A protein AaBBX21 for increasing the content of anthocyanins in plants and its application in encoding gene

Abstract

The present invention relates to the field of genetic engineering technology, and specifically discloses a protein AaBBX21 for increasing the anthocyanin content of plants and the application of its encoding gene. The protein AaBBX21, whose gene encoding sequence is shown in SEQ ID No.1; after the encoding gene of AaBBX21 is overexpressed in plants by genetic engineering means, it is used to increase the anthocyanin content, ornamental value and edible value of plants. The present invention adopts genetic engineering technology to clone the AaBBX21 transcription factor from the succulent plant 'Halloween', and performs bioinformatics analysis, plant overexpression vector construction, Agrobacterium-mediated genetic transformation and phenotypic analysis of transgenic Arabidopsis thaliana on AaBBX21. The AaBBX21 gene identified by the present invention can significantly increase the anthocyanin content in plant tissues and the ornamental value and edible value of plants. The present invention lays a solid foundation for the subsequent use of genetic engineering technology to carry out transgenic precision breeding to improve the ornamental value and edible value of plants, and the AaBBX21 gene has great application prospects and market potential.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a protein AaBBX21 for increasing the anthocyanin content of plants and the application of a coding gene thereof. Background Art

[0002] Anthocyanins are a class of flavonoids that often accumulate in plant flowers, fruits, seeds and other tissues. They are secondary metabolites in plants. Anthocyanins were first discovered in 1947. Currently, more than 700 types of anthocyanins have been extracted from more than 7,000 plants. Anthocyanins are very important for plants. For example, they can optimize the color of horticultural plants. At the same time, anthocyanins also play an important role in plants' resistance to abiotic stresses such as low temperature, drought and physical damage. In addition, anthocyanins are also a safe and non-toxic edible pigment. Anthocyanins are beneficial to human health. They have strong antioxidant capacity and can effectively eliminate free radicals produced in the human body, thereby playing an anti-aging role. Not only that, it can also resist inflammation, prevent obesity, resist chronic metabolic disorders, maintain cardiovascular health and improve vision. Anthocyanins play an important role in enhancing the ornamental value and edible value of plants.

[0003] The synthesis process of anthocyanins is relatively complex, requiring the participation of multiple enzymes and involving multiple reaction processes. The initial raw material for anthocyanin synthesis in plants is phenylalanine, which is catalyzed by phenylalanine ammonia lyase (PAL), cinnamic acid 4-hydroxylase (C4H) and 4-coumarate coenzyme A ligase (4CL) to produce coumaroyl-CoA. Then, enzymes such as chalcone isomerase (CHI), chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3' H), dihydroflavonol reductase (DFR), anthocyanidin synthase (ANS), and flavonoid glycosyltransferase (UFGT) perform secondary processing on it to produce various types of anthocyanins. In addition to being affected by structural genes, the synthesis process of anthocyanins is also regulated by many transcription factors, such as MYB, bHLH, WD40, BBX and other types of transcription factors. Although both structural genes and transcription factors are involved in the synthesis of plant anthocyanins, research has found that overexpressing structural genes in plants usually does not make the plants accumulate more anthocyanins. However, overexpressing transcription factors in plants through genetic engineering can significantly increase the accumulation of anthocyanins in transgenic plants.

[0004] Zinc finger transcription factors are commonly found in eukaryotes, and the BBX (B-Box) family is one of its subfamilies. BBX is an important type of transcription factor that is widely present in plants and is involved in regulating plant growth and development, including anthocyanin synthesis, hypocotyl growth, seedling photomorphogenesis, and flowering. BBX family members can be divided into five different subfamilies based on the different B-box domains. Among them, members belonging to the fourth subfamily have the function of promoting anthocyanin synthesis and have strong application value in improving the ornamental and edible value of plants. Summary of the invention

[0005] In order to improve the ornamental value and edible value of plants in agricultural production, the present invention provides a protein AaBBX21 for increasing the anthocyanin content of plants and the application of its encoding gene.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A protein AaBBX21, whose gene coding sequence is shown as SEQ ID No.1.

