Circular RNA (Ribonucleic Acid) medicine for treating heart failure and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a circular RNA medicine for treating heart failure and application of the circular RNA medicine. The invention provides a circular RNA (Ribonucleic Acid). The circular RNA comprises mecciND2 and mecciNd2, wherein the nucleotide sequences of the mecciND2 and the mecciNd2 are respectively shown as SEQ ID No. 1 and SEQ ID No. 2. The mecciND2 or mecciNd2 can inhibit excessive opening of mitochondrial membrane permeability transition pores, significantly reduce ROS level in myocardial cells, maintain mitochondrial activity and further protect the myocardial cells. Intravenous injection of mecciNd2 in a mouse heart failure model can effectively protect the heart function and delay the progress of heart failure. The circular RNA is used as a medicine for treating heart failure and has good safety and specificity. The invention provides a novel mitochondrial targeting biological treatment approach for heart failure treatment, and brings a new breakthrough for heart failure treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to circular RNA drugs for treating heart failure and their applications. More specifically, it relates to the application of a type of circular RNA with specific sequence properties that regulates the release of mitochondrial reactive oxygen species (ROS) as a drug for treating heart failure. Background Art

[0002] Heart failure (HF) is the leading cause of death from cardiovascular disease. The fundamental problem of HF is decreased cardiac pumping function. There are many reasons for decreased cardiac pumping function, which can be summarized as myocardial systolic and / or diastolic dysfunction, long-term excessive cardiac load, and limited ventricular filling. At present, HF is still incurable, and severe HF can only be treated with surgical intervention or even heart transplantation. Therapeutic drugs for HF are mainly aimed at improving the symptoms of HF, by dilating blood vessels, lowering blood pressure, reducing cardiac preload and afterload, reducing the heart's energy demand, and avoiding further adverse myocardial remodeling. These drugs do not repair damaged myocardial cells at the molecular level, fundamentally restore myocardial function, and will produce drug resistance. Although the survival rate has been improved, patients with HF still have a high mortality rate and a very low quality of life.

[0003] Mitochondria are vital for organs that consume a lot of energy, especially the heart. The human heart consumes 15 to 20 times its own weight in ATP in a day, so the mitochondria in the heart need to synthesize about 6 kg of ATP every day to maintain heart function. Cardiomyocytes are the cells with the highest content of mitochondria. The mitochondria in mature cardiomyocytes are larger, accounting for about 40% of the volume of adult mammalian cardiomyocytes. Mitochondrial dysfunction in cardiomyocytes is a key factor leading to heart failure. The ATP production of myocardium in a heart with heart failure will be reduced by about 30% compared with normal myocardium.

[0004] Targeting damaged mitochondria and restoring the function of cardiomyocytes are important targets for the treatment of heart failure, but there is currently no treatment for mitochondrial dysfunction. A key cause of mitochondrial dysfunction in cardiomyocytes is the abnormal increase in ROS production, and specific removal of excess ROS in mitochondria is also one of the strategies for the development of heart failure drugs. At present, no antioxidant drugs have been developed for patients with heart failure. Some studies have shown that broad-spectrum antioxidants such as vitamin C, vitamin E and N-acetylcysteine ​​(NAC) are helpful in the treatment of heart disease. Some mitochondria-targeted antioxidants such as mitoTEMPO and mitoQ have shown good heart failure treatment effects in animal experiments.

[0005] The mitochondrial permeability transition pore (mPTP) is the main channel for mitochondrial ROS release. It is located between the inner and outer membranes of mitochondria. It is a non-selective channel composed of a protein complex that allows molecules smaller than 1.5 kDa to enter and exit. Under normal conditions, the mPTP is closed to maintain the membrane potential and normal function of the mitochondria. In the heart with heart failure, the mPTP is over-opened, causing the loss of mitochondrial membrane potential in cardiomyocytes and oxidative damage to cardiomyocytes. Cyclophilin D (CypD) is a positive regulatory protein of mPTP, which binds to the mPTP component protein ATP5B and promotes the opening of mPTP. The mitochondrial heat shock protein TRAP1 is a negative regulatory protein of mPTP, competing with mPTP for binding to CypD, thereby inhibiting the opening of mPTP. Currently, mPTP is also an important target for the development of heart failure drugs.

