An indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus

Abstract

The present invention discloses an indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus, belonging to the technical field of biological detection. The kit includes an enzyme-labeled plate coated with an antigen; the antigen is a recombinant BICP0 protein; the coding gene sequence of the recombinant BICP0 protein is as shown in SEQ ID NO.2. On the basis of analyzing the specificity of the non-structural protein of bovine infectious rhinotracheitis virus, the present invention selects the non-structural protein BICP0 with high expression in Escherichia coli after codon optimization as the coated antigen, and establishes an ELISA method for detecting antibodies against bovine infectious rhinotracheitis virus. It can not only be used to detect the infection of bovine infectious rhinotracheitis in non-immunized cattle farms, but also can be used to screen cattle infected with field virus in a high-throughput manner in cattle farms immunized with inactivated bovine infectious rhinotracheitis vaccine. By combining immunization and detection and elimination, the efficiency and effect of preventing and controlling bovine infectious rhinotracheitis are improved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly to an indirect ELISA kit for detecting antibodies against infectious bovine rhinotracheitis virus infection. Background Art

[0002] Infectious Bovine Rhinotracheitis (IBR) is an acute, febrile, contagious disease of cattle caused by Infectious Bovine Rhinotracheitis Virus (IBRV). Infected cattle may exhibit various symptoms such as respiratory symptoms, reproductive tract symptoms, abortion, and decreased milk production, causing serious economic losses to the cattle industry.

[0003] The best ways to prevent and control this disease are vaccination and purification and culling. Currently, there are mainly two types of vaccines for infectious bovine rhinotracheitis in China: bovine viral diarrhea / mucosal disease, bovine infectious rhinotracheitis combined inactivated vaccine (Huawit, Tiankang, Jinyu Baoling and other companies), and bovine infectious rhinotracheitis inactivated vaccine (strain C1) (Beijing Shengtai'er). These vaccines have good immunogenicity and are suitable for the prevention and control of infectious bovine rhinotracheitis in China. However, the infectious bovine rhinotracheitis virus has a wide range of infection routes, a high rate of latent infection, a long incubation period, and the immune effect of the vaccine may be poor for some reasons. In such cases, individual cattle in the immunized cattle farm may still be infected, continuously discharging the pathogen as a source of infection, resulting in the continuous existence of the disease in the cattle farm. Therefore, it is necessary to detect antibodies against field virus infection in the immunized cattle herd, exclude cattle infected with field virus from the immunized cattle farm, and gradually achieve the purification of the disease. This requires the establishment of a method for detecting field virus infection. Methods for detecting pathogens such as virus isolation and identification, PCR detection, etc. can be achieved, but for latent infections without viremia and virus release, it is difficult to collect suitable samples for detection. The most effective method for detecting field virus infection is still antibody detection because it has the advantages of a long existence time, easy sampling, and can be evaluated even when not in the infection period.

[0004] However, existing IBR antibody detection kits are designed with viral structural proteins as antigens and cannot distinguish between antibodies against field virus infection and antibodies immunized with inactivated vaccines, and cannot screen cattle infected with field virus in the immunized cattle farm. To solve this problem, the present invention analyzed the specificity of the proteins encoded by the infectious bovine rhinotracheitis virus, selected the non-structural protein BICP0 as an antigen to develop an antibody detection kit for infectious bovine rhinotracheitis with strong specificity, high sensitivity, and good accuracy. It can not only be used to screen infected cattle from the cattle farm immunized with inactivated vaccine for virus purification, but also screen infected cattle from non-immunized cattle farms for direct purification, providing an effective means for better prevention and control of infectious bovine rhinotracheitis.

[0005] The existing methods for detecting bovine infectious rhinotracheitis virus infection mainly include two categories: molecular biology methods such as PCR and qPCR, and serological methods such as ELISA. Molecular biology methods have high requirements for experimental conditions and personnel, with low detection throughput, making it difficult to meet the need for large-scale rapid detection. At the same time, the detection of pathogens is only applicable to the infection stage and cannot detect recovered animals, making it difficult to investigate the true extent and scope of infection. Serological methods such as ELISA can detect antibodies and can detect virus infection for a long time. However, they all use viral structural proteins as antigens. In the case of immunization with inactivated vaccines, they cannot distinguish between immune antibodies and antibodies from wild virus infection, and cannot detect wild virus-infected cattle in immunized cattle farms. Summary of the Invention

[0006] The object of the present invention is to provide an indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus to solve the problems existing in the above-mentioned prior art. The indirect ELISA kit provided by the present invention uses the non-structural protein BICP0, which is highly expressed in Escherichia coli after codon optimization, as the coating antigen, and can accurately detect the infection of bovine infectious rhinotracheitis virus in vaccinated and unvaccinated cattle farms.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides an indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus, which comprises an enzyme-labeled plate coated with antigen;

[0009] The antigen is recombinant BICP0 protein;

[0010] The coding gene sequence of the recombinant BICP0 protein is shown in SEQ ID NO.2.

