Application of Hsp31 protein and related biological materials thereof in improving yield of amino acid in escherichia coli

Abstract

The invention discloses an application of Hsp31 protein and related biological materials thereof in improving the yield of escherichia coli amino acid. According to the invention, an hchA gene is inserted into genomes of a model strain W3110 and a high-yield L-amino acid strain to construct a recombinant strain with improved hchA gene expression quantity. According to the present invention, the fermentation culture on the recombinant bacteria finds that the overexpression of the hchA gene can easily improve the yield of L-threonine, L-tryptophan, L-arginine and L-valine regardless of the high L-amino acid yield strain or the model strain W3110; therefore, the hchA gene and the Hsp31 protein coded by the hchA gene have the function of improving the yield of microbial amino acid. The invention has important application value for culturing high-yield and high-quality strains conforming to industrial production and industrial production of amino acid.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of Hsp31 protein and related biological materials in improving the amino acid yield of Escherichia coli. Background Art

[0002] Amino acids are the basis of proteins and are widely used in the manufacture of pharmaceutical preparations, flavoring agents, animal feed, and cosmetics. At present, the level of industrial amino acid production has been greatly improved, but with the rapid development of industries such as anti-cancer drug preparations and amino acid infusion preparations, the demand for raw amino acids is increasing. How to further increase the production of amino acids on the basis of a high level is imperative.

[0003] Molecular chaperones are a class of proteins that play a key role in cells, mainly responsible for assisting the correct folding, assembly and transport of other proteins. These proteins are widely present in organisms from bacteria to humans. They bind to the assisted proteins with non-covalent bonds, but do not participate in the formation of the structure of the final functional protein. Molecular chaperones can recognize and bind to incompletely folded or assembled proteins, help them achieve the correct conformation, prevent improperly folded proteins from aggregating or being degraded, and participate in the stress response of biological organisms, as well as enhance the activity of DNA helicase during cell division. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the amino acid production of microorganisms.

[0005] In order to solve the above technical problems, the present invention first provides a new use of Hsp31 protein.

[0006] The present invention provides the use of Hsp31 protein in at least any one of the following M1)-M4):

[0007] M1) Increase the production of amino acids from microorganisms;

[0008] M2) preparing products that increase the amino acid production of microorganisms;

[0009] M3) constructing a recombinant microorganism for producing amino acids;

[0010] M4) preparing products of constructing recombinant microorganisms for producing amino acids;

[0011] The Hsp31 protein at least comprises (or is) any one of the following a1) or a2) or a3) or a4):

[0012] a1) a protein containing the amino acid sequence shown in SEQ ID No.2 or a protein containing the amino acid sequence shown in SEQ ID No.2;

[0013] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or the C-terminus of the protein shown in SEQ ID No. 2;

[0014] a3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2;

[0015] a4) A protein having 98% identity with the amino acid sequence shown in SEQ ID No. 2 and having the same function.

[0016] In the protein described in a2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0017] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues.

[0018] In the protein described in a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can be obtained. The identity includes amino acid sequences having 98% or higher, or 99% or higher identity with the amino acid sequence shown in SEQ ID No. 2 of the present invention.

[0019] Any of the proteins described in a1)-a4) above can be artificially synthesized, or the encoding gene can be synthesized first and then expressed biologically.

[0020] In order to solve the above technical problems, the present invention also provides new uses of biomaterials related to the above Hsp31 protein.

[0021] The present invention provides the use of the biomaterial related to the above-mentioned Hsp31 protein in at least any one of the following M1)-M4):

[0022] M1) Increase the amino acid production of microorganisms;

[0023] M2) preparing products that increase the amino acid production of microorganisms;

[0024] M3) constructing a recombinant microorganism for producing amino acids;

[0025] M4) preparing products of constructing recombinant microorganisms for producing amino acids;

[0026] The biological material is a nucleic acid molecule encoding the Hsp31 protein or an expression box or a recombinant vector containing the nucleic acid molecule.

[0027] In the above application, the nucleic acid molecule comprises (or is) the gene shown in B1) or B2) below:

[0028] B1) a DNA molecule containing the nucleotide sequence shown in SEQ ID No.1 or a DNA molecule containing the nucleotide sequence shown in SEQ ID No.1;

[0029] B2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) and encoding the above-mentioned Hsp31 protein.

[0030] Herein, the gene whose nucleotide sequence is SEQ ID No. 1 is named as hchA gene, which encodes the above-mentioned Hsp31 protein.

[0031] A person skilled in the art can easily mutate the nucleotide sequence encoding the Hsp31 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the hchA nucleotide sequence isolated from the present invention, as long as they encode the Hsp31 protein and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention. The identity refers to the sequence similarity with the natural nucleic acid sequence, including nucleotide sequences having 75% or higher identity with the nucleotide sequence of the present invention encoding the protein composed of the amino acid sequence shown in SEQ ID No.2. The identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0032] The above 75% or more identity may be 80%, 85%, 90% or more identity. The above 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 85% identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 90% identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0033] In the above application, the expression cassette refers to a DNA capable of expressing Hsp31 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the hchA gene, but also a terminator for terminating transcription of the hchA gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0034] In the above application, the vector refers to a vector that can carry the above nucleic acid molecule into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid, viral vector (such as retrovirus (including lentivirus), adenovirus, adeno-associated virus, etc.).

