Use of medicago acid in the preparation of an anti-plant fungal bioresource medicine
By using alfalfa acid to prepare an antifungal bio-based drug, the problem of apple rot disease control has been solved. It effectively inhibits black rot fungus and activates plant resistance genes, providing an environmentally friendly biological control solution.
Patent Information
- Application Number
- CN202510217117.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-26
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2045-02-26
AI Technical Summary
Existing technologies for controlling apple rot diseases suffer from high costs in terms of manpower and financial resources, as well as environmental pollution from chemical agents. Furthermore, their effectiveness against fungi is limited, and there is a lack of effective biological control methods.
Using alfalfa acid as the active ingredient, a bio-based drug for inhibiting plant fungal growth was prepared. This drug is used to suppress the growth of black rot fungus, activate the plant's defense response, and enhance the plant's resistance to fungi.
Alfalfa acid significantly inhibits the growth of black rot fungi, increases the expression of plant resistance genes, enhances plant resistance to fungi, and provides a new environmentally friendly method for disease control.
Smart Images
Figure CN119769512B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant disease control, in particular to the application of alfalfa acid in the preparation of biological fungicide against plant fungi. BACKGROUND
[0002] Plant diseases seriously threaten the safety of agricultural production, and their control methods can be mainly divided into: (1) agricultural control. Including germplasm screening, reasonable arrangement of cultivation time, timely cleaning of weeds and other field management methods; (2) chemical control. At different stages of crop growth, use irrigation, spraying and other means to apply chemical agents to kill bacteria, pests or fungi; (3) biological control. Biological control refers to the use of antagonistic microorganisms, natural enemies, etc. to inhibit the growth and reproduction of pathogenic bacteria or pests, which is considered to be a more environmentally friendly disease control measure.
[0003] The ancestor of modern cultivated apple, Malus sieversii, is distributed in the Tianshan Mountains of Xinjiang, and is a nationally protected plant and a precious Tertiary relic plant. Apple is an important fruit worldwide, and its cultivation and production are closely related to the healthy development of global agricultural economy. However, apple canker caused by the ascomycete Valsa mali and its anamorph Cytospora mali can infect M. sieversii and cultivated apples, causing tree vigor to weaken or even die. After V. mali infects the fruit tree, its disease model can be divided into two types: ulcerative and dead branch. The ulcerative type forms red-brown water blister round spots on the main stem at the early stage of the disease, and the diseased part further ulcerates as the disease progresses, hindering the nutrient transport of the fruit tree. The dead branch type is often seen on small branches, and the disease spot is black-brown or red-brown irregular ring shape and gradually withers after infection.
[0004] Nowadays, the prevention and control measures for apple canker are still limited, mainly relying on field management and chemical control. The field management methods for preventing and controlling apple canker include seedling stage management prevention and artificial scraping of the diseased part of the fruit tree after the disease occurs. Chemical control refers to the use of fungicides such as chlorothalonil and methylthiophanate for large-scale spraying. However, these control methods have problems such as high consumption of manpower and financial resources, excessive use of chemical agents polluting the environment, etc.
[0005] Natural products refer to substances extracted from animals, plants, microorganisms themselves or secondary metabolites thereof, including alkaloids, flavonoids, terpenes, fatty acids and other substances. Because natural products are more environmentally friendly, in recent years they have become a research hotspot for new biological pesticides, and the antibacterial potential of terpenes has also been extensively studied. Terpenes are diverse and widely exist in plants, and five-ring triterpenes have been confirmed to have antibacterial effects on bacteria such as Staphylococcus aureus, Streptococcus mutans and Escherichia coli. However, the antibacterial ability of many terpenes including five-ring triterpenes on fungi is lacking in research and rarely reported. SUMMARY
[0006] The purpose of the present application is to provide the application of medicago acid in the preparation of biological source medicine for resisting plant fungi, so as to solve the problems existing in the prior art. The present application discloses that medicago acid has a significant inhibitory effect on the growth of valsa mali, and confirms that medicago acid can improve the expression of resistance genes in plants and activate the defense response of plants, thereby improving the resistance of plants to fungi. The present application provides a new drug resource and theoretical basis for the development of new plant disease-resistant agents, fills the gap of antifungal terpenes, and provides a new idea for the biological control of rot disease in Xinjiang wild fruit forest, cultivated apple orchard and other economic fruit orchard.
[0007] To achieve the above purpose, the present application provides the following scheme:
[0008] The present application provides the application of medicago acid in the preparation of biological source medicine for resisting plant fungi, wherein the plant fungi include valsa mali.
[0009] The present application also provides a biological source medicine for resisting plant fungi, wherein the effective component of the medicine includes medicago acid.
[0010] Optionally, the concentration of medicago acid in the medicine is not less than 0.63 μg / mL.