[0011] Further, the enzyme-labeled plate coated with antigen is prepared by the following steps:

[0012] Add carbonate buffer solution containing recombinant BICP0 protein into a 96-well microplate, coat at 37°C for 1 hour, then add PBST containing 5% skim milk powder, block at 37°C for 1 hour, wash and pat dry to obtain.

[0013] Further, in the carbonate buffer solution, the concentration of the recombinant BICP0 protein is 1 μg / mL.

[0014] Further, it also includes washing solution, diluent, enzyme-labeled secondary antibody, chromogenic solution, termination solution, standard IBRV positive serum and standard IBRV negative serum.

[0015] Further, both the washing solution and the dilution solution are PBST solutions; the enzyme-labeled secondary antibody is HRP-labeled goat anti-bovine IgG;

[0016] The chromogenic solution is TMB solution; the termination solution is 10% sulfuric acid solution.

[0017] The present invention also provides a method for detecting antibodies against bovine infectious rhinotracheitis infection for non-disease diagnosis purposes, including the step of detecting antibodies against bovine infectious rhinotracheitis infection using the said kit.

[0018] Further, it includes the following steps:

[0019] Add 20-fold diluted standard IBRV positive serum, standard IBRV negative serum and the sample to be tested into the enzyme-labeled plate coated with antigen respectively, incubate at 37 °C for 30 min, and after incubation, wash the plate 5 times with PBST;

[0020] Add 100 μL of 5000-fold diluted enzyme-labeled secondary antibody to each reaction well, incubate at 37 °C for 30 min, and after incubation, wash the plate 5 times with PBST;

[0021] Add 100 μL of chromogenic solution to each reaction well, and react in the dark until the solution shows obvious blue color;

[0022] After adding 50 μL of termination solution to each reaction well to terminate the reaction, read the OD 450 value, and determine the test result according to the OD 450 value.

[0023] Further, when the OD 450 value of the sample to be tested ≥ 0.213, it is determined as positive, and when the OD 450 value of the sample to be tested < 0.213, it is determined as negative.

[0024] The present invention discloses the following technical effects:

[0025] Based on the analysis of the specificity of bovine infectious rhinotracheitis virus non-structural protein, the present invention selects the non-structural protein BICP0 with optimized codons and highly expressed in Escherichia coli as the coating antigen. The ELISA method for antibodies against bovine infectious rhinotracheitis virus can not only be used to detect the infection of bovine infectious rhinotracheitis in non-immunized cattle farms, but also can be used to screen wild virus-infected cattle in a high-throughput manner in cattle farms immunized with inactivated bovine infectious rhinotracheitis vaccine. It can combine immunization and detection and elimination to improve the efficiency and effect of preventing and controlling bovine infectious rhinotracheitis.

[0026] The indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus provided by the present invention can specifically detect antibodies against wild bovine infectious rhinotracheitis virus and has no cross-reaction with antibodies against other virus infections. Positive control serum and negative control serum are set, and the experimental conditions are strictly controlled, improving the accuracy and reliability of detection, and can accurately detect the infection of bovine infectious rhinotracheitis virus in inactivated vaccine-immunized cattle farms and non-immunized cattle farms. Brief Description of the Drawings

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0028] Figure 1 It is the BLASTP alignment diagram of the BICP0 protein;

[0029] Figure 2 It is the purification electrophoresis diagram of the BICP0 protein;

[0030] Figure 3 They are the negative and positive samples detected by the commercial detection kit in the ELISA detection of Example 4;

[0031] Figure 4 It is the ROC curve of the detection result of the self-built ELISA detection kit of the present invention in Example 4. Detailed Embodiments

[0032] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0034] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention has been described only with respect to preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0035] Without departing from the scope or spirit of this invention, various modifications and variations can be made to the specific embodiments of the specification of this invention, which will be apparent to those skilled in the art. Other embodiments obtained from the specification of this invention will be apparent to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0036] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0037] Example 1

[0038] 1. Bioinformatics analysis of BICP0

[0039] Obtain the protein sequence of BICP0 from the NCBI website and perform BLASTP analysis on its full length and antigenic epitopes ( Figure 1 ), and determine its specificity as an antigen.

[0040] 2. Preparation of recombinant BICP0 protein

[0041] According to the gene sequence of bovine infectious rhinotracheitis BICP0 protein (SEQ ID NO.1), perform codon optimization to obtain a gene sequence (SEQ ID NO.2) that can be highly expressed in Escherichia coli. After gene synthesis, insert it into the pET28a expression vector, transfect Escherichia coli BL21(DE3), and after culturing, induce with IPTG and then perform affinity purification to prepare a high-purity recombinant BICP0 protein.

