A wheat scab resistance gene linked molecular marker, primer combination and application

Abstract

The application discloses a wheat scab-resistant gene linked molecular marker, a primer combination and application. The molecular marker W17 is linked to the scab-resistant gene, can be directly applied to wheat scab-resistant production practice, provides technical support for breeding of a wheat improved line carrying the scab-resistant gene, can improve the efficiency of molecular marker assisted selection, thereby speeds up research and utilization of a wheat scab-resistant excellent gene, and provides a new material for wheat disease-resistant genetic improvement. In addition, the application has the advantages of not being affected by external environmental factors, simple and convenient operation and the like.

Description

Technical Field

[0001] This invention belongs to the technical field of wheat molecular breeding, and in particular relates to a wheat Fusarium head blight resistance gene linkage molecular marker, primer combination and application. Background Technology

[0002] Wheat is one of the world's most important food crops. However, current wheat production growth is insufficient to meet the needs of global population growth over the next few decades. A key measure to address this challenge is to improve wheat's resistance to various diseases, which could recover 15-20% of the annual yield loss due to diseases. Fusarium graminearum, causing scab, is a fungal disease of wheat that leads to ear rot, thus threatening wheat yield and quality. In recent years, scab has become a significant disease seriously threatening wheat production.

[0003] Studies have shown that breeding and planting disease-resistant varieties is the most economical and effective measure to solve the problem of Fusarium head blight in wheat. Currently, in production, Fusarium head blight resistance genes can be transferred into commercially available wheat varieties susceptible to the disease. However, traditional methods are time-consuming, labor-intensive, difficult to identify phenotypes, and have low breeding efficiency. Therefore, there is an urgent need to develop Fusarium head blight resistance gene-linked molecular markers for use in genetic analyses such as assisted selection breeding. Summary of the Invention

[0004] To address the technical problems in the prior art, this invention provides a wheat Fusarium head blight resistance gene-linked molecular marker, primer combination, and application. Specifically, this invention includes the following:

[0005] In a first aspect, the present invention provides a primer combination for detecting a gene-linked molecular marker for wheat resistance to Fusarium head blight, wherein the primer combination comprises a forward primer W17-F with the sequence shown in SEQ ID NO.1 and a reverse primer W17-R with the sequence shown in SEQ ID NO.2.

[0006] In some embodiments, the primer combination for detecting wheat scab resistance gene-linked molecular markers according to the present invention, wherein the molecular markers have the sequence shown in SEQ ID NO.3.

[0007] In a second aspect, the present invention provides a wheat resistance gene-linked molecular marker, which is obtained by amplification using the primer combination described in the present invention.

[0008] A third aspect of the present invention provides a kit for detecting wheat scab resistance gene-linked molecular markers, comprising the primer combination described in this invention.

[0009] A fourth aspect of the invention provides the application of the primer combinations, molecular markers, or kits described in the invention in wheat genetic analysis.

[0010] In some embodiments, according to the application described in the present invention, the genetic analysis includes genetic diversity analysis, germplasm identification, or assisted breeding.

[0011] A fifth aspect of the present invention provides a method for identifying whether a plant contains a wheat resistance gene for Fusarium head blight, comprising the step of detecting the presence of a wheat resistance gene-linked molecular marker in the DNA of the plant to be identified using the primer combination described in the present invention.

[0012] In some embodiments, the method for identifying whether a plant contains a wheat resistance gene according to the present invention includes the following steps:

[0013] (1) Extracting sample DNA from the plant sample to be identified;

[0014] (2) The step of amplifying nucleic acids containing the molecular marker from the sample DNA using forward and reverse primers via PCR; and

[0015] (3) The plant was identified by detecting the length of the PCR product of the sample by electrophoresis.

[0016] In some embodiments, according to the method for identifying whether a plant contains a wheat resistance gene against Fusarium head blight according to the present invention, the amplification of a 551 bp DNA band indicates that the sample contains the resistance gene against Fusarium head blight, and the amplification of a 598 bp DNA band indicates that the sample does not contain the resistance gene against Fusarium head blight.