[0006] Circular RNA (circRNA) is a special class of RNA molecules, whose 5' and 3' ends are covalently linked to form a closed circular structure. Recent studies have shown that circRNA has important regulatory functions and is closely related to a variety of cardiovascular diseases. It is currently known that circular RNA in animal cells can come from the nuclear genome and mitochondrial genome. The circular RNA encoded by the mitochondrial genome is called mecciRNA (mitochondria-encoded circRNA). Many studies have shown that circular RNA, including mecciRNA, has an important regulatory effect on the normal activity of mitochondria, including promoting mitochondrial protein transport and regulating mitochondrial ROS levels. These functions are closely related to the occurrence and development of heart failure. At present, no circular RNA drugs have been applied to the clinical treatment of heart failure. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a type of circular RNA with specific sequence properties that can regulate the release of mitochondrial ROS for use as a drug for the treatment of heart failure. One of the sequence characteristics of this type of circular RNA is that it can bind to mPTP components and their regulatory proteins and regulate the opening of mPTP, thereby maintaining the mitochondrial function of cardiomyocytes, reducing the level of ROS in cells, thereby protecting cardiomyocytes and delaying the progression of heart failure.

[0008] On the one hand, circular RNA is used in drugs for preventing, assisting treatment and / or treating heart failure.

[0009] Specifically, the circular RNA binds to the mPTP components ATP5B and TRAP1 protein. Further specifically, the circular RNA has a single-stranded region and contains a CUAC, UACC or ACUA sequence.

[0010] More specifically, the circular RNA is encoded by the mitochondrial genome.

[0011] Preferably, the sequence of the circular RNA is SEQ ID No.1 and / or SEQ ID No.2.

[0012] Specifically, the medicine also includes pharmaceutically acceptable excipients.

[0013] More specifically, the pharmaceutically acceptable excipient is selected from one or a combination of two or more of wetting agents, emulsifiers, preservatives, antioxidants, buffers, excipients, diluents, lubricants, antibacterial agents, suspending agents, suspending aids, solubilizers, thickeners, stabilizers, sweeteners and flavors.

[0014] Preferably, the pharmaceutically acceptable excipient is selected from at least one of lactose, mannose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, magnesium stearate and mineral oil.

[0015] Specifically, the drug may also include a viral vector.

[0016] More specifically, the viral vector may be one or more of an adenoviral vector, a lentiviral vector, and a retroviral vector.

[0017] Specifically, the drug may further include an embedding carrier.

[0018] More specifically, the embedding carrier includes but is not limited to: cholesterol, nanoparticles or liposomes.

[0019] Preferably, the embedding carrier may be a liposome.

[0020] Specifically, the drug dosage form is tablets, liquids, capsules, powders or granules.

[0021] Specifically, the drug is administered orally, intravenously, intradermally or subcutaneously.

[0022] In another aspect, the present invention provides a drug for preventing, assisting in the treatment and / or treating heart failure, wherein the drug comprises a circular RNA having a sequence of SEQ ID No.1 and / or SEQ ID No.2.

[0023] Specifically, the heart failure includes but is not limited to: acute heart failure or chronic heart failure.

[0024] Specifically, the medicine also includes pharmaceutically acceptable excipients.

[0025] More specifically, the pharmaceutically acceptable excipient is selected from one or a combination of two or more of wetting agents, emulsifiers, preservatives, antioxidants, buffers, excipients, diluents, lubricants, antibacterial agents, suspending agents, suspending aids, solubilizers, thickeners, stabilizers, sweeteners and flavors.

[0026] Preferably, the pharmaceutically acceptable excipient is selected from at least one of lactose, mannose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, magnesium stearate and mineral oil.

[0027] Specifically, the drug may also include a viral vector.

[0028] More specifically, the viral vector may be one or more of an adenoviral vector, a lentiviral vector, and a retroviral vector.

[0029] Specifically, the drug may further include an embedding carrier.