[0035] The recombinant vector refers to a recombinant DNA molecule constructed by connecting the above nucleic acid molecule and the vector in vitro. The recombinant vector containing the hchA gene expression cassette can be constructed using an existing expression vector. In order to facilitate the identification and screening of recombinant strains, the strain expression vector used can be processed, such as adding genes encoding enzymes or luminescent compounds that can produce color changes and antibiotic markers with resistance (chloramphenicol markers, kanamycin markers, etc.) that can be expressed in the strain.

[0036] In the above applications, the microorganism may be yeast, bacteria, algae or fungi.

[0037] Furthermore, the bacterium may be any bacterium capable of producing amino acids, such as bacteria from the genus Brevibacterium, Corynebacterium, Escherichia, Aerobacter, Micrococcus, Flavobacterium or Bacillus.

[0038] Furthermore, the bacteria is Escherichia coli.

[0039] In some embodiments, the microorganism may be wild-type Escherichia coli, such as Escherichia coli W3110 strain.

[0040] In some embodiments, the microorganism may be a high-yield L-amino acid strain, such as the high-yield L-arginine strain CGMCC 25402, the high-yield L-threonine strain CGMCC 25404, the high-yield L-tryptophan strain CGMCC 25403, and the high-yield L-valine strain CGMCC 22721.

[0041] The recombinant microorganism refers to a recombinant microorganism with changed functions obtained by operating and modifying the genes of the target microorganism. For example, a recombinant microorganism obtained by introducing the above-mentioned recombinant vector into the target microorganism, or a recombinant microorganism obtained by integrating the above-mentioned expression cassette into the target microorganism. The recombinant microorganism can be understood to refer not only to a specific recombinant microorganism, but also to the offspring of such a cell, and due to natural, accidental or intentional mutations and / or changes, the offspring may not be completely identical to the original parent cell, but is still included in the scope of the recombinant microorganism.

[0042] In some embodiments, the recombinant microorganism may be a recombinant bacterium W3110 / pBJ23119-hchA. The recombinant bacterium W3110 / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the Escherichia coli W3110 strain with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the Escherichia coli W3110 strain unchanged.

[0043] In some embodiments, the recombinant microorganism may be a recombinant bacterium YPR / pBJ23119-hchA. The recombinant bacterium YPR / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-arginine producing bacterium CGMCC 25402 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-arginine producing bacterium CGMCC 25402 unchanged.

[0044] In some embodiments, the recombinant microorganism is a recombinant bacterium YPT / pBJ23119-hchA. The recombinant bacterium YPT / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-threonine producing bacterium CGMCC 25404 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-threonine producing bacterium CGMCC 25404 unchanged.

[0045] In some embodiments, the recombinant microorganism is a recombinant bacterium YPW / pBJ23119-hchA. The recombinant bacterium YPW / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-tryptophan producing bacterium CGMCC 25403 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-tryptophan producing bacterium CGMCC 25403 unchanged.

[0046] In some embodiments, the recombinant microorganism is a recombinant bacterium YPV / pBJ23119-hchA. The recombinant bacterium YPV / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-valine-producing bacterium CGMCC 22721 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-valine-producing bacterium CGMCC 22721 unchanged.

[0047] In order to solve the above technical problems, the present invention also provides a recombinant microorganism producing amino acids.

[0048] The amino acid-producing recombinant microorganism provided by the present invention includes (or is) obtained by transforming a receptor microorganism as follows: increasing the content and / or activity of the above-mentioned Hsp31 protein in the receptor microorganism.

[0049] In order to solve the above technical problems, the present invention also provides a method for constructing a recombinant microorganism for producing amino acids.

[0050] The method for constructing a recombinant microorganism for producing amino acids provided by the present invention comprises the following steps: increasing the content and / or activity of the above-mentioned Hsp31 protein in a receptor microorganism to obtain a recombinant microorganism; the amino acid production of the recombinant microorganism is higher than that of the receptor microorganism.

[0051] In order to solve the above technical problems, the present invention also provides a method for increasing the amino acid production of microorganisms.

[0052] The method for increasing the amino acid production of microorganisms provided by the present invention comprises the following steps: increasing the content and / or activity of Hsp31 protein in the amino acid-producing microorganisms.

[0053] In any of the above methods, the method for increasing the content and / or activity of Hsp31 protein in the recipient microorganism may be any of the following:

[0054] X1) comprising the step of introducing a gene encoding an Hsp31 protein into a recipient microorganism;

[0055] X2) comprises the step of integrating the gene encoding the Hsp31 protein into the genome of the recipient microorganism.

[0056] Furthermore, the method for integrating the gene encoding the Hsp31 protein into the genome of the recipient microorganism may be integrating the gene encoding the Hsp31 protein into the ycjF gene in the genome of the recipient microorganism.

[0057] Furthermore, the integration of the gene encoding the Hsp31 protein into the ycjF gene in the genome of the recipient microorganism may be the replacement of the ycjF gene in the genome of the recipient microorganism with an expression cassette of the gene encoding the Hsp31 protein.

[0058] In some embodiments, the expression cassette of the Hsp31 protein encoding gene includes a promoter for initiating expression of the Hsp31 protein encoding gene and the Hsp31 protein encoding gene.