[0007] The invention discloses an application of a protein AaBBX21 coding gene, which is used to increase the anthocyanin content, ornamental value and edible value of plants after overexpressing the AaBBX21 coding gene in plants through genetic engineering.

[0008] Furthermore, the application method of the protein AaBBX21 encoding gene is to connect the encoding sequence of the AaBBX21 gene with a plant overexpression vector using homologous recombination technology, and then transfer the recombinant plasmid into Agrobacterium.

[0009] Furthermore, the overexpression vector is pCAMBIA2300S.

[0010] Furthermore, the Agrobacterium is GV3101.

[0011] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses genetic engineering technology to clone the AaBBX21 transcription factor from the succulent plant 'Halloween' (Aeonium arboreum'Halloween'), and conducts bioinformatics analysis, plant overexpression vector construction, Agrobacterium-mediated genetic transformation and transgenic Arabidopsis thaliana phenotypic analysis on AaBBX21. The AaBBX21 gene identified by the present invention can significantly increase the anthocyanin content in plant tissues and the ornamental and edible values ​​of plants. The present invention lays a solid foundation for the subsequent use of genetic engineering technology for transgenic precision breeding to improve the ornamental and edible values ​​of plants. The AaBBX21 gene has great application prospects and market potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the electrophoresis diagram of the amplified coding sequence of the AaBBX21 gene.

[0013] Figure 2 This is a diagram of the evolutionary tree analysis of the AaBBX21 transcription factor phylogenetic relationship.

[0014] Figure 3 This is a map of the AaBBX21 protein sequence alignment.

[0015] Figure 4 This is a diagram of the transcriptional activity analysis of AaBBX21 protein.

[0016] Figure 5 This is the result of double enzyme digestion of pCAMBIA2300S-AaBBX21 plasmid.

[0017] Figure 6 Figure 2 is a phenotype diagram of wild-type and AaBBX21 transgenic Arabidopsis seedlings.

[0018] Figure 7 Figure 2 shows the phenotypes of the inflorescence axis of wild-type and AaBBX21 transgenic Arabidopsis thaliana.

[0019] Figure 8 The figure shows the fruit phenotypes of wild-type and AaBBX21 transgenic Arabidopsis thaliana.

[0020] Fig. 9 Determination of anthocyanin content in leaves (A), inflorescence axes (B) and fruit pods (C) of wild-type and AaBBX21 transgenic Arabidopsis thaliana.

[0021] Fig.10 Expression analysis of anthocyanin synthesis-related genes in wild-type and AaBBX21 transgenic Arabidopsis. DETAILED DESCRIPTION

[0022] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation mode, structure, characteristics and effects of the present invention are described in detail below in combination with the accompanying drawings and preferred embodiments.