[0011] Optionally, the medicine further comprises a pharmaceutically acceptable carrier or excipient.
[0012] Further, the plant fungi include valsa mali.
[0013] The present application also provides the application of medicago acid in the preparation of a composition for improving the disease resistance of plants.
[0014] Further, the improvement of the disease resistance of plants is to improve the ability of plants to resist valsa mali.
[0015] Optionally, the plants include Xinjiang wild apples and cultivated apples.
[0016] The present application also provides a composition for improving the disease resistance of plants, wherein the effective component of the composition includes medicago acid.
[0017] Optionally, the composition further comprises a pharmaceutically acceptable carrier or adjuvant.
[0018] Further, the improved plant disease resistance is the ability to improve the resistance to Physalospora piricola.
[0019] The present application discloses the following technical effects:
[0020] The present application discloses that the tricin has a significant inhibitory effect on the growth of Physalospora piricola, and the growth of Physalospora piricola is obviously inhibited when the concentration of the tricin is 0.63 μg / mL or above. The present application also proves that the tricin can improve the expression of resistance genes in plants and activate the defense response of the plant body, thereby improving the resistance of the plant to fungi. The present application provides a new drug resource and a theoretical basis for developing a new type of plant disease-resistant agent, fills the gap of anti-fungal terpenoids, and provides a new idea for the biological control of the rot disease of Xinjiang wild fruit orchards and cultivated apple orchards. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0022] Figure 1 A preliminary verification result of the tricin resistance to Physalospora piricola; wherein, A is the mycelial growth state of Physalospora piricola on the 7th day under different concentrations of tricin treatment; B is a mycelial growth curve of Physalospora piricola;
[0023] Figure 2 A Xinjiang wild apple tissue culture seedling living body experiment result of the tricin resistance to Physalospora piricola; wherein, A is the disease incidence of the Xinjiang wild apple tissue culture seedling; B is a determination result of the pathogen content of the Xinjiang wild apple tissue culture seedling; C is a statistical result of the lesion length of the Xinjiang wild apple tissue culture seedling;
[0024] Figure 3 A quantitative detection result of the resistance genes in the Xinjiang wild apple tissue culture seedling. DETAILED DESCRIPTION
[0025] The detailed description of the various exemplary embodiments of the present application should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.
[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, the upper limit of the range and the lower limit of the range are each implicitly disclosed. Each intermediate value of is also, explicitly, individually and expressly included within the scope of the present application. The upper and lower limits of these implicitly disclosed ranges can independently be included or excluded in the ranges given herein.
[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials which are related to the present application. In case of conflict, the content of the present specification will control.
[0028] Many modifications and variations of this application of the present application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.
[0029] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.
[0030] Medicagenic acid used in the embodiments of the present application has a molecular formula of C 30 H 46 O6, and a Cas number of 599-07-5, which is purchased from TargetMol (item number T8167).
[0031] The C.mali EGI 1 used in the antibacterial capacity experiment in the embodiments of the present application is provided by the State Key Laboratory of Desert and Oasis Ecology, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences.
[0032] Example 1 Preliminary verification of the ability of medicagenic acid to resist Diaporthe citri
[0033] Medicagenic acid preparation: 4 mg of medicagenic acid powder was dissolved in 1 mL of 0.5% dimethyl sulfoxide (DMSO) to obtain a stock solution, and the highest concentration stock solution was gradually diluted 2-fold with DMSO to 0.016 mg / mL.
[0034] Drug-containing medium preparation: 500 μL of mother liquor of nine concentrations (0.016 mg / mL, 0.031 mg / mL, 0.063 mg / mL, 0.125 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 1 mg / mL, 2 mg / mL, 4 mg / mL) obtained by dilution were added to 100 mL of slightly cooled sterilized potato dextrose agar medium (PDA) to obtain a medium containing 0.08 μg / mL, 0.16 μg / mL, 0.31 μg / mL, 0.63 μg / mL, 1.25 μg / mL, 2.5 μg / mL, 5.0 μg / mL, 10.0 μg / mL, 20.0 μg / mL of medicagenic acid, respectively. 15 g / L of agar was added to the medium in advance, and about 20 mL of medium was poured into each petri dish before the medium solidified. Five replicates were set for each concentration of medium. A negative control group of 0.5% DMSO and a wild control group (WT) were also set.
[0035] Experimental process: After the plate was cooled, the fungus cake (5 mm in diameter) that had grown on PDA for 5 days was attached to the center of the medium with the mycelium side up, and the plate was incubated upside down. Thereafter, photographs were taken and the mycelial growth area was counted for 7 consecutive days, and a mycelial growth curve was drawn.
