InDel marker located in chromosome 6 and related to pore density of medicago sativa and application of InDel marker

Abstract

The invention belongs to the technical field of molecular markers, and discloses a molecular marker MsChr696378780 located in a chromosome 6 and related to the pore density of medicago sativa and application of the molecular marker MsChr696378780. GWAS whole genome association analysis is combined with molecular marker development, the alfalfa stomatal density is analyzed, the stable and reliable InDel molecular marker MsChr696378780 which is closely linked with the stomatal density character and has polymorphism is obtained, the InDel marker is obtained by inserting / deleting a fragment TTATTTACAAGTACACCAAAAC on the 96378780th site on the sixth chromosome of alfalfa, and the InDel marker MsChr696378780th site on the sixth chromosome of alfalfa is used for detecting the stomatal density of alfalfa. In addition, a primer pair corresponding to the molecular marker MsChr696378780 is designed. The invention also provides a method for rapidly identifying the pore density of alfalfa by using the InDel molecular marker, and the method is simple and rapid, accurate in identification result and good in popularization and application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an InDel molecular marker related to stomatal density of alfalfa located on chromosome 6 and an application thereof. Technical Background

[0002] With the continuous development and improvement of modern biogenetic technology, molecular marker technology has become an indispensable tool for genetic breeding. It effectively improves the accuracy and efficiency of breeding by accurately tracking genetic markers. Molecular marker-assisted breeding (MAS) technology selects target trait genes by tracking genetic markers, thereby achieving the goal of new material breeding. Among them, InDel (inserted or deleted fragments in the genome) markers play an important role in the breeding of various crops due to their high polymorphism, stability and cost-effectiveness.

[0003] Genome-wide association studies (GWAS) are a powerful tool for revealing the genetic basis of complex traits. They analyze genetic markers in large populations to identify genetic variants associated with traits. By combining molecular markers, GWAS can accelerate the identification of important trait genes and further improve breeding efficiency.

[0004] Alfalfa (Medicago sativa L.) is a perennial forage crop with high nutritional value, which is widely planted in northern my country and the Yangtze and Huaihe River Basin. However, adverse conditions such as drought, water shortage, soil salinization and low temperature pose severe challenges to the growth and yield of alfalfa. Therefore, strengthening the research on stress-resistant breeding of alfalfa is of great significance to ensure the sustainable development of my country's animal husbandry.

[0005] As a key structure on plant leaves, stomata regulate gas exchange and water transpiration, and are essential for plant survival under drought and high-salinity stress. By regulating stomatal density, the plant's ability to adapt to adversity can be enhanced, thereby improving the yield and quality of alfalfa. Plants with low stomatal density can maintain growth in a changing environment through physiological and developmental adaptation. Reducing stomatal density helps plants reduce water transpiration under drought conditions, maintain water balance, and improve water use efficiency under non-stress environments. In a high CO2 environment, plants reduce stomatal density to reduce water loss while maintaining photosynthesis. In the face of heavy metal stress, plants reduce stomatal conductance and intercellular CO2 concentration to reduce heavy metal absorption. The reduction in stomatal density also affects photosynthesis and respiration, and can reduce water loss while ensuring that plants can carry out photosynthesis. Therefore, in the actual alfalfa breeding process, it is of great significance to select alfalfa materials with low stomatal density. However, alfalfa breeding started relatively late, and there are few reports on the use of whole genome association analysis to develop and locate genetic markers related to stomatal density. Therefore, the development of molecular markers related to stomatal density in alfalfa is of great significance for alfalfa variety improvement and cultivation. Summary of the invention

[0006] One of the objectives of the present invention is to provide an InDel molecular marker related to the stomatal density of alfalfa.

[0007] The second object of the present invention is to provide the application of the above-mentioned InDel molecular marker related to the stomatal density of alfalfa.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] The stomatal density-related InDel molecular marker disclosed in the invention is located on chromosome 6 of alfalfa, and the molecular marker is named Ms_Chr6_96378780.

[0010] A primer pair for amplifying the InDel molecular marker associated with stomatal density of alfalfa, the primer pair sequence corresponding to the molecular marker Ms_Chr6_96378780 is:

[0011] Ms_Chr6_96378780-F:GACAATGACAATACGATTTGAATC (shown in SEQ ID NO.1);

[0012] Ms_Chr6_96378780-R: GGTCAAATTCTTTACCGGAG (shown in SEQ ID NO.2).

[0013] The present invention also discloses the application of the molecular marker primer pair in molecular marker-assisted breeding related to stomatal density of alfalfa. That is to say, the molecular marker of the present invention can be used in molecular marker-assisted breeding in the future, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the stomatal density of alfalfa materials, thereby determining the stomatal density of alfalfa. The detection can use a PCR detection method, specifically the molecular marker primer pair, and the detection can also be performed by a sequencing method.