[0023] Example 1 Cloning and sequence analysis of AaBBX21 gene The coding sequence of AaBBX21 gene was cloned from the leaves of 'Halloween' using PCR technology. The specific method is as follows: 1. Using the cDNA of 'Halloween' leaves as a template, PCR amplification was performed using a PCR instrument and specific AaBBX21 gene cloning primers AaBBX21F (TCACCTGATTTCGCTTCTGG) and AaBBX21R (AAGACACAATTGGGAGTGC G) under the action of high-fidelity polymerase. In the PCR program, the annealing temperature was set to 56°C and the extension time was set to 1 minute; 2. The PCR amplification product of the previous step was subjected to electrophoresis using 1% agarose gel, and the electrophoresis voltage was set to 120 volts for 25 minutes; 3. The gel of the previous step was observed and photographed using the gel imaging system, and an electrophoresis band of approximately 1000 bp was cut off at the same time; 4. The gel block cut off in the previous step was recovered using the Tiangen agarose gel recovery kit; 5. The PCR recovery product of the previous step was mixed with 2×Taq Mix in a ratio of 4:1, and then incubated at 72°C in a PCR instrument for 20 minutes; 6. 4 μL of the product of the previous step was mixed with 1 μL of the cloning vector pEASY-T1 on ice, and then placed in a 25°C reaction for 10 minutes; 7. The product of the previous step was added to 50 μL of melted 8. Set the thermostat to 42 degrees Celsius, and immediately place the centrifuge tube containing the competent cells and the ligation product at 42 degrees Celsius for 1 minute after the ice bath, and then immediately place it on ice for another 2 minutes, then add 500 μL LB liquid culture medium, and then culture at 37 degrees Celsius for 1 hour, and then centrifuge at 4000 rpm for 5 minutes, discard the supernatant and keep about 50 μL of liquid to resuspend the bacteria, and then spread it on a solid culture medium containing 50 mg / L kanamycin, and then culture at 37°C for about 16 hours; 9. Use a PCR instrument to detect the colonies grown on the culture medium using M13F and M13R primers, the PCR annealing temperature is 55 degrees Celsius, and the extension time is 40 seconds; 10. Perform electrophoresis on 1% agarose gel, and then use a gel imaging system to detect whether there are positive colonies; 11. Pick the positive colonies and add them to a solid culture medium containing 50 1. Use a plasmid extraction kit to extract the plasmid of the positive colony, and send the positive plasmid to a biological company for sequencing. Note: The above method does not specify the brand of drugs and instruments. As long as they are regular, any brand can be used.

[0024] The AaBBX21 gene coding sequence of the present invention is as follows: The underlined regions are 5'UTR (untranslated region) and 3'UTR respectively.

[0025] The method for AaBBX21 gene sequence analysis is as follows: based on the AaBBX21 coding sequence obtained by sequencing, related proteins with high homology to AaBBX21 were searched through BLAST in the NCBI database, and the protein sequence of AtBBXs was obtained in PlantTFDB. Then, the sequence of AaBBX21 was aligned using MEGA7.0 and an evolutionary tree was constructed.

[0026] AaBBX21 gene coding sequence amplification electrophoresis diagram Figure 1 Sequencing showed that the AaBBX21 gene nucleotide sequence has an ORF of 912 bp in length and encodes 303 amino acids. The phylogenetic tree analysis of the AaBBX21 transcription factor is shown in Figure 1. Figure 2 , showing that AaBBX21 belongs to the fourth subfamily and has the highest homology with AtBBX21 in Arabidopsis thaliana. Figure 3 , showing that it contains two B-BOX domains.

[0027] Example 2 Analysis of transcriptional activity of AaBBX21 The coding sequence of the AaBBX21 gene was connected to pGBKT7 using homologous recombination technology, and the recombinant plasmid was transferred into yeast AH109 and verified. The specific methods are as follows: 1. The coding sequence of the AaBBX21 gene with the linker sequence was PCR amplified using the linker primers AaBBX21-BDF (ATGGCCATGGAGGCCGAATTCAGAGAGATGAAGATTCAGTGC) and AaBBX21-BDR (CGCTGCAGGTCGACGGATCCAAGACACAATTGGGAGTGCG); 2. The pGBKT7 plasmid was double-digested with BamH I and EcoR I, and the vector fragment after enzyme digestion was recovered; 3. The coding sequence of the AaBBX21 gene with the linker sequence was connected to the pGBKT7 vector fragment after enzyme digestion using Norwex homologous recombination enzyme. The reaction system was 10 μL, 4 μL of the recovered product of the AaBBX21 gene coding sequence containing the linker sequence, 3 μL of the pGBKT7 double-digested product, and 5× CE IIBuffer 2 μL, homologous recombinase 1 μL, reaction conditions are 37 degrees Celsius for 30 minutes; 4. The ligation product of the previous step was transformed into Escherichia coli by heat shock method, and positive single colonies were screened and plasmids were extracted; 5. The positive plasmid was transformed into yeast strain AH109 using yeast transformation kit (Frozen-EZ Yeast Transformation II Kit). 6. The transcriptional activity of AaBBX21 transcription factor was verified on yeast culture medium SD / -Trp plate, SD / -Trp-His-Ade plate, and SD / -Trp-His-Ade / X-α-gal plate respectively.