[0030] More specifically, the embedding carrier includes but is not limited to: cholesterol, nanoparticles or liposomes.

[0031] Preferably, the embedding carrier may be a liposome.

[0032] Specifically, the drug dosage form is tablets, liquids, capsules, powders or granules.

[0033] Specifically, the drug is administered orally, intravenously, intradermally or subcutaneously.

[0034] The technical effects achieved by the present invention are: (1) Higher targeting and specificity: The circular RNA of the present invention binds to ATP5B and TRAP1 proteins and regulates the levels of TRAP1 and other proteins in mitochondria, inhibits the excessive opening of mPTP, regulates the release of ROS in cardiomyocyte mitochondria, and significantly reduces the level of ROS in cardiomyocytes. Compared with broad-spectrum antioxidant therapy, the circular RNA of the present invention has better targeting and specificity.

[0035] (2) Safety of circular RNA: circular RNA is less likely to trigger an immune response and is therefore safer in application.

[0036] (3) Multiple applicability: The circular RNA of the present invention is not only suitable for the treatment of heart failure, but also has the function of protecting mitochondria and alleviating oxidative stress, and has the potential to be extended to other mitochondrial damage-related diseases.

[0037] (4) Clinical and economic value: Existing treatments are mainly aimed at alleviating the symptoms of heart failure. The circular RNA of this invention targets damaged mitochondria, inhibits the release of excessive mitochondrial ROS, and helps restore the function of myocardial cells. It provides patients with more effective treatment options, which is expected to reduce treatment costs and improve patients' quality of life. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 To identify mitochondrial circular RNAs bound to TRAP1 and ATP5B proteins; A is TRAP1 RIP-seq performed in human 293T cells, and the Western blot results prove that TRAP1 protein was successfully enriched by specific antibodies; B is the statistical result of mitochondrial circular RNAs identified by TRAP1 RIP-seq; C is ATP5BRIP-seq performed in human 293T cells, and the Western blot results prove that ATP5B protein was successfully enriched by specific antibodies; D is the statistical result of mitochondrial circular RNAs identified by ATP5B RIP-seq.

[0039] Figure 2 Sequence features of mitochondrial circular RNAs that bind to TRAP1 and ATP5B predicted by HOMER software.

[0040] Figure 3 Schematic diagram of the secondary structure of mecciND2 and mecciNd2 predicted using mfold.

[0041] Figure 4 In vitro synthesized mecciND2 and mecciNd2 bind to TRAP1 and increase the content of TRAP1 in mitochondria; A shows that mecciND2 transfected into 293T cells can specifically bind to TRAP1 protein; B shows that the level of TRAP1 protein in mitochondria is changed after mecciND2 transfection by APEX experiment; C shows that the level of TRAP1 and CypD in whole cells and mitochondria is changed after mecciND2 transfection by Western blot; ACTIN is the internal reference protein at the whole cell level; TOMM40 is the internal reference protein at the mitochondrial level; D shows the quantitative results of proteins in Figure C; E shows that mecciNd2 transfected into HL-1 cells can specifically bind to TRAP1 protein; F shows that the level of TRAP1 protein in mitochondria is changed after mecciNd2 transfection by APEX experiment; G shows that Blot analysis was used to detect the changes in TRAP1 and CypD at the whole-cell level after transfection with mecciNd2; H is the quantitative result of the proteins in G; ns indicates no significant difference, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0042] Figure 5 To detect the mPTP and ROS levels of cardiomyocytes after transfection of mecciND2 in human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) stimulated by hypoxia or doxorubicin; A is the Calcein AM signal indicating the degree of closure of mPTP, the stronger the green fluorescence, the higher the degree of closure, and the weaker the green fluorescence, the higher the degree of opening; B is the DCFH-DA indicating the level of ROS in cells, the strong red signal indicates high ROS in cells, the weak red signal indicates low ROS content in cells, Hoechst specifically marks the cell nucleus, and the white dotted box indicates the outline of the cardiomyocyte; untreated in the figure means that the cells were cultured under normoxic conditions and without doxorubicin stimulation; the scale bar in the figure is 5 μm; ns means no significant difference, * means p<0.05, ** means p<0.01, and *** means p<0.001.