[0059] The nucleotide sequence of the promoter used to initiate the expression of the Hsp31 protein encoding gene is shown in positions 501-577 of SEQ ID No. 3.

[0060] The nucleotide sequence of the Hsp31 protein encoding gene is shown in SEQ ID No. 3, positions 578-1429.

[0061] In some specific embodiments, the nucleotide sequence of the expression cassette of the Hsp31 protein encoding gene is shown in positions 501-1429 of SEQ ID No.3.

[0062] Furthermore, the method for integrating the gene encoding the Hsp31 protein into the ycjF gene in the genome of the recipient microorganism may be to introduce the substance of integrating the gene encoding the Hsp31 protein into the ycjF gene in the genome of the recipient microorganism into the recipient microorganism.

[0063] In some embodiments, the material for integrating the gene encoding the Hsp31 protein into the ycjF gene in the genome of the recipient microorganism includes a CRISPR / Cas9 gene editing vector and a homologous recombination fragment for knocking out the ycjF gene.

[0064] The CRISPR / Cas9 gene editing vector for knocking out the ycjF gene expresses sgRNA and Cas9 protein targeting the ycjF gene.

[0065] The homologous recombination fragment includes the ycjF upstream homology arm, the expression box of the Hsp31 protein encoding gene and the ycjF downstream homology arm in sequence.

[0066] In some specific embodiments, the target sequence of the sgRNA may be ttgtcgggcagggtgtacag.

[0067] The nucleotide sequence of the homologous recombination fragment is shown in SEQ ID No.3.

[0068] In any of the above methods, the microorganism may be yeast, bacteria, algae or fungi.

[0069] Furthermore, the bacterium may be any bacterium capable of producing amino acids, such as bacteria from the genus Brevibacterium, Corynebacterium, Escherichia, Aerobacter, Micrococcus, Flavobacterium or Bacillus.

[0070] Furthermore, the bacteria is Escherichia coli.

[0071] In some embodiments, the Escherichia coli is Escherichia coli W3110 strain.

[0072] In other embodiments, the Escherichia coli is a high-producing L-amino acid strain, such as the high-producing L-arginine strain CGMCC 25402, the high-producing L-threonine strain CGMCC 25404, the high-producing L-tryptophan strain CGMCC 25403, and the high-producing L-valine strain CGMCC 22721.

[0073] In order to solve the above technical problems, the present invention finally provides a method for producing amino acids.

[0074] The method for producing amino acids provided by the present invention comprises the following steps: culturing the above-mentioned recombinant microorganism to obtain amino acids.

[0075] The culture method can be carried out according to conventional test methods in the prior art, or can be carried out using optimized and improved conventional test methods.

[0076] Any of the above amino acids includes at least one of the following amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, histidine, isoleucine, glycine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

[0077] In some embodiments, the amino acid is L-arginine.

[0078] In some embodiments, the amino acid is L-threonine.

[0079] In some embodiments, the amino acid is L-tryptophan.

[0080] In some embodiments, the amino acid is L-valine.

[0081] The present invention constructs recombinant bacteria W3110 / pBJ23119-hchA, YPR / pBJ23119-hchA, YPT / pBJ23119-hchA, YPW / pBJ23119-hchA, and YPV / pBJ23119-hchA with improved hchA gene expression by inserting the hchA gene at the ycjF site in the genome of the model strain W3110 and the high-yield L-amino acid strain. By fermenting and culturing these recombinant bacteria, it is found that the overexpression of the hchA gene helps to increase the yield of L-threonine, L-tryptophan, L-arginine, and L-valine, regardless of the high-yield L-amino acid strain or the model strain W3110. The present invention has great application value for cultivating high-yield and high-quality strains that meet industrial production, as well as industrial production of amino acids.

[0082] Collection Instructions

[0083] Bacteria species: Escherichia coli

[0084] Latin name: Escherichia coli

[0085] Strain ID: YP004-8

[0086] Depository: China General Microbiological Culture Collection Center Depository abbreviation: CGMCC

[0087] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0088] Storage date: 2022-07-25

[0089] CGMCC Registration Number: CGMCC No.25402

[0090] Bacteria species: Escherichia coli

[0091] Latin name: Escherichia coli

[0092] Strain ID: YP006D

[0093] Depository: China General Microbiological Culture Collection Center Depository abbreviation: CGMCC

[0094] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0095] Storage date: 2022-07-25

[0096] CGMCC Registration Number: CGMCC No.25403

[0097] Bacteria species: Escherichia coli

[0098] Latin name: Escherichia coli

[0099] Strain ID: YP0158

[0100] Depository: China General Microbiological Culture Collection Center Depository abbreviation: CGMCC

[0101] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0102] Storage date: 2022-07-25

[0103] CGMCC Registration Number: CGMCC No.25404

[0104] Bacteria species: Escherichia coli

[0105] Latin name: Escherichia coli

[0106] Strain ID: YP045

[0107] Depository: China General Microbiological Culture Collection Center Depository abbreviation: CGMCC

[0108] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0109] Collection date: 2021-06-15

[0110] CGMCC Registration Number: CGMCC No.22721 BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1 This is the growth curve of E.coli-Arg under hyperosmotic stress.

[0112] Figure 2 It is the half inhibitory concentration of E.coli-Arg under hyperosmotic stress.

[0113] Figure 3 This is the growth curve of the strain modified with stress-resistant elements under arginine stress.

