EIF4E knockout corn plants for antiviral use

Abstract

The present invention relates to a genetically modified maize plant which is resistant to at least one maize virus, wherein the maize plant comprises a maize cell from which at least one eIF4E gene is knocked out. The maize virus can be a potato Y virus or a horse maize chlorotic mottle virus. The invention also relates to a method for obtaining a genetically modified maize plant resistant to at least one maize virus wherein the method comprises: a) knocking out at least one eIF4E gene in maize cells or maize tissue to obtain knocked-out maize cells or knocked-out maize tissue, and b) regenerating the maize plant from the knocked-out maize cells or the knocked-out maize tissue. The invention also relates to a vector suitable for knocking out at least one corn eIF4E gene.

Description

Field of the Invention

[0001] The present invention relates to resistance of corn to viral diseases. Background Art

[0002] Maize can be affected by many viral diseases, especially those caused by several potato viruses Y, such as Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV), Wheat Streak Mosaic Virus (WSMV), which in combination with MCMV (Maize Chlorotic Mottle Virus (Machlomovirus in the family Tombusviridae)) cause Maize Lethal Necrotic Disease (MLND).

[0003] Insecticide treatments are effective in protecting maize crops from MNLD, and until recently, little research has been done to find alternatives to these treatments. As insecticide controls become more stringent in some parts of the world, this can lead to increased insect pressure and, indirectly, an increase in plant viruses, as insects are important vectors of viruses.

[0004] Plants do have genetic resistance to certain viruses in nature. The infiltration of this genetic resistance in commercial varieties is an alternative to chemical treatment and has no effect on the environment. Resistance to these viruses can be obtained, for example, using natural variation, or by infiltrating QTLs known to confer resistance to such diseases (see Murithi et al., Frontiers in Genetics, 2021, 12, 767883: 1-17) or, for example, using favorable alleles of genes known to be involved in SCMV resistance (see Leng et al., Molecular Plant, 2017, 10: 1357-1359).

[0005] Certain crops do not always have natural resistance. However, similar resistance can be produced through mutagenesis, genetic modification or new breeding techniques.

[0006] eIF4E protein has been used as a gene target to improve genetic resistance in many vegetable crops. eIF4E protein is indeed known to play a role in viral replication in plants. It was first demonstrated that vegetable plants with eIF4E knockout (KO) do confer tolerance to several viruses of the Potyviridae family. However, plant phenotypes associated with eIF4E knockout have been shown to be often impaired, such as delayed bolting, slow growth, affecting fertility and even causing death (see Bastet et al., Trends in Plant Science, 2017, 22 (5): 411-419).

[0007] WO2004 / 057941 discloses a method for conferring viral resistance to plants, the method comprising silencing a gene encoding eIF4E in a plant under conditions effective to confer viral resistance to the plant. For example, silencing is performed in pepper and tomato using an antisense oligonucleotide complementary to the mRNA encoding eIF4E.

[0008] Therefore, there is a need to provide corn plants that are resistant to viral diseases, such as those caused by potato virus Y and / or maize chlorotic mottle virus, as an alternative to treatment with insecticides. Summary of the invention

[0009] The present inventors have surprisingly discovered that knocking out eIF4E confers resistance to viruses in maize, in particular resistance to at least one potato virus Y and / or maize chlorotic mottle virus, without affecting the growth, yield and fertility of the maize plants.

[0010] These results were unexpected because knockout of eIF4E in other plant species has been shown to cause delayed bolting, slow growth, impaired fertility, and even lethality.

[0011] In a preferred embodiment, the eIF4E1 and / or eIF4E2 genes are knocked out to confer virus resistance to maize.

[0012] Without being bound by any theory, the inventors believe that corn plants with knockout of the eIF4E gene remain viable because they also contain the eIFiso4E protein, which may compensate for the absence of the eIF4E protein. The eIFiso4E protein is an isoform of the eukaryotic translation initiation factor 4E. Surprisingly, viral resistance in corn plants according to the present invention cannot be circumvented by recruiting these isoforms by viruses that infect corn.

[0013] In a preferred embodiment, eIF4E gene knockout is obtained by gene editing, preferably using CRISPR-Cas.

[0014] A first object of the present invention is a genetically modified maize cell comprising at least one knocked-out eIF4E gene.

[0015] The eIF4E gene may be the eIF4E1 gene or the eIF4E2 gene.

[0016] The genetically modified maize cell as defined above may comprise a knocked out eIF4E1 gene and a knocked out eIF4E2 gene.

[0017] Another object of the invention is a genetically modified corn plant or part of said plant resistant to at least one virus that infects corn, wherein said plant or said part comprises a cell as defined above. Said plant is not obtained by means of an essentially biological process.

[0018] Another object of the invention is a genetically modified corn seed resistant to at least one virus infecting corn, wherein said seed comprises a cell as defined above.

[0019] Another object of the invention are the progeny of the genetically modified maize plants as defined above.

[0020] The virus is preferably potato virus Y or maize chlorotic mottle virus.

[0021] The potato virus Y is preferably selected from the group consisting of Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV) and Wheat Streak Mosaic Virus (WSMV).

[0022] The maize chlorotic mottle virus is preferably MCMV (Maize Chlorotic Mottle Virus).

[0023] The genetically modified corn plant as defined above, the part of said plant as defined above or the genetically modified corn seed as defined above may be resistant to at least two viruses infecting corn as defined above.

[0024] Another object of the present invention is a vector suitable for knocking out at least one maize eIF4E gene, wherein said vector comprises:

[0025] a) at least one gRNA expression cassette, wherein the gRNA expression cassette comprises a nucleic acid encoding a gRNA under the control of a promoter, and wherein the gRNA comprises a region complementary to a target region of the maize eIF4E gene, and

[0026] b) Optionally, at least one CRISPR-Cas endonuclease expression cassette.

[0027] Another object of the present invention is a method for obtaining a genetically modified corn plant resistant to at least one virus that infects corn, wherein said method comprises:

[0028] a) knocking out at least one eIF4E gene in a corn cell or corn tissue to obtain a knockout corn cell or a knockout corn tissue, and

[0029] b) Regenerating corn plants from the knockout corn cells or knockout corn tissues.

[0030] The step of knocking out at least one eIF4E gene may comprise introducing at least one vector as defined above into said maize cell or maize tissue.

[0031] Another object of the present invention is a method for identifying a corn plant that is resistant to at least one virus that infects corn, wherein the method comprises evaluating (i) the expression of at least one eIF4E protein and / or (ii) the sequence of at least one eIF4E gene, wherein (i) in the absence of expression of the at least one eIF4E protein, and / or (ii) in the presence of a mutation in the sequence of the at least one eIF4E gene that results in a non-functional eIF4E gene, the corn plant is identified as being resistant to at least one corn virus. DETAILED DESCRIPTION

[0032] Maize eIF4E gene and protein

[0033] The term "eIF4E" refers to eukaryotic translation initiation factor 4E.