[0043] Figure 6 To transfect mecciNd2 into mouse cardiomyocytes HL-1 stimulated by hypoxia or doxorubicin, the mPTP and ROS levels of cardiomyocytes were detected; A and C are Calcein AM signals indicating the degree of mPTP closure, the stronger the green fluorescence, the higher the degree of closure, and the weaker the green fluorescence, the higher the degree of opening; B and D are DCFH-DA indicating the level of cellular ROS, a strong red signal indicates high ROS in the cell, and a weak red signal indicates low ROS content in the cell; Hoechst specifically labels the cell nucleus; the scale bar in the figure is 5 μm; ns indicates no significant difference, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0044] Figure 7 Figure 3 is the therapeutic effect of mecciNd2 in the doxorubicin-induced mouse heart failure model; A is the flow chart of doxorubicin treatment and mecciNd2 injection; B is the expression of mecciNd2 in the heart after mecciNd2 injection; C is the ejection fraction of the heart of each group of mice detected by cardiac color Doppler ultrasound; D is the appearance of the heart of a representative individual mouse in each group; the scale bar in the figure is 5 mm; E is the H&E and Masson staining results of the mouse heart tissue section at the end of treatment; the scale bar in the figure is 50 μm; F is the cross-section of myocardial cells counted according to the H&E staining results; G is the myocardial fibrosis counted according to the Masson staining results; ns means no significant difference, * means p<0.05, *** means p<0.001; the number of mice in each group is 6, 6, 6, and 6, respectively.

[0045] Figure 8Figure 3 is the therapeutic effect of mecciNd2 in the pressure overload-induced heart failure model in mice; A is the flow chart of the mouse experiment; TAC: aortic arch constriction; B is the ejection fraction of the heart of each group of mice detected by cardiac color Doppler ultrasound; Sham: sham operation; C is the appearance of the heart of a representative individual of each group of mice; the scale bar in the figure is 5 mm; D is the H&E and Masson staining results of the heart tissue sections of mice at the end of treatment; the scale bar in the figure is 50 μm; E is the cross-section of myocardial cells counted according to the H&E staining results; F is the myocardial fibrosis counted according to the Masson staining results; ns means no significant difference, ** means p<0.01, *** means p<0.001; the number of mice in each group is 4, 4, 6, and 6, respectively. DETAILED DESCRIPTION

[0046] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0047] the term: 1. mPTP, mitochondrial permeability transition pore, mitochondrial permeability transition pore.

[0048] 2. ATP5B is a component of mPTP; TRAP1 is a negative regulatory protein of mPTP; CypD is a positive regulatory protein of mPTP.

[0049] 3. TAC, transaortic arch coarctation.

[0050] 4. Doxorubicin, DOX, doxorubicin, is a chemotherapy drug that is cardiotoxic and long-term use can lead to chronic heart failure.

[0051] The nucleotide sequences of mecciND2 and mecciNd2 described in the present invention are shown in SEQ ID No. 1 and SEQ ID No. 2, and the secondary structure has a large number of single-stranded regions, and contains "CUAC", "UACC" or "ACUA" sequences as potential TRAP1 binding sites, which can bind to mPTP components and regulatory protein TRAP1.

[0052] SEQ ID No.1: CAUAACCAAUACUACCAAUCAAUACUCAUCAUUAAUAAUCAUAAUAGCUAUAGCAAUAAAACUAGGAAUAGCCCCUUUCACUUCUGAGUCCCAGAGGUUACCCAAGGCACCCCUCUGACAUCCGGCCUGCUUCUUCUCACAUGACAAAAACUAGCCCCCAUCUCAAUCAU AUACCAAAUCUCUCCCUCACUAAACGUAAGCCUUCUCCUCACUCUCAAUCUUAUCCAUCAUAGCAGGCAGUUGAGGUGGAUUAAACCAAACCCAGCUACGCAAAAUCUUAGCAUACUCCUCAAUUACCCACAUAGGAUGAAUAAUAGCAGUUCUACCGUACAACCCUAA; SEQ ID No.2: UUCCACCACUAACAGGAUUCUUACCAAAAUGAAUUAUCAUCACAGAACUUAUAAAAAACAACUGUCUAAUUAUAGCAACACUCAUAGCAAUAAUAGCUACUAAACCUAUUCUUUUAUACUCGCCUAAUUUA.

