Candida glabrata and application

Abstract

The invention belongs to the field of biology, and discloses a Candida glabrata strain, the classification name of the Candida glabrata strain is Nakaseomyces glabrata YX2024, and the classification name of the Candida glabrata strain is Candida glabrata strain is Candida glabrata strain. The preservation unit of the candida glabrata is China Center for Type Culture Collection; the preservation time is December 23, 2024; the preservation number is CCTCC (China Center For Type Culture Collection) NO: M 20242881; the preservation address is Wuhan University, Wuhan, China. The enzyme activity of lipase produced by the strain is obviously higher than that of other strains screened in the same batch, and meanwhile, the strain has the characteristics of excellent acid resistance, gastric juice resistance and intestinal juice resistance. Meanwhile, the invention further discloses application of the candida glabrata.

Description

Technical Field

[0001] The invention belongs to the biological field, and particularly relates to a Candida glabrata strain and application. Background Art

[0002] With the implementation of relevant measures such as "antibiotic reduction and replacement" in animal husbandry, and people's pursuit of high-quality livestock products, the development of green feed additives has become an inevitable trend for healthy breeding. Yeast, as a kind of probiotics, plays an important role in maintaining intestinal homeostasis, preventing and treating various gastrointestinal diseases, regulating host immune function, preventing the invasion of harmful pathogens, promoting growth and development of the body, and delaying aging.

[0003] At present, the research focuses on the application of microbial fermented feed, the comparison between yeast and antibiotics in chronic enteropathy, the influence of yeast on flora, etc. In order to screen out more nutritious and functional compound fermentation products, it is necessary to select suitable strains and optimize their culture conditions. Commonly used strains mainly include bacteria and fungi. The main fungal genus is yeast (Saccharomyces cerevisiae, Candida).

[0004] Candida glabrata is a species of Candida species and is rarely reported as a beneficial bacterium. It is widely reported to be pathogenic, such as vaginal infection.

[0005] As a national geographical indication of agricultural products, Ningxiang pigs have the characteristics of high reproduction rate, early maturity and easy fattening, loose meat, tolerance to rough feed and strong disease resistance. Their intestines contain rich beneficial microbial resources, which can bring high-quality strains to the breeding industry.

[0006] We found some Candida glabrata in the intestinal bacteria of Ningxiang pigs. These Candida glabrata exhibited relatively different and peculiar properties. Based on this, we filed this case. Summary of the invention

[0007] Based on this, the first object of the present invention is to provide a strain of Candida glabrata, the lipase activity produced by the strain is significantly higher than that of other strains screened from the same batch, and the strain has excellent acid resistance, gastric juice resistance and intestinal juice resistance.

[0008] At the same time, the invention also discloses the use based on the Candida glabrata.

[0009] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0010] A strain of Candida glabratus, the classification name of the Candida glabratus is: Nakaseomyces glabratusYX2024; the preservation unit of the Candida glabratus is China Center for Type Culture Collection; the preservation time is December 23, 2024; the preservation number is CCTCC NO: M 20242881; the preservation address is: Wuhan University, Wuhan, China.

[0011] The 16S RNA sequence of the bacterium (SEQ ID NO.1) is:

[0012] TAGCATTTATTGATTTGTCTGAGCTCGGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGTTCCTAAAATATTTTCTCTGCTGTGAATGCCATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCA AAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACT TTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAG TTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTGACCTCAAATCAGGTACGGG

[0013] The lipase produced by the Candida glabrata was tested and found to have an activity of 277.56±0.01U·mL -1 The survival rate in gastric juice was 87.97%±0.64, and the survival rate in intestinal juice was 87.97%±0.64; the survival rate could be maintained above 85% at pH 3;

[0014] Lipase is widely used in food, textile, chemical industry, breeding and other fields. For details, please refer to "Application and Research Progress of Microbial Lipase", written by Wang Xiaofeng et al., Biotechnology Bulletin, Issue 4, 2008;

[0015] In the prior art, there is no report that can obtain enzyme activity exceeding 100 U·mL -1 For the related strains, please refer to "Screening of Lipase-producing Strains and Study on Enzymatic Characteristics", written by Hu Chaoyang et al., Guangxi Agricultural Biological Sciences, September 2006, Vol. 25, No. 3, which screened 58 strains of lipase-producing bacteria, and the lipase-producing live bacteria produced by each strain were obviously inferior to the smooth Candida albicans screened by the present invention.