[0034] The eIF4E protein is a translation initiation factor encoded by the eIF4E gene.

[0035] There are two maize eIF4E proteins: the eIF4E1 protein encoded by the eIF4E1 gene and the eIF4E2 protein encoded by the eIF4E2 gene.

[0036] A reference sequence of the native zein eIF4E1 is, for example, the sequence SEQ ID NO: 1, also referred to as Zm00001d041682_eIF4E1 in the B73 genome version 4 (identified as ZmA188v1aHC012309_eIF4E1 in the J1A genome derived from A188). Zein eIF4E1 may comprise or consist of a sequence that is at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 98% or at least 99% identical to the sequence SEQ ID NO: 1. Zein eIF4E1 preferably comprises or consists of the sequence SEQ ID NO: 1.

[0037] The eIF4E1 gene is located on chromosome 3, more precisely at chr3:133075625-133080137 in version 4 of the B73 genome.

[0038] The eIF4E1 gene contains 5 exons. Exon 1 is located at chr3:133075814-133076061 of the B73 strain. Exon 2 is located at chr3:133077529-133077694 of the B73 strain.

[0039] The reference sequence of the natural eIF4E1 gene is, for example, the sequence SEQ ID NO:8.

[0040] A reference sequence for the native zein eIF4E2 is for example the sequence SEQ ID NO: 2, also known as Zm00001d041973_eIF4E2 in the B73 genome version 4 (identified as ZmA188v1aHC012641_eIF4E2 in the J1A genome derived from A188).

[0041] Zein eIF4E2 may comprise or consist of a sequence that is at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO: 2. Zein eIF4E1 preferably comprises or consists of the sequence of SEQ ID NO: 2.

[0042] The eIF4E2 gene is located on chromosome 3, more precisely at chr3:146285064-146288191 (minus strand) in version 4 of the B73 genome.

[0043] The eIF4E2 gene contains 5 exons. Exon 1 is located at chr3:146288074-146287821 of the B73 strain. Exon 2 is located at chr3:146286386-146286221 (minus strand) of the B73 strain.

[0044] The reference sequence of the natural eIF4E2 gene is, for example, the sequence SEQ ID NO:9.

[0045] Maize contains a single copy of the eIF4E1 gene and a single copy of the eIF4E2 gene.

[0046] The skilled person knows how to easily locate the eIF4E1 and eIF4E2 genes, and the corresponding exons 1 and 2, in a given maize line, for example by sequence alignment with the sequences of said corresponding genes and exons as defined above in the B73 line.

[0047] Maize apb1 gene

[0048] The apb1 gene is located on chromosome 3 of maize, more precisely at position chr3:3:134550012-134554530 in version 4 of the B73 genome.

[0049] The reference sequence of the apb1 gene is, for example, the sequence SEQ ID NO:10.

[0050] The apb1 gene encodes the protein APB1.

[0051] The reference sequence of the native zein APB1 is the sequence SEQ ID NO: 11, also known as Zm00001d041711_APB1 in the B73 genome version 4.

[0052] The Apb1 gene is located between the eif4e1 and eif4e2 loci. In some lines, regulatory sequences in the promoter of the apb1 gene have been identified as being responsible for resistance to Sugarcane Mosaic Virus (SCMV), a potato virus Y (see Leng et al., 2017).

[0053] Corn virus

[0054] "Maize virus" or "maize-infecting virus" refers herein to a virus capable of infecting maize.

[0055] The maize virus as defined above is preferably potato virus Y or maize chlorotic mottle virus.

[0056] Potatovirus Y may for example be selected from the group consisting of Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV) and Wheat Streak Mosaic Virus (WSMV).

[0057] An example of the maize chlorotic mottle virus is MCMV (Maize Chlorotic Mottle Virus).

[0058] Thus, the expression "resistance to at least one corn virus" as used herein refers to resistance to diseases resulting from infection with said at least one virus that infects corn.

[0059] The disease may be, for example, maize lethal necrosis disease (MLND), which is caused by a combination of (i) MCMV and (ii) SCMV, MDMV, WSMV or other potato virus Y.

[0060] Genetically modified corn cells

[0061] Therefore, the present invention relates to a genetically modified maize cell, wherein the cell comprises at least one knocked-out eIF4E gene.

[0062] As used herein, "maize cell" or "maize plant cell" refers to a maize cell obtained or found from a seed, suspension culture, embryo, meristem, callus, leaf, root, shoot, gametophyte, sporophyte, pollen, or microspore.

[0063] Genetically modified maize cells also include protoplasts, in particular obtained from tissues as defined above, as well as cells from or found in plant cell tissue cultures or plant calli from which plants can be regenerated.

[0064] The knocked-out eIF4E gene is the endogenous eIF4E gene.

[0065] "Endogenous gene" herein refers to a gene that is naturally present in a maize cell.

[0066] The eIF4E gene is in particular as defined above.

[0067] The eIF4E gene knocked out in the genetically modified maize cell, for example, comprises a sequence that is at least 75%, preferably at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence of SEQ ID NO: 8 or SEQ ID NO: 9, or consists of a sequence that is at least 75%, preferably at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence of SEQ ID NO: 8 or SEQ ID NO: 9.

[0068] In one embodiment, the eIF4E gene knocked out in the genetically modified maize cell comprises or consists of the sequence SEQ ID NO:8 or SEQ ID NO:9.

[0069] The eIF4E gene may be the eIF4E1 gene of SEQ ID NO:8 or the eIF4E2 gene of SEQ ID NO:9.

[0070] Thus, a cell as defined above may comprise a knocked out eIF4E1 gene and / or a knocked out eIF4E2 gene.

[0071] The cell as defined above preferably comprises a knocked out eIF4E1 gene and a knocked out eIF4E2 gene.

[0072] "Knocked out gene" refers to a non-functional gene in this article. A knocked out gene can no longer express the full-length protein originally encoded by the gene.

[0073] In other words, the knocked-out gene can no longer express a functional protein, which means that the full-length protein originally encoded by the gene is no longer translated, but a non-functional protein can be translated from the knocked-out gene."Non-functional protein" refers herein to a protein lacking at least one function of a functional protein (particularly a native protein).