[0053] Note: According to the WIPOST.26 standard, uracil "U" in the sequence is represented by "T" in the sequence table.

[0054] Example 1 Identification and Characterization of Circular RNAs Binding to TRAP1 1.1 Experimental methods (1) RNA-IP of TRAP1 or ATP5B Mitochondria extraction is described in detail in a published article (PMID: 33588027). Mitochondria were cross-linked with 1% formaldehyde and lysed in ice-cold RIPA buffer, which contained 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.1% SDS, and RNase inhibitors, 2 mM DTT, and protease inhibitors. TRAP1 (or ATP5B)-specific antibody or IgG control antibody was added to the remaining supernatant and incubated at 4°C for 4 hours to complete antigen-antibody coupling. Protein G magnetic bead suspension (Invitrogen, 10004D) was added to the antigen-antibody mixture and incubated at 4°C for 2 hours to allow the antigen-antibody complex to bind to the magnetic beads. The protein-antibody-magnetic bead complex was washed twice with RIPA buffer and then washed with high-salt RIPA buffer (containing 500 mM NaCl) twice; take 1 / 5 of the magnetic bead sample, add SDS loading buffer, and boil in a boiling water bath at 100°C for 10 minutes for subsequent Western blot analysis. Add proteinase K to the remaining protein-antibody-magnetic bead complex and incubate at 55°C for 30 minutes to digest the protein. Then use TRIzol reagent to extract RNA. The purified RNA can be used for real-time quantitative PCR (RT-qPCR) or high-throughput sequencing analysis.

[0055] (2) RNA-seq (transcriptome sequencing technology) Beijing Novogene was commissioned to perform high-throughput sequencing. The library type was RIP library, and the mitochondrial RNA was randomly interrupted to build the library. The sequencing platform was Novasek 6000 PE150, and the sequencing depth was 8G clean data. The sequencing data was analyzed using the circular RNA analysis software CIRI2 or the find_circ program, and the reference genome was hg38.

[0056] (3) Circular RNA motif prediction The circular RNA sequences that bind to ATP5B or TRAP1 were used to predict motifs using the HOMER software with default parameters.

[0057] (4) Prediction of circular RNA secondary structure Go to the mfold website (http: / / www.mfold.org), select "RNA Folding Form", put the sequences of mecciND2 and mecciNd2 into the input box respectively, select the "circular" form, and make predictions according to the default parameters.

[0058] 1.2 Experimental Results like Figure 1 As shown in , TRAP1 and ATP5B bind to hundreds of mitochondrial circular RNAs.

[0059] like Figure 2 As shown in the figure, the circular RNA motifs bound by TRAP1 and ATP5B were predicted using HOMER software.

[0060] like Figure 3 As shown, the secondary structures of mecciND2 and mecciNd2 both have more single-stranded regions.

[0061] Example 2 Detection of the interaction between circular RNA and TRAP1 protein 2.1 Experimental methods 2.1.1 Group I self-splicing intron-mediated circular RNA circularization method (1) Design of transcription template The transcription template was designed according to the published article (PMID: 33406226) and chemically synthesized by a sequencing company. The template contained the inverted T4 td gene Group I intron, T7 promoter, and circular RNA sequence.

[0062] (2) In vitro synthesis of circular RNA precursors The linear DNA fragment of circular RNA was transcribed with T7 promoter and synthesized into circular RNA precursor RNA by in vitro transcription using T7 transcription kit (Thermo Scientific, K0441).

[0063] Add the following components to a 50 μL reaction system: T7-DNA template: 1 μg; T7 RNA polymerase: 5 μL; ATP, CTP, GTP, UTP (if biotin labeling is required, use UTP / biotin-UTP mixture): 10 mM each; The mixture was incubated at 37°C for 4 hours.