[0016] The Candida glabrata of the present invention not only produces lipase with high enzyme activity, but also can adapt to acidic environment and survive well in the gastrointestinal tract, which means that it can be used as a probiotic and can smoothly reach the intestine.

[0017] At the same time, the present invention also discloses the use of the Candida glabrata in preparing industrial bacteria for producing lipase, and the use of the Candida glabrata in preparing probiotics.

[0018] In the above-mentioned use, the probiotics are added to the feed in the form of feed additives.

[0019] Finally, the present invention also discloses an industrial bacterium for producing lipase, comprising the Candida glabrata as described above, as well as a Candida glabrata probiotic as described above and an animal feed containing the Candida glabrata as described above.

[0020] The beneficial effects of the present invention are:

[0021] The lipase produced by the Candida glabrata of the present invention has an enzyme activity significantly higher than that of other strains screened from the same batch, and the strain has the characteristics of excellent resistance to acid, gastric juice and intestinal juice. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is an electrophoretic image of the variable region sequences of multiple strains amplified by PCR;

[0023] Figure 2 is the hydrolysis circle diagram of the lipase-producing strain;

[0024] Figure 3 is the lipase standard curve;

[0025] Figure 4 The antibacterial results of some strains are shown in Figure 2.

[0026] Figure 5 This is the growth curve of strain 11#;

[0027] Figure 6 This is the growth curve of strain 11# at different temperatures;

[0028] Figure 7 This is the growth curve of strain 11# at different pH values. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only used to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0030] 1. Materials and Equipment

[0031] 1.1 Sample

[0032] Ningxiang pig small intestine contents

[0033] 1.2 Strains

[0034] Escherichia coli K88, Staphylococcus aureus and Salmonella were provided by Professor Yin Jie from the College of Animal Science and Technology, Hunan Agricultural University.

[0035] 1.3 Culture medium

[0036] Malt broth culture medium: malt extract powder 6.0g / L, glucose 6.0g / L, maltose 1.8g / L, yeast extract powder 1.2g / L, high pressure sterilization at 121℃ for 15 minutes.

[0037] Potato dextrose agar medium (PDA): potato powder 6.0 g / L, glucose 20.0 g / L, chloramphenicol 0.1 g / L, agar 20.0 g / L, autoclave at 121°C for 15 min.

[0038] Potato glucose water culture medium (PDW): potato extract powder 6.0g / L, glucose 20.0g / L, high pressure sterilization at 121℃ for 20min.

[0039] MH agar medium (MHA): beef extract powder 2.0 g / L, soluble starch 1.5 g / L, acid hydrolyzed casein 17.5 g / L, high pressure sterilization at 121°C for 15 minutes.

[0040] YPDA medium: yeast extract 10.0 g / L, peptone 20.0 g / L, glucose 20.0 g / L, adenine sulfate 0.03 g / L, autoclave at 116°C for 30 min.

[0041] YPD liquid culture medium: 20.0 g / L peptone, 20.0 g / L glucose, 10.0 g / L yeast extract powder, autoclave at 121°C for 15 min.

[0042] Basic culture medium: Add 1.0% skimmed milk powder to YPD medium and mix well. To prevent the milk powder from denaturing, the culture medium should be sterilized by high pressure at 121℃ for 20 minutes.

[0043] Protease fermentation medium: glucose 50 g / L, peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 0.4 g / L, pH 7.0, autoclave at 121 °C for 15 min.

[0044] Tween-20 medium: peptone 10 g / L, NaCl 5 g / L, CaCl2·H2O 0.1 g / L, Tween-20 10 g / L, agar 15 g / L, distilled water 1000 mL, pH 7.0-7.4, 1.6% neutral red solution 1 mL, autoclave at 121°C for 15 min.

[0045] Lipase fermentation medium: yeast extract powder 10 g / L, peptone 20 g / L, glucose 20 g / L, olive oil 1% (v / v), glucose and other ingredients were sterilized separately at 115°C for 30 min, then combined and sterilized at 121°C for 15 min.