[0114] Figure 4 The mortality rate of strains transformed with stress resistance elements under arginine stress. DETAILED DESCRIPTION

[0115] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0116] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0117] The Escherichia coli W3110 in the following examples is a product of Beijing Tianjingsha Gene Technology Co., Ltd., with a product number of 2-0286.

[0118] The pGRB plasmid in the following examples is a product of Addgene, catalog number 71539.

[0119] The pREDCas9 plasmid in the following examples is a product of Addgene, with catalog number 71541.

[0120] Example 1: Screening of stress resistance elements in arginine-producing strains

[0121] 1. Construction of strains expressing stress resistance elements

[0122] 1. Preliminary screening of stress-resistant components

[0123] The inventors of the present application conducted preliminary research and screened out 4 stress resistance element genes, as shown in Table 1.

[0124] Table 1. Four stress-resistant components

[0125] Stress resistance gene source CDS Sequence iR Deinococcusradiodurans Sequence 7 in the sequence listing oeLh Escherichia coli Sequence 6 in the sequence listing MaUsp1 Morus alba Sequence 8 in the sequence listing hh Escherichia coli Sequence 1 in the sequence list

[0126] 2. Construction of strains expressing stress resistance elements

[0127] (1) Synthesize the stress resistance element genes in Table 1.

[0128] (2) The four stress-resistant element genes were respectively connected to the empty pETDuet-hTERT-noMCS2 (pEM) plasmid (NovoPro) to obtain the recombinant plasmids pEM-irrE, pEM-otsB, pEM-MaUsp1, and pEM-hchA, respectively.

[0129] (3) The recombinant plasmids pEM-irrE, pEM-otsB, pEM-MaUsp1, and pEM-hchA were electroporated into the L-arginine-producing bacterium CGMCC 25402 (abbreviated as E. coli-Arg), and after identification, the recombinant bacteria E. coli-Arg-pEM-irrE, E. coli-Arg-pEM-otsB, E. coli-Arg-pEM-MaUsp1, and E. coli-Arg-pEM-hchA were obtained, respectively, and stored in a low-temperature refrigerator at 80°C.

[0130] 2. Determination of the conditions for evaluating strain tolerance

[0131] 1. Strain activation

[0132] (1) Take out the glycerol bacteria (E. coli-Arg) from the -80℃ low-temperature refrigerator, add 1mL of bacterial solution to 30mL of activation medium (Table 2), and culture at 37℃ and 200rpm until the OD 600 It is about 3.0.

[0133] Table 2. Activation culture medium (solvent is water)

[0134]

[0135] (2) Dip the activated bacterial solution in the four-ring culture medium and inoculate it densely on a fresh activated slant culture medium. Incubate at 37°C for about 12 h, and then wash it with water for seed culture in the next step.

[0136] 2. Gradient concentration hyperosmotic stress culture

[0137] (1) Preparation of culture medium

[0138] The hyperosmotic stress medium containing different concentrations of L-arginine was prepared according to the formula shown in Table 3.

[0139] Table 3. Hyperosmotic stress culture medium (solvent is water)

[0140]

[0141]

[0142] (2) Fermentation culture

[0143] Wash the activated slant with water, inoculate the washed bacterial solution into 100 mL of fermentation medium (hyperosmotic stress medium containing different concentrations of L-arginine), and ensure that the initial OD 600 The concentration of the culture medium is about 0.1, 37°C, and 200 rpm, and the culture is continued until the bacterial growth enters the stable phase (about 12-14 hours).

[0144] 3. Half inhibitory concentration (IC 50 )

[0145] Fitting the growth curve of the strain under each stress concentration ( Figure 1 ), calculate its maximum specific growth rate, and fit the maximum specific growth rate of the strain under each stress concentration to a curve, calculate the specific growth rate under 0 stress concentration, and the stress concentration corresponding to 1 / 2 of the specific growth rate is the half-inhibitory concentration of the strain.

[0146] The half-inhibitory concentration of strain E. coli-Arg was calculated to be 85 g / L L-arginine ( Figure 2 ), so 85 g / L L-arginine was selected as the stress condition for the subsequent strain tolerance evaluation.

[0147] 3. Evaluation of the tolerance of strains expressing stress resistance elements

[0148] 1. Strain activation

[0149] (1) Take out the glycerol bacteria (recombinant bacteria E. coli-Arg-pEM-irrE, E. coli-Arg-pEM-otsB, E. coli-Arg-pEM-MaUsp1, E. coli-Arg-pEM-hchA) from the -80°C freezer, add 1 mL of bacterial solution to 30 mL of activation medium, and culture at 37°C and 200 rpm until OD 600 It is about 3.0.

[0150] (2) Dip the activated bacterial solution in the four-ring culture medium and inoculate it densely on a fresh activated slant culture medium. Incubate at 37°C for about 12 h, and then wash it with water for seed culture in the next step.

[0151] 2. Gradient concentration hyperosmotic stress culture

[0152] (1) Preparation of culture medium

[0153] A hyperosmotic stress medium containing 85 g / L L-arginine was prepared according to the formula shown in Table 3.

[0154] (2) Fermentation culture

[0155] Wash the activated slant with water, inoculate the washed bacterial solution into 100 mL of fermentation medium (hyperosmotic stress medium containing 85 g / L L-arginine), and ensure that the initial OD 600 The concentration of the culture medium is about 0.1, 37°C, and 200 rpm, and the culture is continued until the bacterial growth enters the stable phase (about 12-14 hours).