[0042] SEQ ID NO.1:

[0043] atgcgcgacctgggccataaaagccccgcgcatgcgcgagcagttactttcggtttggggatgacagcggcgactgcggctcgaaagttaagtatgcaggctgggggtcgcaaatacacggcggtgcggtgtggtgggctgcgggtcgcggagtgggtgggcggggagccggccgcggcgattattgccgccaggcgctgccgccgctgcagcggccgagcagcccggccaggctcgggccctggcgaccgcctggctgcggcgccagggccgcgctgctgcggcggggggtccccaggaggctttctcgcacccaggcggccacttccatttcggtgcgccgcctcttctgcgccgagctctcggggccggggtccaggtcgccccgcgccatggcgctcgctggccttctctcccggccggggttgccattgcggccgacctcggcccgggcggctccggccagggccggagcgccggcccgccgggggtcggcggcaggggcgcggccggcgggagacggggtcggggctcgggtggaaatag;

[0044] SEQ ID NO.2:

[0045] atgcgcgatctgggccataaaagcccggcgcatgcgcgcgcggtgacctttggcctgggcatgaccgcggcgaccgcggcgcgcaaactgagcatgcaggcgggcggccgcaaatataccgcggtgcgctgcggcggcctgcgcgtggcggaatgggtgggcggcgaaccggcggcggcgattattgcggcgcgccgctgccgccgctgcagcggccgcgcggcgcgcccgggcagcggcccgggcgatcgcctggcggcggcgccgggcccgcgctgctgcggcggcggcagcccgggcggctttctggcgccgcgccgcccgctgccgtttcgctgcgcggcgagcagcgcgccgagcagccgcggccgcggcccgggccgcccggcgccgtggcgcagcctggcgtttagcccgggccgcggctgccattgcggccgcccgcgcccgggccgcctgcgcccgggcccggaacgccgcccggcgggcggccgccgccagggccgcggccgccgcgaaaccggcagcggcctgggctggaaatag。

[0046] Example 2 Establishment of an indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus

[0047] Coat the ELISA plate with BICP0 protein, then incubate with the serum to be tested and HRP-labeled goat anti-bovine IgG respectively, and develop color. Read the OD 450 value and determine the result.

[0048] Specifically, the present invention provides an ELISA antibody detection kit for bovine infectious rhinotracheitis, comprising the following components:

[0049] ELISA plate: An ELISA plate coated with the antigen (the recombinant BICP0 protein prepared in Example 1, with a concentration of 1 μg / mL);

[0050] Washing and diluent: PBST solution;

[0051] Enzyme-labeled secondary antibody: HRP-labeled goat anti-bovine IgG;

[0052] Chromogenic solution: TMB solution;

[0053] Stop solution: 10% (V / V) sulfuric acid solution;

[0054] Standard IBRV positive serum;

[0055] Standard IBRV negative serum.

[0056] Among them, the preparation method of the enzyme-labeled plate coated with antigen is as follows:

[0057] Add 100 μL of carbonate buffer solution containing 1 μg / mL recombinant BICP0 protein to a 96-well microplate, incubate at 37 °C in an incubator for 1 hour for coating, and then add 200 μL of PBST containing 5% skim milk powder, and incubate at 37 °C for 1 hour to obtain an enzyme-labeled plate coated with antigen.

[0058] The judgment threshold of the result is OD 450 = 0.213. When the OD of the sample 450 ≥ 0.213, it is judged as positive, otherwise it is negative.

[0059] Example 3

[0060] Use the indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis virus established in Example 2 to detect the positive and negative sera of cattle (15 field virus positive sera, 42 IBRV immunized positive and negative sera) and positive sera of common infectious diseases (pasteurellosis, mannheimiosis, clostridium perfringens disease, foot-and-mouth disease, BVDV, nodular dermatitis, mycoplasmosis). The specific method is as follows:

[0061] Add the 20-fold diluted standard IBRV positive serum, standard IBRV negative serum or sample to be tested to the enzyme-labeled plate coated with antigen respectively, incubate at 37 °C for 30 min, and wash the plate 5 times with PBST after incubation;

[0062] Subsequently, add 100 μL of the 5000-fold diluted enzyme-labeled secondary antibody (HRP-labeled goat anti-bovine IgG) to each reaction well, incubate at 37 °C for 30 min, and wash the plate 5 times with PBST after incubation; the diluents of the serum and the secondary antibody are PBST solution containing 5% skim milk powder;

[0063] Add 100 μL of chromogenic solution (TMB solution) to each reaction well, develop color in the dark for 20 min, and the solution shows obvious blue;

[0064] After adding 50 μL of stop solution (10% sulfuric acid solution) to each reaction well to terminate the reaction, read the OD 450 value with an enzyme-labeled instrument. When the OD of the test sample 450 ≥ 0.213, it is judged as positive.