[0017] A sixth aspect of the present invention provides a method for breeding wheat with a gene for resistance to Fusarium head blight, comprising:

[0018] (1) Using disease-resistant materials carrying the Fusarium head blight resistance gene as donor parents and Fusarium head blight-susceptible wheat varieties as recurrent parents, the BC4F1 generation population is obtained by continuous backcrossing. The genotype of the backcross progeny is determined by the primer combination, molecular marker, kit or method described in this invention, and Fusarium head blight phenotype is identified to obtain hybrids carrying the Fusarium head blight resistance gene.

[0019] (2) The hybrid was self-crossed to obtain the BC4F2 generation population. The resistance of individual plants to Fusarium head blight was identified by single seed propagation, and individual seeds carrying the Fusarium head blight resistance gene were obtained.

[0020] (3) Harvest individual plants to obtain BC4F3 generation seeds. Use the primer combination, molecular marker, kit or method described in this invention to determine the genotype of individual plant seeds. If all seeds carry the Fusarium head blight resistance gene, then the individual plant is a homozygous wheat carrying the Fusarium head blight resistance gene.

[0021] The molecular markers of this invention are linked to Fusarium head blight resistance genes and can be directly applied to wheat Fusarium head blight resistance production practices. This provides technical support for breeding improved wheat lines carrying Fusarium head blight resistance genes, improves the efficiency of marker-assisted selection, accelerates the research and utilization of superior Fusarium head blight resistance genes in wheat, and provides new materials for wheat disease resistance genetic improvement. Furthermore, this invention has advantages such as being unaffected by external environmental factors, being simple and convenient to operate, accelerating the breeding process, and having broad application prospects in wheat molecular breeding. Attached Figure Description

[0022] Figure 1 In the diagram, A represents the sequence amplified by the molecular marker W17 in materials that do not carry the Fusarium head blight resistance allelic variant; B represents the sequence amplified by the molecular marker W17 in materials that carry the Fusarium head blight resistance allelic variant (the sequence within the arrow is the primer amplification sequence, and the position of the marker in the middle is the differential series).

[0023] Figure 2 The results of the detection of molecular marker W17 in wheat BC4F2 population samples (M, DL2000 Marker; 1 is the resistant parent, 2 is the susceptible parent, and 3, 4, 5, 6, 7, 8, 9 and 10 are BC4F2 generation single plants).

[0024] Figure 3 Phenotypic identification of Fusarium head blight resistance in individual plants with different molecular markers and the W17 genotype in the BC4F2 wheat population. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Molecular markers

[0029] In one aspect, the present invention provides a specific molecular marker having a characteristic sequence that distinguishes whether a plant (e.g., wheat) carries a gene for resistance to Fusarium head blight.

[0030] The molecular marker (“characteristic sequence”) in this invention refers to a gene fragment that appears only in Fusarium head blight-resistant wheat and is linked to and closely related to the Fusarium head blight resistance gene, wherein the Fusarium head blight resistance gene is the Fusarium head blight resistance gene QFhb-5 located on wheat chromosome 5A. In a preferred embodiment, the molecular marker has the sequence shown in SEQ ID NO.3.

[0031] Primer combination

[0032] One aspect of the present invention provides a primer combination for detecting a molecular marker linked to a wheat scab resistance gene, which is used to amplify the molecular marker described in the present invention, comprising a forward primer and a reverse primer. In a preferred embodiment, the forward primer is W17-F having the sequence shown in SEQ ID NO.1, and the reverse primer is W17-R having the sequence shown in SEQ ID NO.2.

[0033] Reagent test kit

[0034] One aspect of the present invention provides a kit for detecting wheat scab resistance gene-linked molecular markers, comprising the primer combination described herein and optional reagents for polymerase chain reaction (PCR). The reagents for PCR include any reagents used in conventional PCR, such as polymerases, buffers, etc.

[0035] In addition to the components described above, the kit of the present invention may also provide detailed instructions for use, storage, and troubleshooting. The kit may also optionally be housed in a suitable apparatus, preferably for high-throughput robotic operations.

[0036] In some embodiments, the components of the kit of the present invention may be provided as dry powder. When the reagents and / or components are provided as dry powder, the powder may be reconstituted by adding a suitable solvent. It is contemplated that the solvent may also be provided in another container. The container typically includes at least one vial, test tube, flask, bottle, syringe, and / or other container means in which the solvent may optionally be placed in equal portions. The kit may also include means for containing a second container of sterile, pharmaceutically acceptable buffers and / or other solvents.