[0074] The gene can be knocked out by any suitable method known to the skilled person, such as using:

[0075] - a nucleic acid comprising a mutation or a gene to be inserted into the eIF4E gene by homologous recombination,

[0076] - site-specific nuclease for introducing double-strand breaks in the eIF4E gene,

[0077] - a zinc finger nuclease comprising a DNA binding domain and a restriction endonuclease that targets the eIF4E gene, thereby causing a double-strand break in the eIF4E gene,

[0078] - TALEN (Transcription Activator-Like Effector Nuclease) comprising a DNA binding domain and a nuclease targeting the eIF4E gene, thereby causing a double-strand break in the eIF4E gene, and / or

[0079] -Gene editing, for example using the CRISPR / cas system comprising a guide RNA complementary to a target sequence in the eIF4E gene, which complexes with the Cas protein, thereby causing a double-strand break in the eIF4E gene and optionally introducing a desired sequence.

[0080] In this application, the term "gene editing" includes insertion, deletion or substitution of at least one base pair and resulting in knockout, changes in reading frame, specific amino acid changes (including the generation of stop (STOP) codons) or their combination. Gene editing involves DNA strand breaks and DNA damage repair mechanisms such as non-homologous end joining or homologous recombination.

[0081] When a double-strand break occurs in the eIF4E gene, the cellular DNA repair machinery typically attempts to repair the double-strand break by non-homologous end joining (NHEJ), resulting in insertion-deletions (INDELs). INDELs can alter the reading frame and / or introduce nonsense mutations, resulting in a non-functional eIF4E gene and, thus, a disrupted or truncated protein.

[0082] Therefore, gene knockout is different from gene silencing.

[0083] Gene silencing is actually the regulation of gene expression in cells to prevent the expression of a given gene. Gene silencing usually reduces the expression of a gene, but does not completely (or completely) inhibit its expression into a functional protein, which is the opposite of gene knockout. The most popular gene silencing method is RNAi.

[0084] Therefore, the expression "knocked out gene" does not encompass gene mutations that result in reduced expression levels of the protein encoded by the gene.

[0085] The expression "knocked out gene" does not encompass mutations in the promoter of said gene which result in a decrease in the expression level of the protein encoded by said gene.

[0086] In the present application, knockout can be accomplished by introducing at least one mutation, at least one other gene or sequence and / or at least double-strand break in any part of the genomic sequence, including the 5'UTR, 3'UTR, introns, exons and promoter region of the eif4e gene.

[0087] The knockout is preferably accomplished by introducing at least one mutation, at least one other gene or sequence and / or at least a double strand break in any part of the eif4e gene, more preferably within an intron and / or exon.

[0088] Thus, maize cells containing a knocked-out eIF4E1 gene do not express any eIF4E1 protein.

[0089] Thus, maize cells containing a knocked-out eIF4E2 gene do not express any eIF4E2 protein.

[0090] Thus, a maize cell comprising a knocked-out eIF4E1 gene and a knocked-out eIF4E2 gene does not express any eIF4E1 protein nor any eIF4E2 protein.

[0091] A maize cell as defined above may express a non-functional protein from a knocked out eIF4E gene.

[0092] The "non-functional protein encoded by the knocked-out eIF4E gene" herein refers to a protein that cannot participate in protein synthesis.

[0093] Any suitable method can be used to assess whether the protein encoded by the knocked out eIF4E gene is non-functional, such as a yeast complementation assay or any known standard method.

[0094] In the yeast complementation assay, yeast is made deficient in eIF4E protein. If the protein encoded by the knocked-out eIF4E gene is non-functional, the deficient yeast will not grow.

[0095] The non-functional protein as defined above encoded by the knocked-out eIF4E gene preferably has a length of less than 150 amino acids, preferably less than 100 amino acids.

[0096] For example, a non-functional protein as defined above may comprise a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, or may consist of a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0097] In preferred embodiments, the non-functional protein (i) has a length of less than 100 amino acids and (ii) comprises or consists of an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 16 or SEQ ID NO: 17.

[0098] A maize cell as defined above preferably does not comprise any exogenous nucleic acid encoding a maize eIF4E protein, an eIF4E protein from a plant other than maize and / or variants thereof.

[0099] "Exogenous nucleic acid" herein refers to a nucleic acid that does not naturally occur in corn cells. For example, the exogenous nucleic acid can be introduced into the cell by genetic engineering.

[0100] In other words, the maize cell as defined above has not been further genetically modified to express a maize eIF4E protein, an eIF4E protein from a plant other than maize, or a variant thereof.

[0101] The maize cell as defined above preferably expresses at least one endogenous eIFiso4E (eukaryotic translation initiation factor isoform 4E) protein. Thus, the maize cell as defined above preferably expresses the protein eIFiso4E1 and / or the protein eIFiso4E2.

[0102] When part of a corn plant, a corn cell as defined above confers resistance to at least one corn virus to said plant.

[0103] In a particular embodiment, the maize cell as defined above further comprises at least one apbl mutant gene.

[0104] The apb1 gene is as defined above.

[0105] The term "mutated gene" includes at least one mutation, such as insertion, deletion and / or substitution, compared to a wild-type gene, such as the apb1 gene of sequence SEQ ID NO: 10. The at least one mutation may occur in the promoter, untranslated region, coding region (exon) and / or non-coding region (intron) of the gene. The expression of the mutant apb1 gene preferably increases resistance to at least one corn virus conferred by at least one knocked-out eIF4E gene or results in resistance to infection by another virus.

[0106] Preferably, the apb1 promoter comprises a BoxII motif and three SP1 motifs.

[0107] Genetically modified corn plants, parts of said plants or seeds resistant to at least one corn virus

[0108] The present invention particularly relates to genetically modified corn plants that are resistant to at least one virus that infects corn, and genetically modified corn seeds whose parts are resistant to at least one virus that infects corn.

[0109] A part of a corn plant as defined above may be any part of a corn plant.

[0110] As used herein, "maize plant part" refers to a cell, protoplast, tissue or organ (such as an embryo, pollen, ovule, seed, flower, kernel, cob, leaf, stalk, stem, root, root tip, anther, silk, branch, husk or stalk) from the maize plant.

[0111] As used herein, "plant" refers to the whole plant.

[0112] Said plants are not obtained by means of essentially biological processes.

[0113] A genetically modified maize plant as defined above, a part of said plant or a seed comprises a genetically modified maize cell as defined above in the section "Genetically Modified Maize Cell".

[0114] Thus, the cells comprise at least one knocked-out eIF4E gene.

[0115] A genetically modified corn seed that is resistant to at least one virus that infects corn means that a plant grown from the seed is resistant to the at least one virus.

[0116] The maize virus is in particular as defined above.

[0117] The genetically modified corn plant or genetically modified corn seed as defined above may, for example, be resistant to at least one potato virus Y (such as SCMV, MDMV or WSMV) and / or at least one maize chlorotic mottle virus (such as MCMV).

[0118] Thus, the genetically modified corn plant or genetically modified corn seed is resistant to a disease caused by the at least one corn-infecting virus.

[0119] The disease is for example as defined above.

[0120] The genetically modified maize plant or genetically modified maize seed as defined above may for example be resistant to MNLD.