[0028] AaBBX21 protein transcription activity analysis Figure 4 , AaBBX21 can grow well on both triple-deficient and triple-deficient plus X-α-gal plates, and will turn blue on the latter, indicating that AaBBX21 is a transcriptional activator.

[0029] Example 3 Construction of plant overexpression vector of AaBBX21 gene and transformation of Agrobacterium The coding sequence of the AaBBX21 gene was connected to the plant overexpression vector pCAMBIA2300S by homologous recombination technology, and the recombinant plasmid was transferred into Agrobacterium. The specific method is as follows: 1. The coding sequence of the AaBBX21 gene with the linker sequence was PCR amplified using the linker primers AaBBX212300SF (GAGCT TTCGCGAGCTCGGTACCAGAGAGATGAAGATTCAGTGC) and AaBBX212300SR (CAGGTC GACTCTAGAGGATCCAAGACACAATTGGGAGTGCG); 2. The plant expression vector pCAMBIA2300S was double-digested with BamH I and KpnI, and the vector fragment after enzyme digestion was recovered; 3. The coding sequence of the AaBBX21 gene with the linker sequence was connected to the pCAMBIA2300S vector fragment after enzyme digestion using Norwex homologous recombinase, the reaction system was 10 μL, and the AaBBX21 gene coding sequence containing the linker sequence was recovered 4 μL, pCAMBIA2300S double-enzyme digestion product 3μL, 5× CE II Buffer 2 μL, homologous recombinase 1 μL, the reaction conditions are 37 degrees Celsius for 30 minutes; 4. The ligation product of the previous step is transformed into Escherichia coli by heat shock method and positive single colonies are screened; 5. The plasmid of the positive single colony is extracted and the positive plasmid is double-enzyme digested with BamH I and Kpn I, and then detected in the gel imaging system; 6. The confirmed positive plasmid is transformed into Agrobacterium GV3101 by freeze-thaw method, and a positive test is performed.

[0030] The results of double restriction digestion of the AaBBX21 gene plant overexpression vector plasmid are as follows Figure 5 , indicating that the expression vector was successfully constructed.

[0031] Example 4 Acquisition of AaBBX21 transgenic plants and identification of AaBBX21 gene function The AaBBX21 gene was transferred into wild-type (Col) Arabidopsis by inflorescence infection method, positive plants were identified and purified to T2 generation, and then phenotypic analysis was performed on T3 seedlings. The specific method was as follows: 1. Wild-type (WT) Arabidopsis was sown in a special culture box for Arabidopsis, and seedlings were transplanted after 14 days. When the seedlings were about 15 cm in length, the inflorescence of Arabidopsis was infected with Agrobacterium GV3101 carrying the AaBBX21 gene overexpression vector by inflorescence infection method. The infection was repeated one week after the first infection. One week after the second infection, the newly grown inflorescence was cut off and harvested; 2. Positive plants were selected using MS medium containing 50 mg / L kanamycin, and transplanted into soil after 2 weeks. Leaves of 5-week-old seedlings were taken, DNA was extracted, and primers AaBBX21F (AGAGAGATGAAGATTCAGTGC) and 2300SR (GGAGAAACTCGAG CTTGC) for positive plant detection; 3. Collect seeds of AaBBX21 positive individual plants and continue sowing and screening until the seeds of T2 generation AaBBX21 transgenic plants are harvested; 4. T3 generation 6-day-old seedlings and 20 cm-tipped Arabidopsis plants are treated with strong light (10,000 lux) for 3 consecutive days, and then their phenotypes are observed using a stereomicroscope, and the samples are weighed to determine the anthocyanin content and perform fluorescence quantitative PCR analysis.