[0037] In some embodiments, the components of the kit of the present invention may be provided in solution form, such as an aqueous solution. When present in aqueous solution form, the concentration or content of these components can be readily determined by those skilled in the art according to different needs. For example, for storage purposes, the component concentration may be higher, and when in operation or in use, the concentration can be reduced to the working concentration, for example, by diluting the higher concentration solution.

[0038] In kits containing more than one component, the kit typically also includes second, third, or other additional containers for individually holding other components. Additionally, combinations of multiple components may be contained within the containers. Any combination or reagent described herein may be a component of the kit.

[0039] application

[0040] One aspect of the present invention provides the application of the primer combinations, molecular markers, or kits described herein in wheat genetic analysis, including but not limited to genetic diversity analysis, germplasm identification, and assisted breeding. In one specific embodiment, the application includes germplasm identification of wheat resistant to Fusarium head blight. In another specific embodiment, the application includes assisted breeding of wheat resistant to Fusarium head blight.

[0041] Identification methods

[0042] One aspect of the present invention provides a method for identifying whether a plant contains a wheat resistance gene for Fusarium head blight, comprising the step of detecting the presence of a wheat resistance gene-linked molecular marker in the DNA of the plant to be identified using the primer combination described in the present invention.

[0043] In this invention, the method for detecting the presence of wheat resistance to Fusarium head blight gene-linked molecular markers can employ any method known in the art, including methods for amplifying nucleic acids containing characteristic sequences, and methods for directly sequencing the plant genome, etc.

[0044] In some embodiments, the method of the present invention for identifying whether a plant contains a wheat resistance gene for Fusarium head blight includes the step of amplifying a gene sequence containing a characteristic sequence from the DNA of the plant sample to be identified by PCR using forward and reverse primers.

[0045] In an exemplary embodiment, a method for identifying whether a plant contains a wheat resistance gene for Fusarium head blight includes the following steps:

[0046] (1) Extracting sample DNA from the plant sample to be identified;

[0047] (2) The step of amplifying nucleic acid containing the molecular marker from the sample DNA by PCR using forward primers and reverse primers;

[0048] (3) The length of the PCR product of the sample was detected by electrophoresis to identify whether the plant contains the wheat resistance gene against Fusarium head blight.

[0049] In step (1), "plant sample to be identified" refers to the whole plant or a part of the plant, such as plant roots, leaves or plant stems.

[0050] In a preferred embodiment, in step (2), the ratio of forward primer to reverse primer is 1:1. PCR reaction program: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 10 min. The reaction system used for amplification includes: 1 μL DNA template, 5 μL 2×Taq Master Mix, 0.7 μL primer W17-F (10 μmol / L), 0.7 μL primer W17-R (10 μmol / L), and water to 10 μL. In step (3), a 551 bp DNA band is amplified, indicating that the sample contains the Fusarium head blight resistance gene; a 598 bp DNA band is amplified, indicating that the sample does not contain the Fusarium head blight resistance gene.

[0051] Breeding methods

[0052] This invention also provides a breeding method for wheat carrying a Fusarium head blight resistance gene, particularly a breeding method for a homozygous Fusarium head blight resistance genotype. The method includes the steps of using the primer combination, molecular markers, kits, or identification methods of this invention. When the Fusarium head blight resistance gene is detected and the wheat exhibits a Fusarium head blight resistance phenotype, the hybrid offspring are identified as a hybrid carrying the Fusarium head blight resistance gene. In step (2), the single-seed transfer method is not particularly limited and can be performed using methods known in the art.

[0053] Example 1

[0054] The development of the molecular marker W17 is illustrated below.

[0055] Using software, whole-genome resequencing was performed on the resistant parent SNDH-28 to obtain sequence information. The obtained sequencing data was then aligned to a reference genome (Fielder). Primers were designed based on the reference sequences surrounding differentially expressed sites between the susceptible parent Fielder genome database and the resistant parent SNDH-28. Figure 1 Genomic DNA was extracted from the two parent wheat plants. After PCR amplification and sequencing analysis, the amplified sequences showed differences, leading to the design of specific primers to identify the wheat chromosome 5A resistance gene against Fusarium head blight. SNDH-28 is a hybrid offspring of the wheat tetraploid London and Aegilops scabra.

