β-hydroxysteroid dehydrogenase (17β-hsd2) converts estradiol (E2) into estrone (E1), acting as a key enzyme in estrogen inactivation. Studies have shown that decreased 17β-hsd2 expression leads to abnormal local estrogen levels, thereby affecting gonadal development in aquatic animals. Exogenous estradiol also promotes the synthesis of yolk protein in sea urchins, thereby promoting ovarian development and oogenesis. Progesterone and estradiol (E2) may stimulate and regulate ovarian development in Chinese shrimp. Evidence suggests that E2 can increase the ovarian gonadal index and promote oocyte maturation in Chinese mitten crabs during ovarian development to stages III-IV, with oocyte diameter significantly increasing. These studies suggest that the 17β-hsd2 gene may regulate the synthesis of multiple estrogens, thereby participating in the recruitment and ovulation of primordial follicles in the ovaries of aquatic animals and ultimately influencing ovarian reserve. To date, no single-nucleotide polymorphisms (SNPs) associated with spawning in sturgeons have been identified in the regulatory region of the 17β-hsd2 gene. Summary of the Invention

[0005] In order to facilitate the identification of the egg production of female sturgeons, the present invention provides a SNP molecular marker for identifying the egg production of female sturgeons and its application.

[0006] The primer pair described in this invention can detect the genotype of a specific SNP site in the 17β-hsd2 gene. This SNP site is significantly associated with the reproductive traits of female sturgeons. Therefore, by screening the SNP site genotype of individuals with high spawning capacity, early selection of female sturgeons for high reproductive traits and genetic improvement of the breed can be carried out.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A single-nucleotide polymorphism (SNP) molecular marker for identifying the egg production of female sturgeons. The SNP molecular marker for identifying the egg production of female sturgeons is located at bp 333 of the 17β-hsd2 gene nucleotide fragment (SEQ ID NO: 1). Its polymorphism is C / G, and the genotype of the base mutation site includes CC, CG, or GG.

[0009] The nucleotide sequence of the detection primer pair for detecting the above SNP molecular marker is:

[0010] Forward primer F: 5'-CCCTTCTGGTGAGAGACTCTGTAG-3', SEQ ID NO: 2,

[0011] Reverse primer R: 5′-TACTCATCCAAAAAAATGGACTCTT-3′, SEQ ID NO: 3.

[0012] An application of the SNP molecular marker or the detection primer in identifying the spawning amount of female sturgeons comprises the following steps:

[0013] Step 1: extracting genomic DNA from the fin ray tissue of the female sturgeon to be tested;

[0014] Step 2: using detection primers to perform PCR amplification on sturgeon genomic DNA to obtain a 17β-hsd2 gene nucleotide fragment;

[0015] Step 3: Detect the genotype at 333bp of the PCR amplification product; among them, female individuals with genotype GG belong to low egg-laying individuals (egg weight / body weight <0.15), and female individuals with genotypes CC and CG belong to high egg-laying individuals (egg weight / body weight >0.2).

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker associated with the egg production trait of female sturgeons. The SNP molecular marker is located at the 7824th base pair of the 17β-hsd2 gene on chromosome NC_081207.1 of sturgeon (i.e., the 333rd base pair of the 17β-hsd2 gene nucleotide fragment (SEQ ID NO: 1)). The SNP site contains a C / G base mutation and is significantly correlated with the egg production trait of female sturgeons. Individuals with the GG genotype have significantly lower egg production than those with the CC and CG genotypes. The genotyping results of this SNP molecular marker match the actual egg production trait by as much as 75.58%. The molecular marker provided by the present invention can be used for early artificial selection of female sturgeons for the spawning trait, and can be widely applied to a variety of female sturgeon populations, such as Acipenser schrenckii, Acipenser dabryanus, Acipenser siberianus and hybrid sturgeon. The SNP site of the gene 17β-hsd2 related to the spawning trait of sturgeons lays a theoretical foundation for molecular marker-assisted selection of female sturgeons with high fertility traits, thereby significantly accelerating the breeding process of high-spawning sturgeon varieties.

[0018] The present invention accelerates the genetic selection process of the spawning capacity trait of female sturgeons through the dominant allele type of SNP molecular markers, and significantly shortens the breeding cycle of sturgeon reproductive traits, thereby saving the cost of artificial propagation of sturgeons and effectively improving the economic benefits of the sturgeon farming industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the three genotype sequencing peak diagrams of the PCR amplification products in Example 1 of the present invention. DETAILED DESCRIPTION

[0020] The technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only part of the embodiments of the invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0021] Example 1:

[0022] Identification of polymorphic sites in the 17β-hsd2 gene of female sturgeon.

[0023] 1. Procurement of High- and Low-Egg-Producing Female Sturgeons for Testing: All fish used in this experiment were obtained from Hangzhou Qiandao Lake Sturgeon Technology Co., Ltd. Eighty-six robust, healthy, and healthy adult females were selected, measuring 138.77 ± 36.68 cm in length and 26.47 ± 6.28 kg in weight. After dissection, egg retrieval, and weighing, 17 females with egg production exceeding the 20th percentile were designated as the high-egg-producing group, while 69 females with egg production below the 15th percentile were designated as the low-egg-producing group. Fins were clipped and used as samples for genomic DNA extraction, which were stored at -20°C for subsequent experiments.