[0032] The method of anthocyanin content determination and fluorescence quantitative PCR analysis is as follows: 1. First, take out the centrifuge tube containing Arabidopsis seedlings (in a -80℃ refrigerator), place it in liquid nitrogen, and after freezing, transfer it to a grinder and grind it at a frequency of 45 Hz and 40 s. Add 1 mL of anthocyanin extract. After completion, place it in a 4℃ refrigerator for 16 h. Note that it should be protected from light during this period and the centrifuge tube should be turned over three times. Finally, all the mixtures are transferred to a new centrifuge tube at a speed of 12,000 rpm, a temperature of 4℃, and a time of 5 min. Then, transfer it to a 96-well ELISA plate. Note that three sets of repeated experiments should be performed for each plant type to measure its absorbance at 530 nm and 657 nm. Using the formula Q Anthocyanins =(A530-0.25×A657)×M -1 1. The anthocyanin content was calculated by quantifying the weight of the plant material (M: the weight of the plant material); 2. The RNA of the AaBBX21 T3 transgenic seedlings after light treatment was extracted using a kit, and the concentration of the RNA sample was determined and recorded using an ultra-micro spectrophotometer. The RNA was then reverse transcribed into cDNA using a reverse transcription kit, and the expression levels of anthocyanin synthesis-related genes in the AaBBX21 transgenic Arabidopsis were analyzed using fluorescent quantitative PCR and a fluorescent quantitative special Mix.

[0033] The phenotypes of wild-type and AaBBX21 transgenic Arabidopsis seedlings are shown in the figure. Figure 6The back of the L1 and L2 leaves of the AaBBX21 transgenic line is obviously redder than that of the WT. The phenotype of the inflorescence axis of the wild type and AaBBX21 transgenic Arabidopsis is shown in Figure 7 The color of the L1 and L2 inflorescence axes of the AaBBX21 transgenic lines is significantly redder than that of the WT. The fruit phenotypes of the wild type and AaBBX21 transgenic Arabidopsis are shown in Figure 8 The color of L1 and L2 pods of AaBBX21 transgenic lines is obviously redder than that of WT. Fig. 9 The anthocyanin content in the leaves, inflorescences and fruit pods of the L1 and L2 seedlings of the AaBBX21 transgenic lines was significantly higher than that of the WT. In summary, AaBBX21 significantly increased the accumulation level of anthocyanins in Arabidopsis. The expression analysis of anthocyanin synthesis-related genes in wild-type and AaBBX21 transgenic Arabidopsis is shown in Figure 2. Fig.10 , the structural genes related to anthocyanin synthesis were mostly up-regulated in transgenic Arabidopsis (e.g. Fig.10 For example, the expression level of AtCHS in transgenic Arabidopsis was at least 6.3 times higher than that of the wild type, the expression level of AtCHI was at least 17.8 times higher, the expression level of AtF3'H was at least 12.5 times higher, the expression level of AtDFR was at least 16.5 times higher, and the expression level of AtANS was at least 4.6 times higher. Only AtF3H had no significant difference. In summary, AaBBX21 significantly upregulated the expression levels of anthocyanin synthesis-related genes in Arabidopsis, thereby increasing the accumulation level of anthocyanins in Arabidopsis.

[0034] In some embodiments, the plant described in the present invention is any plant species, including monocots and dicots, and is particularly suitable for plants that have a genetic transformation system.

Claims

1. A protein AaBBX21, characterized in that: The protein AaBBX21 gene coding sequence is shown in SEQ ID No.

1.

2. An application of a gene encoding protein AaBBX21, characterized in that: The AaBBX21 coding gene is overexpressed in plants through genetic engineering to increase the anthocyanin content, ornamental value and edible value of plants.

3. The use of a gene encoding protein AaBBX21 as claimed in claim 1, characterized in that: The application method of the protein AaBBX21 coding gene is to connect the coding sequence of the AaBBX21 gene with a plant overexpression vector by using homologous recombination technology, and then transfer the recombinant plasmid into Agrobacterium.

4. The use of a gene encoding protein AaBBX21 as claimed in claim 1, characterized in that: The overexpression vector is pCAMBIA2300S.

5. The use of a gene encoding protein AaBBX21 as claimed in claim 1, characterized in that: The Agrobacterium is GV3101.

Images