[0056] Example 2

[0057] The following illustrates the transfer and utilization of the wheat Fusarium head blight resistance gene QFhb-5 using molecular marker W17-assisted selection.

[0058] Using an artificial climate chamber, the BC4F1 generation was obtained by backcrossing four times with the resistant SNDH-28 as the donor parent and the susceptible Fielder as the recurrent parent, combined with marker-assisted selection. Then, individual plants of the BC4F1 generation were self-pollinated once to obtain the BC4F2 generation, which was then planted in the artificial climate chamber. The resistance of individual plants to Fusarium head blight was determined using a single-seed transfer method. Figure 3 ), retain individual plants with good resistance to Fusarium head blight.

[0059] Example 3

[0060] The following describes a method for identifying wheat scab resistance genotypes based on the molecular marker W17.

[0061] 1. Genomic DNA was extracted from the samples using the CTAB method.

[0062] The specific steps for extracting DNA from wheat samples using the CTAB method are as follows:

[0063] Cut 2-3 cm wheat leaves and place them in a 2 mL centrifuge tube. After freezing the leaves in liquid nitrogen, quickly grind them into powder. Add 700 μL of preheated 65°C CTAB extraction buffer and incubate at 65°C for 45 min. Then, add an equal volume of chloroform, mix well, and let stand for 3 min. Centrifuge at 12000 rpm for 10 min, then extract 500 μL of the supernatant. Add 500 μL of isopropanol and 50 μL of sodium acetate, mix well, and let stand for 15 min. Subsequently, centrifuge at 12000 rpm for 10 min, discard the supernatant, and the precipitate is genomic DNA. Wash twice with 500 μL of 70% ethanol, dissolve the precipitate in water, and store at low temperature for later use.

[0064] 2. PCR amplification using extracted DNA as a template.

[0065] The PCR reaction system includes: 1 μL DNA template, 5 μL 2×Taq Master Mix, 0.7 μL each of primers W17-F and W17-R at a concentration of 10 μmol / L, and water added to a final volume of 10 μL.

[0066] The PCR reaction program is as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 10 min.

[0067] 3. Polyacrylamide gel electrophoresis for detecting PCR products

[0068] Electrophoresis analysis showed that primers W17-F and W17-R amplified a 551 bp band, indicating that wheat BC4F2 generation plants 7, 8, 9, and 10 carried the Fusarium head blight resistance allelic variant gene; a 598 bp band amplified the band, indicating that wheat BC4F2 generation plants 3, 4, 5, and 6 did not carry the Fusarium head blight resistance allelic variant gene. Figure 2 ).

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. These modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer combination for detecting a molecular marker for resistance to scab in wheat, characterized by, The primer combination comprises a forward primer W17-F with the sequence as shown in SEQ ID NO. 1 and a reverse primer W17-R with the sequence as shown in SEQ ID NO. 2, and the sequence of the molecular marker is as shown in SEQ ID NO. 3, wherein the base at position 476 of the sequence is A or AGGACAGAAAGAGTAATTGCTTGTGGGCGTTGCATGGGCATGGAGGTC.

2. A molecular marker for resistance to scab in wheat, characterized in that, The sequence of the molecular marker is as shown in SEQ ID NO. 3, wherein the base at position 476 of the sequence is A or AGGACAGAAAGAGTAATTGCTTGTGGGCGTTGCATGGGCATGGAGGTC, which is amplified by the primer combination of claim 1.

3. A kit for detecting a molecular marker for resistance to scab in wheat, characterized by, The sequence of the molecular marker is as shown in SEQ ID NO. 3, wherein the base at position 476 of the sequence is A or AGGACAGAAAGAGTAATTGCTTGTGGGCGTTGCATGGGCATGGAGGTC, which comprises the primer combination of claim 1.

4. Use of the primer combination of claim 1, the molecular marker of claim 2 or the kit of claim 3 in detecting the scab resistance phenotype of wheat.

5. Use of the primer combination of claim 1, the molecular marker of claim 2 or the kit of claim 3 in assisted breeding of scab resistance wheat.

Images