[0156] (3) Determination of strain mortality

[0157] During the fermentation process, samples were taken every 4 h, centrifuged at 5000 rpm for 3 min, the supernatant was discarded, and the precipitate was collected; then washed twice with PBS and diluted to OD 600 To 0.2-0.5. 5 μL / mL of PI dye was added to the experimental group and stained in the dark for 15 min, while the control group (initial strain E. coli-Arg) was not stained. Flow cytometry was used to analyze cell mortality.

[0158] 3. Growth and mortality changes of strains expressing stress resistance elements under stress conditions

[0159] The results showed that under the stress of adding 85g / L L-arginine, only the strain E.coli-Arg-pEM-hchA had a higher growth rate and maximum OD compared with the initial strain (E.coli-Arg). 600 Both have been significantly improved ( Figure 3 ), and the mortality rate was lower than that of the initial strain ( Figure 4 ).

[0160] The above screening results show that the stress resistance element hchA can improve the tolerance of E. coli-Arg to high concentrations of L-arginine to a certain extent.

[0161] Example 2: Construction of an amino acid-producing genetically engineered strain overexpressing the hchA gene

[0162] According to the genome sequence of Escherichia coli W3110 strain published by NCBI, the ycjF gene in the genome of the model strain W3110 and the high-yield L-amino acid strain was knocked out using CRISPR / Cas9 gene editing technology (Sequence ID: CP097882.1, submitted on 11-OCT-2022), and the hchA gene from Escherichia coli was inserted into the ycjF site to further study the effect of hchA on L-amino acid production in the high-yield L-amino acid strain. Among them, the hchA gene (SEQ ID No.1) encodes the Hsp31 protein, and the amino acid sequence of the Hsp31 protein is shown in SEQ ID No.2.

[0163] 1. Construction of sgRNA

[0164] 1. Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting the appropriate sgRNA target sequence, the linearized pGRB cloning vector end sequence was added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0165] sgRNA-1F and sgRNA-1R were annealed by PCR to obtain double-stranded sgRNA molecules. The reaction system for PCR annealing is as follows: sgRNA-1F 10μL, sgRNA-1R 10μL; the reaction procedure for PCR annealing is as follows: 95℃ denaturation for 5min, 50℃ annealing for 1min. After annealing, the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100ng / μL. The primer sequences are as follows (synthesized by Suzhou Jinweizhi Company):

[0166] sgRNA-1F:

[0167] 5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT ttgtcgggcagggtgtacag GTTTTAGAGCT AGAAAT AGCAAGTTAAAATAAGG -3';

[0168] sgRNA-1R:

[0169] 5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ctgtacaccctgcccgacaa ACTAGTATTAT ACCTA GGACTGAGCTAGCTGTCA -3'.

[0170] In the above sgRNA-1F and sgRNA-1R, the underlined bases are the homology arm sequences of the pGRB cloning vector, and the bases in lowercase are the sgRNA sequences.

[0171] 2. Extract the pGRB plasmid and digest it with Spe I and dephosphorylate it to prevent the pGRB plasmid from self-ligating. Enzyme digestion system: 10xBuffer 5μL, SpeI 2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After digestion at 37℃ for 3h, agarose gel electrophoresis was performed and the gel was recovered and then dephosphorylation reaction was performed. The dephosphorylation reaction system is as follows: 10xBuffer 5μL, linearized pGRB plasmid DNA 1000-2000ng, CIAP 2.5μL, supplemented with ddH2O to 50μL. After treatment at 37℃ for 1h, the linearized pGRB plasmid was recovered using a DNA purification kit.

[0172] 3. Use Gibson Assembly Kit (New England) to recombine double-stranded sgRNA molecules and linear pGRB plasmids. The recombination system is as follows: 2.5 μL of NEB assembly enzyme, 2 μL of linearized cloning vector, and 0.5 μL of double-stranded sgRNA molecules. After assembling at 50°C for 30 minutes, transform the product into DH5α competent cells, extract the plasmid, and sequence and identify it with sequencing primers sgRNA-PF / sgRNA-PR, and name the plasmid with correct sequencing pGRB-sgRNA. The primer sequences are as follows:

[0173] sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3';

[0174] sgRNA-PR: 5'-ATGAGAAAGCGCCACGCT-3'.

[0175] 2. Amplification of overexpressed hchA gene

[0176] 1. Using W3110 genomic DNA as a template, KAPA HiFi HotStart was used to perform PCR amplification using primers P1 / P2, P3 / P4, and P5 / P6 to obtain a 550 bp ΔycjF upstream homology arm (ΔycjF-UP), a 919 bp pBJ23119-hchA, and a 561 bp ΔycjF downstream homology arm (ΔycjF-DOWN).

[0177] The primer sequences are as follows:

[0178] P1: 5'-TTTAATGATATGCGTCTGGC-3'.

[0179] P2: 5'-TGGTCTTACCAATTTGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAACGCAATTTATCTCCTATTAA-3'.

[0180] P3: 5'-CTAGCAAATTGGTAAGACCAATTAAGCTTAAAGAGGAGAAAGAATTCATGACTGTTCAAACAAGTAA-3'.