[0121] The genetically modified corn plant or genetically modified corn seed as defined above may be resistant to at least two viruses that infect corn, such as at least three viruses that infect corn or at least four viruses that infect corn.

[0122] The genetically modified corn plant or genetically modified corn seed as defined above may, for example, be resistant to SCMV, MDMV, WSMV and MCMV.

[0123] The genetically modified corn plant or genetically modified corn seed as defined above may, for example, be resistant to SCMV and MCMV.

[0124] Thus, a genetically modified maize plant or a genetically modified maize seed as defined above may for example be resistant to MNLD.

[0125] The maize plant or seed as defined above is preferably an agronomic plant or an agronomic seed.

[0126] "Agronomic plants or agronomic seeds" refers herein to plants or seeds suitable for large-scale production, in particular for human and animal food or for industrial purposes.

[0127] In one embodiment, the plant as defined above is regenerated from a genetically modified tissue or cell, wherein the tissue or cell comprises at least one knocked-out eIF4E gene as described above. For example, the plant is obtained by the following method.

[0128] In one embodiment, a plant as defined above is regenerated from a genetically modified corn seed as defined above. Therefore, the present invention also relates to the offspring of a genetically modified corn plant as defined above, in particular the offspring of a genetically modified corn plant or part of said plant that is resistant to at least one virus that infects corn, wherein said plant is not obtained by means of an essentially biological process, and wherein said plant comprises cells containing at least one knocked-out eIF4E gene.

[0129] In another embodiment, the plant is a descendant of a plant not obtained by means of an essentially biological process as described above.

[0130] The present invention also relates to progeny, variants and / or mutants of said regenerated plants, provided that they comprise cells containing at least one knocked-out eIF4E gene.

[0131] For example, resistance to corn virus can be assessed in vivo by monitoring the development (or absence of development) of corn diseases caused by infection with the corn virus in the genetically modified corn plant to be assessed. The corn virus is preferably inoculated on the plant, for example, by mechanical inoculation. The result is preferably compared with the wild-type corn plant placed under the same conditions. Compared with the wild-type corn plant, the development of corn virus disease in the genetically modified corn plant to be assessed is reduced or the corn virus disease does not develop, indicating that the genetically modified corn plant is resistant to the corn virus.

[0132] Resistance to corn viruses can also be assessed by virus quantification, for example using Elisa or qPCR, which methods allow the presence or absence of viruses and / or the amount of viruses present in the genetically modified corn plants being assessed to be determined by comparison with wild-type corn plants.

[0133] In particular, ELISA is able to measure the extent of viral accumulation, for example using antibodies specific for the corn virus. For example, anti-SCMV, anti-MDMV and anti-MCMV antibodies can be used.

[0134] A corn seed as defined above may be produced from a corn plant as defined above.

[0135] A corn plant as defined above may be produced by growing a corn seed as defined above.

[0136] Vector suitable for knocking out at least one corn eIF4E gene

[0137] The present invention also relates to vectors suitable for knocking out at least one maize eIF4E gene (eg, the maize eIF4E1 gene and / or the maize eIF4E2 gene).

[0138] A vector as defined above may be a plasmid.

[0139] A vector as defined above may comprise:

[0140] a) at least one CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas endonuclease expression cassette, and / or

[0141] b) at least one gRNA expression cassette.

[0142] The vector as defined above preferably comprises:

[0143] a) at least one gRNA expression cassette, wherein the gRNA expression cassette comprises a nucleic acid encoding a gRNA under the control of a promoter, and wherein the gRNA comprises a region complementary to a target region of a maize eIF4E gene, and

[0144] b) Optionally, at least one CRISPR-Cas endonuclease expression cassette.

[0145] The at least one CRISPR-Cas endonuclease expression cassette and the at least one gRNA expression cassette may be provided in the same vector or in different vectors.

[0146] The CRISPR-Cas endonuclease expression cassette comprises a nucleic acid encoding a Cas endonuclease under the control of a promoter.

[0147] Cas endonucleases are enzymes that use gRNA as a guide to recognize specific locations in a DNA sequence and perform double-strand breaks at specific locations. Cas endonucleases generally require the presence of a protospacer adjacent motif (PAM) sequence near a specific targeted location. The PAM sequence is preferably spaced up to 20 nucleotides from the targeted location. The PAM sequence can vary depending on the Cas endonuclease.

[0148] While the Cas endonuclease requires a PAM sequence, the eIF4E gene contains a PAM sequence downstream of the targeted region.

[0149] The Cas endonuclease can be selected from the group consisting of Cas9, Cas12a, Cas12b, C2c1 and C2c2.

[0150] The Cas endonuclease is preferably a Cas9 (CRISPR-associated protein 9) endonuclease. For example, the Cas9 endonuclease may comprise or consist of the sequence SEQ ID NO:7.

[0151] The promoter of the CRISPR-Cas endonuclease expression cassette may be a constitutive promoter selected from the group consisting of the ZmUbi promoter, the 35S promoter or the 19S promoter (Kay et al., 1987), the rice actin promoter (McElroy et al., 1990), the pCRV promoter (Depigny-This et al., 1992), the CsVMV promoter (Verdaguer et al., 1998) and the ubiquitin promoter from rice or sugarcane. The promoter of the CRISPR-Cas endonuclease expression cassette is preferably the ZmUbi promoter.

[0152] The CRISPR-Cas endonuclease expression cassette preferably comprises a terminator, such as SbHSP.

[0153] The gRNA expression cassette contains a nucleic acid encoding the gRNA under the control of a promoter.

[0154] gRNA contains:

[0155] a) a region complementary to a target region of the eIF4E gene, preferably complementary to a target region in an exon of the eIF4E gene, and

[0156] b) A scaffold region that allows binding to the CRISPR-Cas endonuclease encoded by the CRISPR-Cas endonuclease expression cassette.

[0157] The eIF4E gene is particularly as defined above. The target region of the eIF4E gene is preferably located in exon 1 or exon 2 of the eIF4E gene. Exons 1 and 2 of the eIF4E1 gene and exons 1 and 2 of the eIF4E2 gene are particularly as defined above in the section "Maize eIF4E Gene and Protein".

[0158] For example, the promoter of the gRNA expression cassette can be selected from the group consisting of RNA polymerase III promoters (e.g., TaU6 promoter, ZmU6 promoter, or ZmU3), or RNA polymerase II promoters, such as constitutive promoters (e.g., ZmUbi or TaUbi). The promoter of the gRNA expression cassette is preferably a ZmU6 promoter.

[0159] Thus, the gRNA produced by the gRNA expression cassette is capable of recognizing the target region of the eIF4E gene, and thus, when complexed with the CRISPR-Cas endonuclease, introduces a double-strand break in the target region of the eIF4E gene through the action of the CRISPR-Cas endonuclease.