[0065] The results are shown in Table 1. Only the OD of the field virus positive serum 450≥0.213, the test result is positive, and the test results of both the immune positive serum and other positive sera are negative, showing the accuracy of the test.

[0066] Table 1 Test results of bovine positive and negative sera and positive sera of common infectious diseases

[0067]

[0068] Example 4 Conformity test

[0069] Use the indirect ELISA kit for detecting antibodies against bovine infectious rhinotracheitis field virus established in Example 2 and the IBRS-5P ID ELISA antibody detection kit for bovine infectious rhinotracheitis virus to co-detect serum samples from 96 non-immunized cattle farms. The results are based on the commercial kit as the standard. As Figure 3 、 Figure 4 shown, the accuracy of the self-built ELISA detection kit is 96%, the sensitivity is 100%, and the specificity is 96%, showing good detection effects.

[0070] Example 5 Diagnosis of bovine infectious rhinotracheitis infection in non-immunized cattle farms

[0071] In cattle farms where inactivated vaccines against bovine infectious rhinotracheitis have not been immunized, collect blood from 30 cattle through the jugular vein, centrifuge to separate serum, and conduct blind tests according to the method of Example 3.

[0072] Results: The test results of 6 sera were positive, indicating that 6 cattle had been infected with bovine infectious rhinotracheitis virus. After verification by PCR, the test results of the present invention were consistent with the actual infection situation of the animals.

[0073] Example 6 Detection of bovine infectious rhinotracheitis infection in immunized cattle farms

[0074] In cattle farms where inactivated vaccines against bovine infectious rhinotracheitis have been immunized, collect blood from 50 cattle through the jugular vein, centrifuge to separate serum, and conduct blind tests according to the method of Example 3.

[0075] Results: The test results of 2 sera were positive, indicating that 2 cattle had antibodies against bovine infectious rhinotracheitis field virus and had been infected with bovine infectious rhinotracheitis virus. After verification by PCR, the test results of the present invention were consistent with the actual infection situation of the animals.

[0076] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An indirect ELISA kit for detecting bovine infectious rhinotracheitis infection antibodies, characterized in that: The kit includes an ELISA plate coated with an antigen; The antigen is recombinant BICP0 protein; The coding gene sequence of the recombinant BICP0 protein is shown in SEQ ID NO.

2.

2. The kit according to claim 1, characterized in that The antigen-coated ELISA plate is prepared by the following steps: A carbonate buffer solution containing recombinant BICP0 protein was added to a 96-well microplate, and the plate was coated at 37°C for 1 hour. Then, PBST containing 5% skimmed milk powder was added, and the plate was blocked at 37°C for 1 hour. The plate was washed and patted dry.

3. The kit according to claim 2, characterized in that In the carbonate buffer solution, the concentration of the recombinant BICP0 protein was 1 μg / mL.

4. The kit according to claim 1, characterized in that It also includes washing solution, diluent, enzyme-labeled secondary antibody, color development solution, stop solution, standard IBRV-positive serum and standard IBRV-negative serum.

5. The kit according to claim 4, characterized in that The washing solution and diluent are both PBST solutions; The enzyme-labeled secondary antibody is HRP-labeled goat anti-bovine IgG; The color developing solution is TMB solution; The stop solution is 10% sulfuric acid solution.

6. A method for detecting bovine infectious rhinotracheitis infection antibodies for non-disease diagnosis purposes, characterized in that: The method comprises the step of using the kit described in any one of claims 1 to 5 to detect bovine infectious rhinotracheitis infection antibodies.

7. The method according to claim 6, characterized in that The following steps are involved: Add 20-fold diluted standard IBRV positive serum, standard IBRV negative serum and the sample to be tested to the antigen-coated ELISA plate, incubate at 37° C. for 30 min, and wash the plate 5 times with PBST after incubation; Add 100 μL of 5000-fold diluted enzyme-labeled secondary antibody to each reaction well and incubate at 37°C for 30 min. After incubation, wash the plate 5 times with PBST; Add 100 μL of color development solution to each reaction well and react in the dark until the solution turns obviously blue; After adding 50 μL of stop solution to each reaction well to terminate the reaction, read the OD value using a microplate reader. 450 Value, according to OD 450 The value determines the test result.

8. The method according to claim 7, characterized in that When the OD of the sample to be tested 450 When the value is ≥0.213, it is judged as positive. 450 When the value is less than 0.213, it is judged as negative.

Images