[0064] (3) Purification of transcription products DNase I was added to remove the template DNA and terminate the transcription reaction. The transcribed linear RNA was then purified using TRIzol reagent.

[0065] (4) In vitro cyclization reaction The transcribed linear RNA was incubated at 55°C for 15 min in a circularization buffer (15 mM MgCl2, 1 mM DTT, 50 mM Tris-HCl, pH 7.5) and 2 mM GTP.

[0066] (5) Separation and purification of cyclization products The reaction products were separated on a 5% urea PAGE gel, the corresponding band of the circular RNA was cut out, and the RNA was eluted overnight in an elution buffer (20 mM Tris-HCl, pH 7.5, 250 mM NaOAc, 1 mM EDTA, 0.25% SDS). The eluted RNA was purified using the RNA Clean&Concentrator-5 kit (Zymo Research, R1013) to obtain highly pure circularized circular RNA, which can be used for subsequent experiments and analysis.

[0067] 2.1.2 Pull-down experiment of cytoplasmic TRAP1 by biotinylated circular RNA (1) Cell transfection Cells were seeded in 15 mm culture dishes, transfected with 20 pmol of biotin-labeled circular RNA (or circ-ctrl as a control), and cultured for 24 h.

[0068] (2) Cell treatment Before collecting cells, place the cells in a UV crosslinker at an intensity of 120 mJ / cm². After crosslinking, the cells were digested with trypsin and collected with PBS. The cell pellet was resuspended in 1 mL of ice-cold digitonin buffer (150 mM NaCl, 50 mM HEPES, pH 7.4, 50 μg / mL digitonin, protease inhibitors, RNase inhibitors), incubated with rotation at 4°C for 15 minutes, and then centrifuged at 2,000 × g. The supernatant was collected as the cytoplasmic fraction for subsequent pull-down experiments.

[0069] (3) Magnetic bead capture Take 50 μL of streptavidin magnetic beads (Invitrogen, 11205D) and block with 1% BSA and 500 ng / μL yeast tRNA for 30 minutes at room temperature. Add the blocked magnetic beads to the cytoplasmic fraction and incubate with rotation at room temperature for 1 hour. Collect and wash the magnetic beads using a magnetic separator. Finally, resuspend the magnetic beads in 100 μL digitonin buffer, add SDS loading buffer, and boil at 100℃ for 10 minutes for subsequent Western blot detection.

[0070] 2.1.3 Proximity Chemical Labeling (APEX) (1) 293T or HL-1 cells stably expressing mitochondrial matrix-localized APEX2 were transfected with 5 nM circular RNA and cultured for 24 hours.

[0071] (2) Place the cells in a culture medium containing 500 mM biotin-phenol (APExBIO, A8011) and incubate at 37°C for 30 minutes. Then, add 1 mM H2O2 for 1 minute at room temperature. Immediately add 2 mL of stop solution (10 mM ascorbic acid, 5 mM Trolox) and react for 1 minute to terminate the labeling.

[0072] (3) Lyse the cells with 1 mL RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, protease inhibitors, RNase inhibitors). Add 50 µL M-280 streptavidin magnetic beads (Invitrogen, 11206D) and incubate at room temperature for 2 hours to allow the labeled protein to bind to the beads.

[0073] (4) Wash the beads three times with RIPA buffer, resuspend them in 60 µL of 2×SDS loading buffer containing 20 mM DTT and 2 mM biotin, and boil at 95°C for 15 min. The final protein sample was used for Western blot detection.

[0074] 2.1.4 Western blot The protein mixture obtained in 2.1.2 or 2.1.3 was separated by SDS-PAGE gel electrophoresis and then transferred to a nitrocellulose membrane. After blocking with 5% skim milk powder / TBST, primary and secondary antibodies were prepared and incubated, and finally developed, and grayscale value statistical analysis was performed using Image J.

[0075] 2.2 Experimental Results like Figure 4 As shown in A and E, mecciND2 and mecciNd2 transfected into cells bind to TRAP1 protein.

[0076] like Figure 4 As shown in B and F, mecciND2 and mecciNd2 led to increased TRAP1 protein levels in mitochondria.