[0160] The gRNA preferably comprises at least 15 nucleotides, preferably at least 17 nucleotides, more preferably at least 18 nucleotides and / or at most 25 nucleotides, preferably at most 24 nucleotides, more preferably at most 23 nucleotides.

[0161] For example, the gRNA can comprise or consist of the sequence SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0162] Method for obtaining a corn plant resistant to at least one corn virus

[0163] The present invention also relates to a method for obtaining a genetically modified corn plant resistant to at least one corn virus, wherein the method comprises:

[0164] a) knocking out at least one eIF4E gene in a corn cell or corn tissue to obtain a knockout corn cell or a knockout corn tissue, and

[0165] b) Regenerating corn plants from the knockout corn cells or knockout corn tissues.

[0166] The maize virus is in particular as defined above.

[0167] Resistance to said at least one corn virus specifically confers resistance to diseases caused by said viruses that infect corn.

[0168] The diseases are in particular as defined above.

[0169] The corn plant resistant to at least one corn virus is in particular as defined above.

[0170] Step a)

[0171] Step a) comprises knocking out at least one eIF4E gene in a corn cell or corn tissue to obtain a knocked-out corn cell or knocked-out corn tissue.

[0172] The eIF4E gene is an endogenous eIF4E gene, in particular as defined above.

[0173] The eIF4E gene can be knocked out by any suitable method known to the skilled person as defined above, such as:

[0174] - homologous recombination with a nucleic acid comprising a mutation or a gene to be inserted into the eIF4E gene,

[0175] - Introducing a double-strand break in the eIF4E gene by: site-specific nuclease, zinc finger nuclease comprising a DNA binding domain targeting the eIF4E gene and a restriction endonuclease, TALEN (transcription activator-like effector nuclease) comprising a DNA binding domain targeting the eIF4E gene and a nuclease, or by gene editing.

[0176] The eIF4E gene is preferably knocked out by gene editing, more preferably using the CRISPR / Cas system.

[0177] The corn cell can be a protoplast.

[0178] The corn tissue may be apical meristem, cotyledons, embryos (preferably immature embryos), pollen, and / or microspores.

[0179] The maize tissue is preferably an immature embryo at 10 days after fertilization.

[0180] The step of knocking out at least one eIF4E gene preferably comprises introducing at least one nucleic acid of interest into said maize cell or maize tissue, preferably introducing at least one vector suitable for knocking out at least one maize eIF4E gene into said maize cell or maize tissue.

[0181] Any method of introducing nucleic acids into cells or tissues can be used, such as transformation or the use of haploid inducible lines.

[0182] Said vector suitable for knocking out at least one maize eIF4E gene is, for example, as defined above.

[0183] When more than one vector is used in step a), it is preferred to transform maize cells or maize tissues with the different vectors simultaneously.

[0184] Any technique suitable for transformation of plant cells or plant tissues may be used, such as biolistic particle delivery, PEG transformation, electroporation or Agrobacterium transgene delivery.

[0185] For Agrobacterium transgene delivery, the vector is first transferred into Agrobacterium to obtain transformed Agrobacterium, which is then used to transform corn cells or corn tissues. The Agrobacterium is preferably Agrobacterium tumefaciens.

[0186] For example, transformation with the transformed Agrobacterium includes co-culturing corn cells or corn tissue with the Agrobacterium, for example, for at least 5 minutes.

[0187] In addition to transformation, vectors can also be introduced using haploid inducible lines or related techniques.

[0188] When using a vector suitable for knocking out at least one maize eIF4E gene as defined above, step a) results in particular in:

[0189] - expression of one or more Cas endonucleases from one or more CRISPR-Cas endonuclease expression cassettes and production of one or more gRNAs from one or more gRNA expression cassettes, thereby generating a double strand break in the eIF4E gene in the plant genome, and

[0190] - Double-strand break repair, in particular by non-homologous end joining (NHEJ), leading to insertions and / or deletions in the targeted eIF4E gene.

[0191] Step b)

[0192] Step b) comprises regenerating a corn plant from the knockout corn cell or the knockout corn tissue.

[0193] The regeneration of plants from plant cells or plant tissues is well known to the skilled person.

[0194] In particular, maize cells or maize tissue can be placed in a culture medium suitable for growing maize plants.

[0195] Regenerating a corn plant from a corn cell or corn tissue may include:

[0196] - growing the maize cells or maize tissue to obtain callus tissue, and

[0197] -Regeneration of shoots from callus tissue.

[0198] Growth of maize cells into callus and regeneration of shoots is carried out in any suitable culture medium, particularly one containing plant growth regulators.

[0199] Growing callus from maize tissue and regenerating shoots from maize tissue can be carried out in any suitable culture medium, particularly in a culture medium comprising a plant growth regulator.

[0200] The method as defined above may also comprise the subsequent step of evaluating whether the eIF4E gene is knocked out in the maize plant obtained.

[0201] For example, this subsequent step can be performed by evaluating the resistance of the obtained corn plant to at least one corn virus (e.g., as defined above). If the obtained corn plant is resistant to at least one corn virus, the eIF4E gene in the obtained corn plant is knocked out compared to the corresponding untransformed corn plant.

[0202] This subsequent step can also be performed by evaluating the expression of the protein encoded by the target eIF4E gene.If the cells of the maize plant do not express the protein encoded by the target eIF4E gene, the eIF4E gene is knocked out in the resulting maize plant.

[0203] Detection of the expression of the protein encoded by the eIF4E gene can be performed according to any method familiar to the skilled person, such as Western blot or immunoassay.

[0204] Method for identifying genetically modified corn plants resistant to at least one virus that infects corn

[0205] The present invention also relates to a method for identifying a corn plant that is resistant to at least one corn virus, wherein the method comprises evaluating (i) the expression of at least one eIF4E protein and / or (ii) the sequence of at least one eIF4E gene, wherein (i) in the absence of expression of the at least one eIF4E protein, and / or (ii) in the presence of a mutation in the sequence of the at least one eIF4E gene that results in a non-functional eIF4E gene, the corn plant is identified as being resistant to at least one corn virus.

[0206] The present invention also relates to a method for identifying a corn plant that is resistant to at least one corn virus, wherein the method comprises evaluating (i) the expression of eIF4E1 and eIF4E2 proteins and / or (ii) the sequence of eIF4E1 and eIF4E2 genes, wherein (i) in the absence of expression of said eIF4E1 and eIF4E2 proteins, and / or (ii) in the presence of mutations in said eIF4E1 and eIF4E2 gene sequences that result in non-functional eIF4E1 and eIF4E2 genes, the corn plant is identified as being resistant to at least one corn virus.

[0207] The maize virus is in particular as defined above.

[0208] The eIF4E protein and the eIF4E gene are in particular as defined above.