[0024] 2. Extract genomic DNA from the fin ray tissue of the female sturgeon to be tested: Use a column-based animal tissue genomic DNA extraction kit to extract fin genomic DNA. After extraction, DNA quality and integrity were assessed by electrophoresis on a 1% agarose gel. DNA concentration was determined using a NanoDrop 2000 spectrophotometer. Genomic DNA samples that met the required concentration and showed good integrity were stored at -20°C until further use.

[0025] 3. Amplify the nucleotide fragment containing the SNP site

[0026] 3.1 Primer design: The DNA sequence corresponding to the 17β-hsd2 gene (NCBI accession number: LOC117424683) was downloaded from the sturgeon genome database (https: / / www.ncbi.nlm.nih.gov / ). Primers were designed based on the partial DNA sequence of the 17β-hsd2 gene, including:

[0027] Forward primer F: 5'-CCCTTCTGGTGAGAGACTCTGTAG-3' (SEQ ID NO: 2)

[0028] Reverse primer R: 5'-TACTCATCCAAAAAAATGGACTCTT-3' (SEQ ID NO: 3).

[0029] The amplified region of the primer is 546 bp in length, and the amplified sequence is shown in SEQ ID NO: 1, which includes a molecular marker site with a C / G mutation at position 333 bp.

[0030] SEQ ID NO: 1

[0031] GTGAAACGGATTTTAATATTTATTTAACGTTCTTTATGTAGGGTGGCACTTTGGTCTA

[0032] AATTAATCGATGAGACATTATTTAAATTAATCCAATTTCCTTTGCACTTGTTGGTTTT

[0033] GTTATTTCGATTAAATAAATAAGACAAAAATATGTTTTTGTTTTGTGATTTAATTTTTT

[0034] TAATGTATTTTTCTTTTGCAGCCAGGCCACGTGTTACTGCTCACAGACTGAATATCTTT

[0035] GCATGAGCATAGTCAAGACAAACAGCTACTGTCACAACAGGTTTCCAGGCATTGATCAAAATTATTATTTATTTCTTAGCAGACGCCCTTATCCAGGG[G / C]AACTTACAATTA TTACAAGATATCACATTATTTTTACATACAATGACATTATTTTTTTACATACAATTACCCATTTATACAGTTGGCTTTTTACTGGAGCAATCTAGGTAAAGTACCTTGCTCAAGGGTACAGCAGCAGTGTCCCCCACCTGGGATTGAACCCACGACCCTCCAGTCAAGAGTCCATTTTTTGGGATGAGTAAAAATTGTAT

[0036] 3.2 PCR Amplification: The PCR reaction system (20 μL) consisted of: 10 μL 2× TSINGKE MasterMix (Blue), 0.8 μL forward primer (10 μmol / L), 0.8 μL reverse primer (10 μmol / L), 1.0 μL template DNA (≥100 ng / μL), and 7.4 μL ddH2O. The PCR reaction conditions were: initial denaturation at 95°C for 5 min, 35 cycles of [95°C denaturation for 30 s, 52°C annealing for 30 s, and 72°C extension for 30 s], and a final extension at 72°C for 10 min.

[0037] 4. Detect PCR amplified fragments and obtain SNP molecular markers: Perform Sanger single-end sequencing on the PCR product in step 3 based on the ABI 3730XL sequencing platform. The genotype at the 333 bp of the PCR amplified product is the genotype of the SNP site. The sequencing peaks of the three genotypes are shown in Figure 2. Figure 1 shown.

[0038] Example 2:

[0039] An expanded population analysis of the polymorphic locus at the 17β-hsd2 genome was performed on 86 female sturgeons from both the high and low spawning groups. Association analysis between the SNP locus and spawning trait was performed using a general linear model (Table 1). This SNP genotype was significantly positively correlated with spawning trait (P < 0.05). Furthermore, the matching rate between the genotyping results of this SNP and the actual spawning trait was 75.58%.

[0040] Table 1 Genotype frequencies of SNPs in high and low spawning groups of sturgeon

[0041]

[0042]

[0043] Note: * indicates significant difference (P < 0.05), ** indicates extremely significant difference (P < 0.01).

[0044] In the process of breeding sturgeon varieties with high spawning capacity, individuals with genotype GG can be selected and eliminated, while individuals with genotype CC and CG can be retained.

[0045] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker for identifying the spawning rate of female sturgeons, characterized by: The SNP molecular marker for identifying high and low egg production in female sturgeons is located at bp 333 of the nucleotide fragment of SEQ ID NO: 1 of the 17β-hsd2 gene. Its polymorphism is C / G, and the genotype of its base mutation site includes CC, CG, or GG. The nucleotide sequence of the detection primer for the above SNP molecular marker is: The forward primer is shown in SEQ ID NO: 2, The reverse primer is shown in SEQ ID NO:

3.

2. Use of the SNP molecular marker according to claim 1 in identifying the spawning rate of female sturgeons.

3. The use according to claim 2, characterized in that The following steps are involved: Step 1: extracting genomic DNA from the fin rays of the sturgeon to be tested; Step 2: using the primers described in SEQ ID NO: 2 and SEQ ID NO: 3 to perform PCR amplification on the genomic DNA of sturgeon to obtain the nucleotide fragment of the 17β-hsd2 gene; Step 3: Detecting the genotype of the SNP molecular marker according to claim 1, wherein female individuals with a genotype of GG are low-egg-laying individuals, and female individuals with a genotype of CC or CG are high-egg-laying individuals.

Images