[0014] The present invention also discloses the application of the molecular marker in identifying the stomatal density of alfalfa, especially in screening and identifying the stomatal density of alfalfa. Specifically, the specific steps for identifying the stomatal density of alfalfa are as follows:

[0015] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the above molecular marker Ms_Chr6_96378780 was used for PCR amplification. The reaction system of PCR amplification is shown in Table 1:

[0016] Table 1 PCR amplification reaction system

[0017]

[0018]

[0019] Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 56°C for 24 s, extension at 72°C for 24 s, 40 cycles; extension at 72°C for 10 min; storage at 4°C.

[0020] (2) Agarose gel electrophoresis detection of PCR products: Take 2.5 μL and judge the stomatal density of alfalfa based on the results of the bands.

[0021] PCR amplification was performed using primer pairs Ms_Chr6_96378780-F and Ms_Chr6_96378780-R. If the PCR amplification product had only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa was of the low stomatal density type; or if there was both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 228 bp as shown in SEQ ID NO.5, the alfalfa was of the high stomatal density type.

[0022] In addition, the present invention also protects a kit for identifying the stomatal density of alfalfa, wherein the kit comprises primer pairs Ms_Chr6_96378780-F and Ms_Chr6_96378780-R. The other components of the kit are all conventional reagents. Specifically, 10×PCR Buffer, dNTP and Taq DNA polymerase are also included. The present invention has no special restrictions on the concentration of the primer pair, and the primer concentration well known in the art can be used. The present invention has no special restrictions on the sources of the 10×PCR Buffer, dNTP and Taq DNA polymerase, and ordinary PCR amplification reagents well known in the art can be used.

[0023] The kit of the present invention can be used to quickly identify the stomatal density of alfalfa, and can also quickly identify the stomatal density genotype of alfalfa. The specific method refers to the specific steps of identifying the stomatal density of alfalfa, and the PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous low stomatal density genotype; if the PCR amplification product has both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 228 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous high stomatal density genotype.

[0024] The present invention has the following advantages:

[0025] (1) The inventors of the present invention screened out a molecular marker Ms_Chr6_96378780 related to the stomatal density of alfalfa. The molecular marker is located on chromosome 6. The molecular marker Ms_Chr6_96378780 of the present invention can be used to quickly identify the stomatal density of alfalfa.

[0026] (2) Screening using markers linked to stomatal density is conducive to molecular marker-assisted selection breeding. The method is simple and feasible, which is conducive to improving efficiency and saving costs.

[0027] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be simply, quickly and high-throughput applied to alfalfa stomatal density-related molecular marker-assisted breeding practice and material identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The whole genome association analysis result of stomatal density of alfalfa is a Manhattan diagram obtained by EMMAX software analysis. The green dots indicate the InDel positions associated with the present invention.

[0029] Figure 2 The box plot of the stomatal density distribution corresponding to the genotype of the Ms_Chr6_96378780 locus of the alfalfa population in Example 1 of the present invention is shown. 0 / 0 means that the genotype of the Ms_Chr6_96378780 locus is a homozygous low stomatal density genotype, 0 / 1 means that the Ms_Chr6_96378780 locus is a heterozygous high stomatal density genotype, the dots are the extreme values ​​of the data, and **** represents P < 0.0001.

[0030] Figure 3 This is the partial sequence alignment result of low pore density materials and high pore density materials in the pore density related region. Figure 4 This is the electrophoresis diagram of the molecular marker amplified from 17 alfalfa germplasm resources at the Chr6_96378780 site. The concentration of the agarose gel is 3%.

[0031] In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0033] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0034] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0035] Example 1 Development of molecular markers related to stomatal density in alfalfa

[0036] The present invention measures the stomatal density of alfalfa by the stomatal density of the initial flowering stage of alfalfa. The higher the value, the higher the stomatal density of the alfalfa material; the lower the value, the lower the stomatal density of the alfalfa material. The stomatal density of the alfalfa population at the initial flowering stage was measured, and an InDel site ( Figure 1Green site), named Ms_Chr6_96378780. This site is located at the 96378780 site on chromosome 6 of the alfalfa reference genome, where the first allele type is 0 / 0; its second allele type is 0 / 1. The stomatal density distribution box plot corresponding to the genotype of the population Ms_Chr6_96378780 site ( Figure 2 ), indicating that the stomatal density of the alfalfa material with genotype 0 / 1 is significantly different from that of the alfalfa material with genotype 0 / 0. At the 96378780th site on chromosome 6 of alfalfa, the insertion / deletion fragment TTATTTACAAGTACACCAAAAC (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the stomatal density of alfalfa. The alfalfa into which the fragment shown in SEQ ID NO.3 is inserted is a low-stomatal density alfalfa; the alfalfa into which the fragment shown in SEQ ID NO.3 is deleted is a high-stomatal density alfalfa.

[0037] Based on the InDel variation and its upstream and downstream sequences, the following primers were designed using SnapGene:

[0038] Ms_Chr6_96378780-F: GACAATGACAATACGATTTGAATC (shown in SEQ ID NO.1);

[0039] Ms_Chr6_96378780-R: GGTCAAATTCTTTACCGGAG (shown in SEQ ID NO. 2).