[0181] P4: 5'-GGTCAGCACCCGATATTGCATTAACCCGCGTAAGCTGCCAG-3'.

[0182] P5: 5'-CTGGCAGCTTACGCGGGTTAATGCAATATCGGGTGCTGACC-3'.

[0183] P6: 5'-CCGCACAATTGATTAACGGC-3'.

[0184] 2. After the PCR reaction, a column DNA gel recovery kit was used to perform agarose gel electrophoresis to recover (ΔycjF-UP), pBJ23119-hchA and ΔycjF-DOWN. The recovered DNA was subjected to overlap PCR with primers P1 / P6 to obtain a 1969 bp hchA overexpression integration homology arm DNA fragment Up-pBJ23119-hchA-Down. The DNA fragment is shown in SEQ ID No.3, wherein SEQ ID No.3 Nos. 1-500 are ΔycjF upstream homology arm sequences, Nos. 501-577 are pBJ23119 promoter sequences, Nos. 578-1429 are hchA coding gene sequences, and Nos. 1430-1969 are ΔycjF downstream homology arm sequences.

[0185] The overlap PCR amplification system is as follows: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0186] The overlap PCR amplification program was as follows: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), and over-extension at 72°C for 5 min.

[0187] 3. Preparation and transformation of competent cells

[0188] The pREDCas9 plasmid (containing the spectinomycin resistance gene) was extracted and transformed into wild-type Escherichia coli W3110, high-yield L-arginine strain CGMCC 25402, high-yield L-threonine strain CGMCC 25404, high-yield L-tryptophan strain CGMCC25403, and high-yield L-valine strain CGMCC 22721 competent cells were spread on 2-YT agar plates containing spectinomycin (100 mg / L) and cultured at 32°C. Single colonies resistant to spectinomycin (100 mg / L) were selected and identified by PCR using primers pRedCas9-PF / pRedCas9-PR (pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3' and pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3'). The PCR amplified positive transformants with a size of 872 bp were obtained, and wild-type Escherichia coli W3110 containing pREDCas9 plasmid (abbreviated as W3110-Cas9), L-arginine-producing bacteria CGMCC 25402 containing pREDCas9 plasmid (abbreviated as L-arginine CGMCC 25402-Cas9), and L-threonine-producing bacteria CGMCC 25404 containing pREDCas9 plasmid (abbreviated as CGMCC 25404-Cas9), L-tryptophan-producing bacteria CGMCC 25403 containing the pREDCas9 plasmid (referred to as L-tryptophan CGMCC 25403-Cas9), and L-valine-producing bacteria CGMCC 22721 containing the pREDCas9 plasmid (referred to as L-valine CGMCC 22721-Cas9).

[0189] Prepare W3110-Cas9, L-arginine CGMCC 25402-Cas9, L-threonine CGMCC 25404-Cas9, L-tryptophan CGMCC 25403-Cas9 and L-valine CGMCC 22721-Cas9 competent cells respectively. 600 =0.1Add IPTG at a final concentration of 0.1mM to induce λ-Red-mediated homologous recombination. 600 =0.6, the bacteria were collected to prepare competent cells, and the pGRB-sgRNA plasmid and the genomic overexpression DNA fragment Up-pBJ23119-hchA-Down were transformed, respectively, and spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. The single colonies produced by the culture were identified by PCR using primers P7 / P8 (P7: 5'-CGCTTTAATT ATTACTGCGA-3' and P8: 5'-CAGACCGGAAATGGTCGCCA-3'), and the fragment with a size of 997 bp (SEQ ID No. 4) amplified by PCR was a positive transformant.

[0190] The positive transformants were inoculated in 2-YT medium containing spectinomycin (100 mg / L) and arabinose with a final concentration of 0.2% to eliminate the plasmid pGRB-sgRNA, and the colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected, and then these colonies were transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. The colonies that did not grow on spectinomycin (100 mg / L) but grew on 2-YT medium without resistance were selected, and PCR identification was performed using primers P9 / P10 (P9: 5'-AACGCTGATAGCGAATATGC-3' and P10: 5'-CTGGCGGCCCATACGAATCG-3'). The PCR amplified fragment with a size of 1152 bp (SEQ ID No. 5) was a positive transformant.

[0191] The positive transformants were sent for sequencing, and the recombinant bacteria with correct sequencing were named W3110 / pBJ23119-hchA, YPR / pBJ23119-hchA, YPT / pBJ23119-hchA, YPW / pBJ23119-hchA, and YPV / pBJ23119-hchA. The recombinant bacteria W3110 / pBJ23119-hchA, YPR / pBJ23119-hchA, YPT / pBJ23119-hchA, YPW / pBJ23119-hchA, and YPV / pBJ23119-hchA all contained double copies of the hchA gene shown in SEQ ID No. 1. The recombinant bacteria containing double copies of the hchA gene can significantly and stably increase the expression level of the hchA gene in wild-type Escherichia coli W3110 and amino acid high-yielding strains.

[0192] The recombinant bacterium W3110 / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the Escherichia coli W3110 strain with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the Escherichia coli W3110 strain unchanged.

[0193] The recombinant bacterium YPR / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-arginine producing bacterium CGMCC 25402 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-arginine producing bacterium CGMCC 25402 unchanged.

[0194] The recombinant bacterium YPT / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-threonine producing bacterium CGMCC 25404 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-threonine producing bacterium CGMCC 25404 unchanged.