[0036] The results are shown in Figure 1 . It can be seen from Figure 1 that medicagenic acid can inhibit the growth of mycelium. The mycelial growth of Diaporthe citri EGI 1 was significantly inhibited at a concentration of 0.63 μg / mL, and the inhibition of mycelial growth by medicagenic acid reached the best effect at a concentration of 5 μg / mL. Thereafter, the concentration increased and the antibacterial ability did not improve.
[0037] Example 2: In vivo experiment of the ability of medicagenic acid to resist Diaporthe citri in Xinjiang wild apple tissue culture seedlings
[0038] Medicagenic acid preparation: medicagenic acid powder was dissolved in 0.5% DMSO and then diluted with sterilized water to 5 μg / mL.
[0039] Inoculated tissue culture seedlings preparation: 1-month-old Xinjiang wild apple tissue culture seedlings (height: 3 cm) were cut and laid flat on a moist sterilized filter paper, and a needle attached to a disposable syringe was used to prick the seedlings 10 times. Fungus cake EGI 1 that had grown on PDA for 5 days was prepared, and the mycelium side of the fungus cake was attached to the wound. After 20 h, the fungus cake was removed, and the twigs had mild disease.
[0040] Experimental process: the infected tissue culture seedlings were divided into three groups, namely: wild control group (WT): no treatment; negative control group (CK): 0.5% DMSO was sprayed on the tissue culture seedlings, using a 15 mL spray bottle, spraying 2 times per plant each time, and spraying once a day at a fixed time (interval 24 h); alfalfa acid treatment group (Ma+C.mali): alfalfa acid was sprayed on the tissue culture seedlings, using a 15 mL spray bottle, spraying 2 times per plant each time, and spraying once a day at a fixed time (interval 24 h). At the same time, the alfalfa acid control group (Ma) was set up: alfalfa acid was sprayed on the non-infected tissue culture seedlings, using a 15 mL spray bottle, spraying 2 times per plant each time, and spraying once a day at a fixed time (interval 24 h).
[0041] After the start of the experiment, samples were taken and photographed for 3 consecutive days, and the rot fungus content and lesion length were counted. The RNA of the tissue culture seedlings in each group was extracted, and the cDNA was obtained by reverse transcription, and the relative expression amount of the classic resistance genes MsPR5, MsPR8 and MsPR10 was determined by qRT-PCR.
[0042] The primer information used in the qRT-PCR process is as follows:
[0043] MsPR5-F: CTGCACTCCGCCGAATAATA (SEQ ID NO. 1);
[0044] MsPR5-R: GTCCACCACTGCAGGTAAAT (SEQ ID NO. 2);
[0045] MsPR8-F: CTGTCCCTCTTGATCCTCATTT (SEQ ID NO. 3);
[0046] MsPR8-R: CATACTGGTAGTTGCCTGAGTT (SEQ ID NO. 4);
[0047] MsPR10-F: CCTTTGTCCTCGATGCTGATAA (SEQ ID NO. 5);
[0048] MsPR10-R: TGCTTCACGTAGCCGTATTG (SEQ ID NO. 6).
[0049] The reaction system is shown in Table 1.
[0050] Table 1 Reaction system
[0051]
[0052] The reaction procedure (two-step PCR amplification standard procedure) is as follows: step 1: 95℃, 30 seconds; step 2: 95℃, 5 seconds; 60℃, 30 seconds; step 3: melting curve.
[0053] The results are shown in Figure 2 and Figure 3 It can be seen from Figure 2 that the alfalfa acid can inhibit the infection of the Malus sieversii tissue culture seedlings by the Valsa mali, which is consistent with the results verified in Example 1. After spraying the alfalfa acid, the length of the bacterial plaque on the Malus sieversii tissue culture seedlings is significantly reduced compared with the wild type (WT) and the negative control (CK), and the bacterial content is also significantly reduced compared with the wild type (WT) and the negative control (CK). It can be seen from Figure 3 that after spraying the alfalfa acid only, the expression amounts of MsPR5, MsPR8 and MsPR10 show an upward trend, indicating that the alfalfa acid has an enhancing effect on the disease resistance and immunity of the Malus sieversii tissue culture seedlings; after spraying the alfalfa acid and inoculating the Valsa mali at the same time, the expression amounts of MsPR5, MsPR8 and MsPR10 are significantly higher than those of the negative control group (CK).
[0054] The above-described examples only describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope defined by the claims of the present application.
Claims
1. Use of medicarpic acid in the fight against plant fungi, characterized in that, The plant fungus is Venturia inaequalis; The concentration of the medicament is not less than 0.63 μg / mL.
2. Use of medicarpic acid for increasing the disease resistance of plants, characterized in that, The improved disease resistance of the plant is the improved ability of the plant to resist Venturia inaequalis. The concentration of the medicament is not less than 0.63 μg / mL.
3. Use according to claim 2, characterized in that, The plant includes Malus sieversii and cultivated apples.