[0209] Assessment of eIF4E protein expression can be performed by any method familiar to the skilled artisan, such as Western blot or immunoassay.

[0210] The evaluation of the sequence of at least one eIF4E gene can be performed by any method familiar to the skilled person, such as sequencing. The obtained sequence can then be analyzed to identify possible mutations, for example by comparing the sequence with the sequence of the endogenous eIF4E gene and analyzing whether the mutation, if present, results in a non-functional eIF4E gene.

[0211] The present invention will be further described in the following figures and examples.

[0212] A brief description of the sequence

[0213] SEQ ID NO: 1 corresponds to the sequence of native maize eIF4E1 protein (in Figure 2 A also referred to as ZmA188v1aHC012309_eIF4E1).

[0214] SEQ ID NO:2 corresponds to the sequence of native maize eIF4E2 protein.

[0215] SEQ ID NO: 3 corresponds to the sequence of gRNA14 (ZmeIF4E_a_SpCas9_gRNA14) targeting a region in exon 1 of eIF4E1.

[0216] SEQ ID NO:4 corresponds to the sequence of gRNA47 (ZmeIF4E_b_SpCas9_gRNA47) targeting a region in exon 1 of eIF4E2.

[0217] SEQ ID NO:5 corresponds to the sequence of gRNA ZmeIF4E_a324&b330_SpCas9_gRNA targeting a region in exon 2 of eIF4E1 and eIF4E2.

[0218] SEQ ID NO:6 corresponds to the sequence of gRNA ZmeIF4E_a367&b373_SpCas9_gRNA targeting a region in exon 2 of eIF4E1 and eIF4E2.

[0219] SEQ ID NO:7 corresponds to the sequence of Cas9 (CRISPR associated protein 9) endonuclease.

[0220] SEQ ID NO: 8 corresponds to the genomic sequence of the eIF4E1 gene.

[0221] SEQ ID NO:9 corresponds to the genomic sequence of the eIF4E2 gene.

[0222] SEQ ID NO: 10 corresponds to the genomic sequence of the apb1 gene.

[0223] SEQ ID NO: 11 corresponds to the sequence of native APB1 protein.

[0224] SEQ ID NO: 12 corresponds to the sequence of the eIF4E1 protein encoded by mutant 9_16 ( Figure 2 Allele E1_a_short in A).

[0225] SEQ ID NO: 13 corresponds to the sequence of the eIF4E1 protein encoded by mutant 10_30 ( Figure 2 Allele E1_b_short in A).

[0226] SEQ ID NO: 14 corresponds to the sequence of the eIF4E1 protein encoded by mutant 15_19 ( Figure 2 AlleleE1_c_short in A).

[0227] SEQ ID NO: 15 corresponds to the sequence of the eIF4E2 protein encoded by mutant 14_15 ( Figure 2 allele E2_a in B).

[0228] SEQ ID NO: 16 corresponds to the sequence of the eIF4E2 protein encoded by mutant 58_77 ( Figure 2 AlleleE2_b_short in B).

[0229] SEQ ID NO: 17 corresponds to the sequence of the eIF4E2 protein encoded by mutant 59_83 or 59_74 ( Figure 2 AlleleE2_c_short in B).

[0230] See Table 1 for details of SEQ ID NO: 18-43.

[0231] Table 1

[0232] BRIEF DESCRIPTION OF THE DRAWINGS

[0233] Figure 1 ：Nucleotide sequence alignment between the reference sequences eIF4E1 and eIF4E2 in the J1A line (public gene IDs ZmA188v1aHC012309_eIF4E1 and ZmA188v1aHC012641_eIF4E2) and those of GE-edited plants, focusing on the edited sequences in exons 1 and 2 of the eIF4E gene. The first row corresponds to the physical position on the J1A map. The last code corresponds to the internal reference for the mutation in exon 1, followed by the internal reference for exon 2 (e.g. "AlleleE1a_MutE1_9_16" corresponds to an allele carrying a mutation in exon 1 of eIF4E1 with internal reference "9" and a mutation in exon 2 of eIF4E1 with internal reference "16"). Some alleles can accumulate more than one mutation. AlleleE2cmutE2_13_14_15_16 contains mutations with references "13", "14" and "15" in exon 1 and mutation with reference "16" in exon 2. A: eIF4E1 mutation in exon 1; B: eIF4E1 mutation in exon 2; C: eIF4E2 mutation in exon 1; D: eIF4E2 mutation in exon 2.

[0234] Figure 2 : Protein sequence alignment between the reference sequences eIF4E1 and eIF4E2 in the J1A line (public gene IDs ZmA188v1aHC012309_eIF4E1 and ZmA188v1aHC012641_eIF4E2) and those of the GE edited plants that resulted in a non-functional eIF4E protein. A: eIF4E1 protein sequence of the reference plant and the GE plant mutant form; B: eIF4E2 protein sequence of the reference plant and the GE plant mutant form.

[0235] Figure 3 : Phenotypic analysis of GE plants after virus infection as described in Example 4. A: MCMV and SCMV; B: MCMV and MDMV. A set of 7 independent eIF4E GE lines (plants 1 to 7, see Table 2) and control lines J1A and PA405.

[0236] Example Knockout of the maize eIF4E gene confers complete resistance to maize virus diseases

[0237] Example 1: Identification of the maize eIF4E gene

[0238] Identification of the maize eIF4E sequence has been accomplished by blasting the eIF4E protein sequences of other species. Two eIF4E genes were identified in the maize genome of B73 on chromosome 3, named eIF4E1 and eIF4E2:

[0239] -Zm00001d041682 named eIF4E1,

[0240] -Zm00001d041973 named eIF4E2.

[0241] Example 2: Design of guide RNAs to create knockout mutants of the maize eIF4E1 and eIF4E2 genes

[0242] The design of guide RNAs targeting eIF4E1 and / or eIF4E2 has been done using the Cas-Designer tool (Pack et al., 2015), allowing us to identify suitable guide RNAs to create mutations in the gene resulting in a non-functional protein. Four gRNAs were selected in exon 1 or 2:

[0243] Exon 1 of ZmeIF4E_a_SpCas9_gRNA14 / eIF4E1

[0244] CGACACCAGGCCTGCCTCCG CGG (SEQ ID NO:3)

[0245] Exon 1 of ZmeIF4E_b_SpCas9_gRNA47 / eIF4E2

[0246] CCGTCCTGCGCACGCTACCG AGG (SEQ ID NO:4)

[0247] ZmeIF4E_a324&b330_SpCas9_gRNA / exon 2 of eIF4E1 and eIF4E2

[0248] CAAATAGGGTCTTCCCATTT TGG (SEQ ID NO:5)

[0249] ZmeIF4E_a367&b373_SpCas9_gRNA / exon 2 of eIF4E1 and eIF4E2

[0250] TTTTCCTCTTCCACAGCTGA TGG (SEQ ID NO:6)

[0251] The three underlined nucleotides in the 3' of the above sequence are the PAM sequence.