[0077] like Figure 4 As shown in C, D, G, and H, mecciND2 and mecciNd2 led to a decrease in CypD protein levels in cells.

[0078] Example 3 Detection of circular RNA function in cardiomyocytes 3.1 Experimental methods (1) Transfection and treatment of cardiomyocytes: Thermo's Lipofectamine 3000 product was used to transfect in vitro cyclized mecciND2 or mecciNd2 into human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) and mouse cardiomyocyte cell line HL-1 cells. Hypoxia treatment conditions were: 1% O2 / 5% CO2 / balance N2, 37°C, 24 hours; normoxic conditions were used as controls. Doxorubicin treatment conditions were: 2 µM doxorubicin, 6 hours.

[0079] (2) mPTP and ROS detection: In the present invention, commercial mPTP and ROS detection kits were used to perform live cell staining on specific cells, live cell photography was performed using a laser confocal microscope, and fluorescence statistics were performed using image J software.

[0080] 3.2 Experimental Results like Figure 5 and Figure 6 As shown, when cardiomyocytes are in hypoxia or stimulated by doxorubicin, transfection of mecciND2 and mecciNd2 can maintain the closure of cardiomyocyte mitochondrial mPTP, reduce ROS levels, and protect cardiomyocytes.

[0081] Example 4 Therapeutic effect of mecciNd2 on adriamycin-induced heart failure 4.1 Experimental methods Mice (SPF grade C57BL / 6, 8 weeks old, purchased from Beijing Biotechnology Co., Ltd.): Doxorubicin (5 mg / kg each time) was injected intraperitoneally, and mecciNd2 or control circRNA (7 μg each time) encapsulated by liposomes was injected into the tail vein once a week for a total of 4 weeks. The procedure was as follows Figure 7 As shown in A. The control circular RNA contains a 264nt GFP sequence (SEQ ID No. 3).

[0082] SEQ ID No.3: AUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGG CCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAG.

[0083] Note: According to the WIPOST.26 standard, uracil "U" in the sequence is represented by "T" in the sequence table.

[0084] The experiment is divided into 4 groups, the specific information is as follows: Group 1: injected with PBS and control circRNA (labeled as PBS; circ-ctrl in the figures); Group 2: injected with PBS and mecciNd2 (labeled as PBS; mecciNd2 in the figures); Group 3: injected with doxorubicin and control circRNA (labeled as doxorubicin; circ-ctrl in the figures); Group 4: injected with doxorubicin and mecciNd2 (labeled as doxorubicin; mecciNd2 in the figures).

[0085] At the fifth week, the heart function of the mice was detected by color Doppler ultrasound; the hearts of the mice were taken out for measurement and photography after being killed; the heart tissue was fixed with 4% paraformaldehyde, dehydrated with gradient alcohol, embedded in paraffin, and cut into slices with a thickness of 5 μm. The slices were dewaxed with xylene and then stained with hematoxylin and eosin to obtain HE stained slices or placed in Masson staining solution for staining.

[0086] 4.2 Experimental Results like Figure 7 As shown in B, the expression level of mecciNd2 in cardiac tissue increased by about 20 times one day after tail vein injection of mecciNd2, and the increased expression level of mecciNd2 could be maintained until the fifth day.

[0087] like Figure 7 As shown in center C, the left ventricular ejection fraction of DOX mice treated with mecciNd2 was maintained at a normal level compared with that of DOX mice injected with control circRNA.

[0088] like Figure 7 As shown in middle D, the heart morphology of DOX mice injected with control circRNA was significantly atrophied, while the heart morphology of DOX mice treated with mecciNd2 was similar to that of PBS mice.

[0089] like Figure 7 As shown in E to G, compared with PBS mice, DOX mice injected with control circRNA had cardiomyocyte atrophy and increased myocardial fibrosis, while mecciNd2 treatment significantly reduced cardiomyocyte atrophy and fibrosis in DOX mice.