[0195] The recombinant bacterium YPW / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-tryptophan producing bacterium CGMCC 25403 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-tryptophan producing bacterium CGMCC 25403 unchanged.

[0196] The recombinant bacterium YPV / pBJ23119-hchA is obtained by replacing the ycjF gene in the genome sequence of the L-valine producing bacterium CGMCC 22721 with the hchA gene expression cassette (SEQ ID No. 3, positions 501-1429), while keeping the other sequences of the L-valine producing bacterium CGMCC 22721 unchanged.

[0197] Example 3, fermentation experiment

[0198] 1. L-threonine fermentation experiment

[0199] Escherichia coli W3110, Escherichia coli W3110 / pBJ23119-hchA, YPT / pBJ23119-hchA and Escherichia coli CGMCC 25404 were inoculated in a 5L fermenter of BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-threonine fermentation medium and culture conditions. Each strain was repeated three times, and the results were averaged over three fermentations. After the fermentation, the L-threonine content was detected by high performance liquid chromatography (HPLC), and the results were averaged over three replicates.

[0200] L-threonine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn syrup 5 g / L, molasses 17 g / L, and ammonia is added to adjust the pH to 7.0.

[0201] L-Threonine fermentation conditions:

[0202] Calibration DO 100%: temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0Mpa, calibration after 5min;

[0203] Inoculation amount 10%;

[0204] Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0205] Full control:

[0206] 1. When dissolved oxygen is less than 30%, increase the speed in sequence: 500rpm→600rpm→air volume 1L / min→700rpm→800rpm;

[0207] 2. After 8 hours of fermentation, the tank pressure is 0.01Mpa; after 12 hours of fermentation, the tank pressure is 0.02Mpa→0.03Mpa→0.04Mpa→0.05Mpa;

[0208] Residual sugar control: 0.1-0.5% before 12 hours of fermentation; after 12 hours of fermentation, the residual sugar is controlled to 0.1-0.3% according to DO requirements;

[0209] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0210] Fermentation cycle: about 30 hours, the control process uses 20-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0211] The results are shown in Table 4. The results showed that overexpression of the hchA gene could increase the production of L-threonine.

[0212] Table 4. Results of small-scale fermentation of threonine engineering bacteria

[0213]

[0214] 2. L-Tryptophan Fermentation Experiment

[0215] Escherichia coli W3110, Escherichia coli W3110 / pBJ23119-hchA, YPW / pBJ23119-hchA and Escherichia coli CGMCC 25403 were inoculated into a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) and fermented using L-tryptophan fermentation medium and culture conditions. Each strain was repeated three times, and the results were taken as the average of the three replicates.

[0216] L-tryptophan fermentation medium: the solvent is water, the solutes and their concentrations are glucose 7g / L, FM902 yeast powder 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, defoaming agent 0.2mL / L, and ammonia is added to adjust the pH to 7.0.

[0217] L-Tryptophan Culture Conditions:

[0218] Calibration DO100%: temperature 35℃, speed 800rpm, air volume 5L / min, tank pressure 0Mpa;

[0219] Inoculation amount 10%;

[0220] Initial conditions: temperature 35°C, pH 7.0, air volume 1.0 L / min, speed 350 rpm;

[0221] Full process control: When dissolved oxygen is ≤20% before the base sugar is consumed, increase the speed in sequence → 400rpm → 450rpm; when the base sugar is consumed, add sugar to control dissolved oxygen at 15-30%;

[0222] pH control: 7.0 before 24h fermentation, 6.7 after 24h fermentation;

[0223] Residual sugar control: 0.1-0.5% before 12 hours of fermentation; after 12 hours of fermentation, the residual sugar is controlled to 0.1-0.3% according to DO requirements;

[0224] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0225] Fermentation cycle: about 34 hours, the control process uses 15-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0226] The results are shown in Table 5. The results showed that overexpression of the hchA gene can increase the production of L-tryptophan.

[0227] Table 5. Tryptophan engineering bacteria small-scale fermentation results

[0228]

[0229]

[0230] 3. L-arginine fermentation experiment

[0231] Escherichia coli W3110, Escherichia coli W3110 / pBJ23119-hchA, YPR / pBJ23119-hchA, and Escherichia coli CGMCC 25402 were inoculated into a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) and fermentation experiments were carried out using L-arginine fermentation medium and culture conditions. Each strain was repeated three times and the results were taken as the average of the three replicates.

[0232] L-arginine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 8g / L, FM902 yeast powder 3g / L, K2HPO4·3H2O 6g / L, MgSO4·7H2O 1g / L, FeSO4·7H2O 0.05g / L, betaine 0.5g / L, VB 12 0.005g / L, defoamer 0.3mL / L, ammonium sulfate 3g / L, pH 7.2.

[0233] L-arginine fermentation conditions:

[0234] Calibration DO100%: temperature 35°C, pH 7.2, speed 100rpm, air volume 6L / min, tank pressure 0Mpa;

[0235] Inoculation amount 10%;

[0236] Initial conditions: temperature 35°C, pH 7.2, tank pressure 0.01 MPa, air volume 1.5 L / min, speed 350 rpm;

[0237] Full process control: control DO at 20-30%; when dissolved oxygen ≤ 25%, increase the speed each time: 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0238] Residual sugar control: The residual sugar is controlled at 0.05-0.1% throughout the process;

[0239] Feed materials: 25% ammonia water, 80% concentrated sugar, 10% sodium bicarbonate;

[0240] Fermentation cycle: about 50h, the control process uses 20-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0241] The results are shown in Table 6. The results showed that overexpression of the hchA gene can increase the production of L-arginine.