[0040] The primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous alfalfa material with low stomatal density had only a 250bp characteristic band, while the PCR product of the heterozygous alfalfa material with high stomatal density had both a 250bp characteristic band and a 228bp characteristic band.

[0041] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0042] 224 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0043] Table 2 Stomatal density at the initial flowering stage of 224 germplasm materials and the genotype corresponding to the Chr6_96378780 locus

[0044]

[0045]

[0046]

[0047] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0048] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×Taq PCR Master Mix 10μL, deionized water to 20μL; the reaction program of PCR amplification is preferably: 94℃ pre-denaturation for 4min; 94℃ denaturation for 30s, 56℃ annealing for 24s, 72℃ extension for 20s, 40 cycles; 72℃ extension for 10min; 4℃ storage. 3% agarose gel electrophoresis separation, after spotting, electrophoresis at 120V DC voltage for 80min, and then read the PCR band type of each sample.

[0049] 2) judging the stomatal density of alfalfa according to the size of the PCR product: when the fragment shown in SEQ ID NO.3 is missing in the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with high stomatal density;

[0050] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa of low stomatal density;

[0051] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 250 bp (SEQ ID NO.4), then the alfalfa to be identified is a homozygous low stomatal density alfalfa.

[0052] The sequence of SEQ ID NO.4 is as follows:

[0053]

[0054] When the PCR product of the alfalfa to be identified is two bands, namely a band with the fragment shown in SEQ ID NO.3 inserted and a band with the fragment shown in SEQ ID NO.3 deleted, and one band of the PCR product is 250 bp (SEQ ID NO.4) in length and the other is 228 bp (SEQ ID NO.5), then the alfalfa to be identified is a hybrid high stomatal density alfalfa.

[0055] The sequence of SEQ ID NO.5 is as follows:

[0056]

[0057] In addition, as shown in Table 2, among the 224 alfalfa materials identified in this study, 86 alfalfa materials had a genotype of 0 / 0 at the Chr6_96378780 locus. The average stomatal density of these 86 alfalfa materials was 234.02 / mm 2 , which is a low stomatal density type alfalfa; 163 alfalfa materials have a genotype of 0 / 1 at the Chr6_96378780 locus. The average stomatal density of these 163 alfalfa materials is 248.99 / mm 2 , which is a high stomatal density type of alfalfa. Variance analysis showed that the stomatal density of low stomatal density type and high stomatal density type of alfalfa was significantly different (P < 0.0001). 17 germplasms ('PI632020', 'CF040589', 'CF020828', 'CF050248', 'Pioneer', 'CF050058', 'CF039769', 'CF040664', 'Hulunbuir', 'CF048304', 'Nanmu 601', 'CF039818', 'Caoyuan 1', 'Dongmu 2', 'Gannong 7', 'Wisfal', 'Gongnong 6') were randomly selected and tested by PCR. The test results were consistent with the genotype at the Chr6_96378780 locus and the actual stomatal density measurement results ( Figure 4 ), therefore, the InDel molecular marker of the present invention can effectively identify the high and low stomatal density of alfalfa, and can be used for the prediction and screening of alfalfa materials with low stomatal density.

[0058] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. An InDel marker located on chromosome 6 and associated with stomatal density in alfalfa, the InDel marker being named Ms_Chr6_96378780, characterized in that: The InDel marker is an insertion / deletion fragment TTATTTACAAGTACACCAAAAC at the 96378780th site on chromosome 6 of alfalfa. The primer pair sequence corresponding to the InDel marker is: Ms_Chr6_96378780-F: GACAATGACAATACGATTTGAATC; Ms_Chr6_96378780-R: GGTCAAATTCTTTACCGGAG.

2. Use of the InDel marker according to claim 1 in identifying or assisting in identifying the stomatal density of alfalfa.

3. The use according to claim 2, characterized in that: The method for identifying the stomatal density of alfalfa includes the following steps: (1) extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the InDel-labeled primer pair described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are: PCR amplification was performed using primer pairs Ms_Chr6_96378780-F and Ms_Chr6_96378780-R. If the PCR amplification product had only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa was a low stomatal density type; if the PCR amplification product had both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 228 bp as shown in SEQ ID NO.5, the alfalfa was a high stomatal density type.

4. A kit for identifying the stomatal density of alfalfa, characterized in that: Comprising the primer pair described in claim 1.

5. Use of the kit according to claim 4 in identifying the stomatal density genotype of alfalfa.

6. The use according to claim 5, characterized in that: The method for identifying the stomatal density genotype of alfalfa using the kit is as follows: (1) extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products are subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, then the alfalfa is a low stomatal density genotype; if the PCR amplification product has both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 228 bp as shown in SEQ ID NO.5, then the alfalfa is a high stomatal density genotype.

Images