[0090] Example 5 Therapeutic effect of mecciNd2 on TAC-induced heart failure 5.1 Experimental Methods Mice (SPF grade C57BL / 6, 8 weeks old, purchased from Beijing Biotechnology Co., Ltd.): Aortic arch constriction (TAC) surgery: Avertin (250 mg / kg, intraperitoneal injection) was used to anesthetize mice. A small incision was made at the sternum to open the chest cavity and expose the aortic arch. A 6-0 silk thread was passed through the aortic arch between the right brachiocephalic artery and the left common carotid artery. A 27G pad needle was placed close to the aortic arch and parallel to the aortic arch. The silk thread was tightened to ligate the aortic arch and then the pad needle was withdrawn to form aortic arch constriction. After tying again and fixing, the chest cavity was closed layer by layer. The sham group (Sham) performed the same operation, with the only difference being that the sham group only threaded the thread without ligating the aortic arch.

[0091] One week after TAC surgery, liposome-encapsulated mecciNd2 or control circRNA (7 μg each time) was injected into the tail vein once every three days for a total of three injections. The procedure was as follows Figure 8 As shown in A. The control circular RNA contains a 264 nt GFP sequence, which is the same as the SEQ ID No. 3 in 4.1.

[0092] The experiment is divided into 4 groups, the specific information is as follows: Group 1: sham surgery and injection of control circRNA (labeled as Sham; circ-ctrl in the figures); Group 2: sham surgery and injection of mecciNd2 (labeled as Sham; mecciNd2 in the figures); Group 3: TAC surgery and injection of control circRNA (labeled as TAC; circ-ctrl in the figures); Group 4: underwent TAC surgery and mecciNd2 injection (labeled as TAC; mecciNd2 in the figures).

[0093] Three weeks after the last injection, the heart function of the mice was detected by color Doppler ultrasound; the mice were killed and the hearts were taken out for measurement and photography; the heart tissue was fixed with 4% paraformaldehyde, dehydrated with gradient alcohol, embedded in paraffin, and cut into slices with a thickness of 5 μm. The slices were dewaxed with xylene and then stained with hematoxylin and eosin to obtain HE stained slices or placed in Masson staining solution for staining.

[0094] 5.2 Experimental Results like Figure 8 As shown in Figure 2B, the left ventricular ejection fraction of TAC mice treated with mecciNd2 was maintained at a normal level compared with that of TAC mice injected with control circRNA.

[0095] like Figure 8 As shown in center C, the hearts of TAC mice injected with control circRNA showed eccentric hypertrophy, while the hearts of TAC mice treated with mecciNd2 were not significantly enlarged.

[0096] like Figure 8 As shown in D to F, compared with Sham mice, the cardiomyocyte area and myocardial fibrosis ratio of TAC mice injected with control circRNA were significantly enlarged, while mecciNd2 treatment significantly reduced the hypertrophy and fibrosis of cardiomyocytes in TAC mice.

Claims

1. Use of circular RNA in a drug for preventing, assisting in the treatment and / or treating heart failure, characterized in that: The circular RNA binds to mPTP components ATP5B and TRAP1 protein; the circular RNA has a single-stranded region and contains CUAC, UACC or ACUA sequences.

2. The use according to claim 1, characterized in that: The circular RNA is encoded by the mitochondrial genome.

3. The use according to claim 2, characterized in that: The sequence of the circular RNA is SEQ ID No.1 and / or SEQ ID No.

2.

4. The use according to claim 1, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

5. The use according to claim 1, characterized in that: The medicine also includes a viral vector.

6. The use according to claim 5, characterized in that: The viral vector is one or more of an adenoviral vector, a lentiviral vector, and a retroviral vector.

7. The use according to claim 1, characterized in that: The medicine also includes an embedding carrier.

8. The use according to claim 7, characterized in that: The embedding carrier is cholesterol, nanoparticles or liposomes.

9. The use according to claim 8, characterized in that: The embedding carrier is liposome.

10. A drug for preventing, assisting in the treatment and / or treating heart failure, characterized in that: The drug comprises a circular RNA having a sequence of SEQ ID No.1 and / or SEQ ID No.

2.

11. The drug according to claim 10, characterized in that The heart failure includes acute heart failure or chronic heart failure.

Images