[0252] Example 3: Generation of GE plants using CRISPRCas9 via the KO / SDN1 approach

[0253] 3.1. Cloning

[0254] The ZmU6 promoter from maize (Zea mays) was used to drive the expression of each of the above gRNAs. DNA fragments of two gRNA transcription systems ZmU6::ZmeIF4E_a324&b330_SpCas9_gRNA and ZmU6::ZmeIF4E_a_SpCas9_gRNA47 were synthesized by GenScript Biotech (Netherlands) and cloned into pUC57 to obtain plasmid geBGA_12189. DNA fragments of two gRNA transcripts ZmU6::ZmeIF4E_a_SpCas9_gRNA14 and ZmU6::ZmeIF4E_a367&b373_SpCas9_gRNA were synthesized in the same manner to obtain plasmid geBGA_12190.

[0255] Four gRNA transcription units from plasmids geBGA_12189 and geBGA_12190 were cloned into binary plasmid pBIOS11975 by Golden Gate reaction to obtain final plasmid pBIOS12487. The T-DNA portion of the vector includes three boxes. One box allows expression of Cas9 endonuclease driven by a strong corn ubiquitin promoter (ZmUbi) sequence, which includes the first intron (Christensen et al., 1992) and the Nos terminator. Another box consists of the ZmUbi promoter and the first intron, the ZsGreen coding sequence (derived from the green fluorescent protein of button coral (Zoanthus sp.); Matz et al., 1999) and the Sac66 terminator sequence (Wang et al., 1998) from the ADGP1 gene of Arabidopsis thaliana for screening purposes. Finally, a selection cassette consisting of the rice actin gene promoter and first intron, the bialaphos resistance (Bar) gene from Streptomyces hygroscopicus (Thompson et al., 1987), and the Nos terminator sequence (Depicker et al., 1982) was included.

[0256] The above binary vector pBIOS12487 was transferred into Agrobacterium LBA4404.

[0257] 3.2. Transformation with Agrobacterium

[0258] According to the scheme of Ishida et al. (1996, Nat Biotechnol, 14 (6): 745-50), on J1A, especially on the immature embryos 10 days after fertilization, genetic transformation is completed by Agrobacterium tumefaciens. All culture media used refer to the references cited. Transformation starts from the co-cultivation stage, at which stage, the immature embryos of corn are contacted with Agrobacterium tumefaciens LBA 4404 containing a binary vector for at least 5 minutes, and the binary vector includes a genetic element for editing the target gene. The embryo is then placed on LSA culture medium and placed in the dark at 25 ° C for 3 days. The transformed callus is selected for the first time: the embryonic callus is transferred to a culture medium containing 5mg / l phosphinothricin LSD5 and 250mg / l cefotaxime (by limiting Agrobacterium tumefaciens to remove contamination). This step is carried out for 2 weeks at 25 ° C in the dark. The second selection step was performed by transferring embryos developed on LSD5 medium to LSD10 medium (10 mg / l phosphinothricin) in the presence of cefotaxime for 3 weeks under the same conditions (temperature and light) as above. The third selection step consisted of cutting callus into type I (1-2 mm fragments) and transferring from LSD 10 medium at 25°C in the dark for 3 weeks to 25°C in the presence of cefotaxime.

[0259] Shoot regeneration was performed by excising proliferating type I callus, proliferating it and transferring it from LSZ on medium in the presence of 5 Mg / l phosphinothricin to cefotaxime for 2 weeks and transferring to 22°C and continuous light.

[0260] After 2 weeks on medium containing 100 mg / l RM+G2, the regenerated seedlings were transferred to 22°C and Augmentin under continuous light for the developmental steps. The obtained plants were then transferred to a phytotron for acclimatization.

[0261] 3.3. Identification of GE plants with mutations that generate stop codons in the eIF4E protein

[0262] Primers are designed around the eIF4E editing site to generate amplicons, which are sequenced to determine the sequence modifications. The goal is then to identify deletions, insertions, or substitutions in the gene sequence. T0 plants are selected when GE mutations in the eIF4E gene can produce sequence modifications that result in non-functional eIF4E proteins. In GE-edited plants, reference sequences (eIF4E1 and eIF4E2) and mutated eIF4E1 and eIF4E2 genes are aligned to select mutations that affect the protein sequence.

[0263] For eIF4E1, we selected five different mutants: 9_16; 10_30; 1_11; 15_19; 15_30, which differ from the reference sequence at the nucleic acid level (the reference sequence of eIF4E1 in the J1A line is the public gene ID ZmA188v1aHC012309_eIF4E1) (see Figure 1 ). These nucleic acid mutants produce different types of mutant proteins, resulting in non-functional proteins. At the protein level, an alignment was performed between the reference sequence of eIF4E1 in the J1A line (public gene ID ZmA188v1aHC012309_eIF4E1) and the mutant eIF4E1 proteins (see Figure 2 ), showing the effect on the protein sequence (deletion or formation of early stop codon). Finally, three different types of mutant proteins were obtained, named alleleE1a / b / c of ​​eIF4E1.

[0264] For eIF4E2, we selected five different mutants: 14_15; 59_83; 59_74; 58_77; 12_14_15_16, which differ from the reference sequence at the nucleic acid level (the reference sequence of eIF4E2 in the J1A line is the public gene ID ZmA188v1aHC012641_eIF4E2) (see Figure 1 ). These nucleic acid mutants produce different types of mutant proteins, resulting in non-functional proteins. At the protein level, an alignment was performed between the reference sequence eIF4E2 (public gene ID ZmA188v1aHC012641_eIF4E2) and the mutant eIF4E2 proteins in the J1A line (see Figure 2 ), showing the effect on the protein sequence (deletion or formation of early stop codon). Finally, three different types of mutant proteins were obtained, named alleleE2a / b / c of ​​eIF4E1 and alleleE2a / b / c of ​​eIFE2.

[0265] Using these alleles for each eIF4E gene, we selected 7 different plants with different combinations of eIF4E1 / eIF4E2 mutations (see Table 2). These T0 plants were self-pollinated to obtain T1 plants homozygous for the mutations.

[0266] Table 2 : corresponds to Figure 3 Description of the truncated protein forms of the eIF4E1 and eIF4E2 mutant alleles in seven plants.

[0267]

[0268] These plants were then subjected to virus infection to assess their resistance to different viruses.