[0242] Table 6. Results of small-scale fermentation of arginine engineering bacteria

[0243]

[0244] IV. L-valine fermentation experiment

[0245] Escherichia coli W3110, Escherichia coli W3110 / pBJ23119-hchA, YPV / pBJ23119-hchA and Escherichia coli CGMCC 22721 were inoculated into a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) and fermentation experiments were carried out using L-valine fermentation medium and culture conditions. Each strain was repeated three times, and the results were taken as the average of the three repetitions.

[0246] L-valine fermentation medium: the solvent is water, the solutes and their concentrations are yeast extract powder 4g / L, corn steep liquor powder 2g / L, peptone 4g / L, methionine 2g / L, KH2PO4·3H2O 7g / L, MgSO4·7H2O 2g / L, CoCl2 20mg / L, (NH4)2SO4 3g / L, citric acid 2g / L, FeSO4·7H2O 50mg / L, MnSO4·7H2O 30mg / L, VH 20mg / L, VB11.5mg / L, VB3 1.5mg / L, VB 12 1.5g / L, defoamer 0.3mL / L, (NH4)2SO4 3g / L, pH 7.0.

[0247] L-valine fermentation culture conditions: Dissolved oxygen electrode calibration method: calibrate the zero point in saturated sodium sulfite solution and calibrate the hundred point in air;

[0248] L-valine fermentation includes two stages of aerobic-limited oxygen fermentation. The cells are first cultured under aerobic fermentation. The air volume, speed and sugar addition rate are adjusted in the early stage to control the dissolved oxygen at about 25%. 600 When the value reaches 50-60, the speed is reduced to 400rpm, the air volume is reduced to 2L / min, and the aerobic fermentation is converted to oxygen-limited fermentation. The fermentation cycle is 48h.

[0249] The results are shown in Table 7. The results showed that overexpression of the hchA gene can increase the production of valine.

[0250] Table 7. Valine engineering bacteria small-scale fermentation results

[0251]

[0252] From the above fermentation results, it can be seen that overexpression of the hchA gene helps to increase the production of L-threonine, L-tryptophan, L-arginine and L-valine, regardless of the high-yield L-amino acid strain or the model strain W3110.

[0253] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of Hsp31 protein in at least any one of the following M1)-M4): M1) Increase the amino acid production of microorganisms; M2) preparing products that increase the amino acid production of microorganisms; M3) constructing a recombinant microorganism for producing amino acids; M4) Preparation of products for constructing recombinant microorganisms for producing amino acids.

2. The use according to claim 1, characterized in that: The Hsp31 protein comprises at least any one of the following a1) or a2) or a3) or a4): a1) a protein containing the amino acid sequence shown in SEQ ID No.2; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or the C-terminus of the protein shown in SEQ ID No. 2; a3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2; a4) A protein having 98% identity with the amino acid sequence shown in SEQ ID No. 2 and having the same function.

3. Use of a biological material related to the Hsp31 protein according to any one of claims 1 to 2 in at least one of the following M1) to M4): M1) Increase the amino acid production of microorganisms; M2) preparing products that increase the amino acid production of microorganisms; M3) constructing a recombinant microorganism for producing amino acids; M4) preparing products of constructing recombinant microorganisms for producing amino acids; The biological material is a nucleic acid molecule encoding the Hsp31 protein according to any one of claims 1 to 2, or an expression cassette or a recombinant vector containing the nucleic acid molecule.

4. The use according to claim 3, characterized in that: The nucleic acid molecule comprises the gene shown in B1) or B2) below: B1) a DNA molecule containing the nucleotide sequence shown in SEQ ID No.1; B2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) and encoding the Hsp31 protein.

5. A recombinant microorganism producing amino acids, wherein the recombinant microorganism is obtained by modifying a receptor microorganism as follows: the content and / or activity of the Hsp31 protein in any one of claims 1 to 2 in the receptor microorganism is increased.

6. A method for constructing a recombinant microorganism for producing amino acids, comprising the following steps: increasing the content and / or activity of the Hsp31 protein described in any one of claims 1-2 in a recipient microorganism to obtain a recombinant microorganism; the amino acid production of the recombinant microorganism is higher than that of the recipient microorganism.

7. A method for increasing the amino acid production of a microorganism, comprising the following steps: increasing the content and / or activity of the Hsp31 protein according to any one of claims 1 to 2 in an amino acid-producing microorganism.

8. The method according to any one of claims 5 to 7, characterized in that: The method for increasing the content and / or activity of the Hsp31 protein according to any one of claims 1 to 2 in a recipient microorganism comprises the step of introducing a gene encoding the Hsp31 protein into the recipient microorganism.

9. A method for producing amino acids, comprising the following steps: culturing the recombinant microorganism according to claim 5 to obtain amino acids.

10. The use according to any one of claims 1 to 4, the recombinant microorganism according to claim 5, or the method according to any one of claims 6 to 9, characterized in that: The microorganism is Escherichia coli.

Images