[0269] Example 4: Phenotype of GE plants after infection with SCMV, MDMV and / or MCMV viruses

[0270] Among the selected GE plants, seven independent events (plants 1–7, Table 2 ) carrying different types of mutations on the two eIF4E genes were phenotyped in the greenhouse to evaluate resistance to three different viruses: SCMV and MDMV (Potavirus family) and MCMV (Maize Chlorotic Mottle Viridae), either alone or by combining MCMV and Potatovirus Y to mimic maize lethal necrosis disease.

[0271] Maize inbred line J1A was used as a susceptible control and maize inbred line PA405 as a reference for resistance to potato virus Y. For each event (code plant 1-7, 7 plants were infected and 2 control plants were not infected).

[0272] For each virus infection (5 in total), plants were grown on separate cultivation tables to avoid cross contamination. Growth conditions were 24°C day / 19°C night with a photoperiod of 16 h day / 8 h night.

[0273] 13 days after sowing, plants were infected artificially by mechanical infection of the second or third leaf using freshly infected leaves ground in phosphate buffer (phosphate 0.03 M, containing 0.2% DIECA, pH 7) containing an abrasive (silicon carbide, 20 mg / ml phosphate buffer).

[0274] The first mosaic symptom was observed 7 days post infection (DPI) in susceptible plants (J1A). Scoring was performed weekly until 28 days post infection (28 DPI). The last mosaic symptom was observed on infected plants at 25 dpi. J1A control plants showed mosaic symptoms in all infection modes, with symptoms being more severe under dual infection. PA405 plants did not show mosaic symptoms as expected when infected with PPV Y, but showed severe symptoms when infected with MCMV alone or in combination with PPV Y. For all viral infection modes, no symptoms were observed in all infected plants from 7 independent events: SCMV, MDMV, MCMV, SCMV+MCMV, MDMV+MCMV (Tables 3 and Figure 3 ).

[0275] Table 3 : Results of phenotypic analysis of 7 independent events evaluating resistance to 3 different viruses: SCMV and MDMV (Potavirus family) and MCMV (Maize Chlorotic Mottle Viridae), alone or in combination with MCMV and Potatovirus Y to simulate maize lethal necrosis. R = resistant; S = susceptible

[0276]

[0277] References:

[0278] Christensen et al. (1992). Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol. 1992 Feb;18(4):675-89.

[0279] Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982;1(6):561-73.

[0280] Matz, M., Fradkov, A., Labas, Y. et al. Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol 17, 969–973 (1999).

[0281] Jeongbin Park, Sangsu Bae, Jin-Soo Kim, Cas-Designer: a web-based tool for choice of CRISPR-Cas9 target sites, Bioinformatics, Volume 31, Issue 24, 15 December 2015, Pages 4014–4016.

[0282] Pengfei Leng,Qing Ji,Torben Asp,Ursula K.Frei,Christina R.Ingvardsen,Yongzhong Xing,Bruno Studer,Margaret Redinbaugh,Mark Jones,Priyanka Gajjar,Sisi Liu,Fei Li,Guangtang Pan,Mingliang Xu and Thomas Lübberstedt.AuxinBinding Protein 1Reinforces Resistance to Sugarcane Mosaic Virus in Maize,Molecular plant,volume 10,October 2017,pages 1357-1360.

[0283] Thompson CJ,Movva NR,Tizard R,Crameri R,Davies JE,Lauwereys M,Botterman J.Characterization of the herbicide-resistance gene bar fromStreptomyces hygroscopicus.EMBO J.1987Sep;6(9):2519-23.

[0284] Wang SM,Lue WL,Yu TS,Long JH,Wang CN,Eimert K,Chen J.Characterizationof ADG1,an Arabidopsis locus encoding for ADPG pyrophosphorylase smallsubunit,demonstrates that the presence of the small subunit is required forlarge subunit stability.Plant J.1998Jan;13(1):63-70.

[0285] Ishida Y,Saito H,Ohta S,Hiei Y,Komari T,Kumashiro T,High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens,NatBiotechnol,1996Jun14(6):745-50.doi:10.1038 / nbt0696-74.

Claims

1. A genetically modified corn cell comprising at least one knocked-out eIF4E gene.

2. The genetically modified corn cell according to claim 1, wherein the eIF4E gene is the eIF4E1 gene or the eIF4E2 gene.

3. The genetically modified corn cell of claim 1 or 2, wherein the cell comprises a knocked-out eIF4E1 gene and a knocked-out eIF4E2 gene.

4. A genetically modified corn plant or part of said plant which is resistant to at least one virus that infects corn, wherein said plant is not obtained by means of an essentially biological process, and wherein said plant or said part comprises a cell according to any one of claims 1 to 3.

5. A genetically modified corn seed that is resistant to at least one virus that infects corn, wherein the seed comprises the cell of any one of claims 1-3.

6. The genetically modified corn plant or part of said plant according to claim 4 or the genetically modified corn seed according to claim 5, wherein said virus is potato virus Y or maize chlorotic mottle virus.

7. The genetically modified corn plant, part of said plant or genetically modified corn seed according to claim 6, wherein said Potatovirus Y is selected from the group consisting of Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV) and Wheat Streak Mosaic Virus (WSMV).

8. The genetically modified corn plant, part of the plant or the genetically modified corn seed according to claim 6, wherein the maize chlorotic mottle virus is MCMV (Maize Chlorotic Mottle Virus).

9. The genetically modified corn plant, part of said plant or genetically modified corn seed according to any one of claims 6 to 8, which is resistant to at least two viruses that infect corn.

10. Progeny of the genetically modified corn plant of any one of claims 5-9.

11. A vector suitable for knocking out at least one corn eIF4E gene, wherein the vector comprises: a) at least one gRNA expression cassette, wherein the gRNA expression cassette comprises a nucleic acid encoding a gRNA under the control of a promoter, and wherein the gRNA comprises a region complementary to a target region of the maize eIF4E gene, and b) Optionally, at least one CRISPR-Cas endonuclease expression cassette.

12. A method for obtaining a genetically modified corn plant that is resistant to at least one virus that infects corn, wherein the method comprises: a) knocking out at least one eIF4E gene in a corn cell or corn tissue to obtain a knockout corn cell or a knockout corn tissue, and b) Regenerating corn plants from the knockout corn cells or knockout corn tissues.

13. The method for obtaining a genetically modified corn plant resistant to at least one virus infecting corn according to claim 12, wherein the step of knocking out at least one eIF4E gene comprises introducing at least one vector according to claim 10 into said corn cell or corn tissue.

14. A method for identifying a corn plant that is resistant to at least one corn-infecting virus, wherein the method comprises evaluating (i) the expression of at least one eIF4E protein and / or (ii) the sequence of at least one eIF4E gene, wherein the corn plant is identified as being resistant to at least one corn virus (i) in the absence of expression of the at least one eIF4E protein, and / or (ii) in the presence of a mutation in the sequence of the at least one eIF4E gene that results in a non-functional eIF4E gene.

Images