[0046] 1.4 Main instruments and equipment

[0047] Instrument name, manufacturer; Constant temperature incubator, Harbin Donglian Electronic Technology Development Co., Ltd.; Clean bench, Shanghai Lishen Scientific Instrument Co., Ltd.; Desktop high-speed refrigerated centrifuge, Hunan Michael Experimental Instrument Co., Ltd.; High-pressure sterilizer, Shanghai Shen'an Medical Equipment Factory; INFINITE M PLEX multifunctional microplate reader, Tecan;

[0048] Combined shaking incubator, Harbin Donglian Electronic Technology Development Co., Ltd.; laboratory water purifier, Veolia Water Treatment Technology (Shanghai) Co., Ltd.

[0049] 2. Test methods

[0050] 2.1 Isolation of strains

[0051] Add the collected fresh Ningxiang pig intestinal contents to the malt broth medium and culture at 28℃ for 48h to enrich the yeast. After the culture, dilute the yeast enrichment solution and spread it on the YPD solid medium, culture it upside down at 28℃ for 2-3 days, and observe whether there are colonies growing. Use an inoculation loop to pick different single colonies and streak them on the YPD solid medium, repeat 2-3 times until a purified colony is obtained and store it at 4℃.

[0052] 2.2 Identification of yeast

[0053] (1) Morphological identification: observe the size, shape, degree of protrusion, surface characteristics, color and transparency of the colonies. Select typical colony samples and use the methylene blue staining method to stain them. Take 0.1% Lu's alkaline methylene blue staining solution and drip it to the center area of ​​the slide. Use a sterile inoculation loop to gently pick up a small amount of yeast and mix it evenly with the staining solution to ensure the uniformity and accuracy of the staining effect. After leaving it for about 3 minutes, observe the morphology, budding and arrangement of the yeast under a microscope. Pick strains that are clear and have typical morphology in the field of view and take pictures.

[0054] (2) Molecular biological identification: Colony PCR was performed according to the instructions of the Beyotime yeast colony PCR kit (alkaline lysis method), and ITS rDNA sequence universal primers (ITS1 5'-TCCG TAGG TGAA CCTG CGG-3' (SEQ ID NO. 2); ITS4 5'-TCCT CC CGC TTAT TGAT ATGC-3' (SEQ ID NO. 3)) were used for gene amplification.

[0055] Lysis of yeast colonies: prepare PCR reaction tubes, add 10μl Yeast Lysis Buffer to each tube, pick the yeast into the PCR tube and mix well, then add 10μl Neutralization Buffer and mix well.

[0056] Setting up the yeast colony PCR reaction system: melt the Yeast Colony PCR Mix at room temperature, pipette 1 μl of the prepared DNA template into 19 μl of the PCR reaction system, and start the PCR reaction.

[0057] The setting of PCR reaction parameters can refer to the following example steps: STEP1 (initial denaturation): 94℃3min; STEP2 (denaturation): 94℃30sec; STEP3 (annealing): 55℃30sec; STEP4 (extension): 72℃1min / kb; STEP5 (cycle): repeat STEP2 (denaturation) step for a total of 30 cycles; STEP6 (final extension): 72℃10min; STEP7 (temporary storage): permanent storage at 4℃.

[0058] Result detection: After the PCR reaction is completed, 5-10ul is directly taken for electrophoresis analysis and detection. Use 1% agarose gel electrophoresis for detection without adding loading buffer.

[0059] Yeast was isolated from pig feces using malt agar solid culture medium, and a single milky white colony was picked and streaked on YPD solid culture medium for purification. Based on the colony size and morphological characteristics, 20 suspected yeast strains were finally screened and purified.

[0060] Colony PCR was used to amplify the variable region sequence of yeast ITS rDNA based on the universal primers for yeast ITS1 5'-TCCG TAGG TGAA CCTG CGG-3'; ITS4 5'-TCCT CC CGC TTAT TGAT ATGC-3'. The results were visualized by 1% agarose gel electrophoresis. Figure 1 .

[0061] Figure 1 It is an electrophoretic image of the variable region sequences of multiple strains amplified by PCR;

[0062] Strains 01, 02, 03, 04, 06, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 were initially screened as yeasts.

[0063] (3) ITS sequencing: Genomic DNA was extracted using a fungal genomic DNA extraction kit, and PCR amplification was performed using universal primers (ITS1 5'-TCCG TAGG TGAA CCTG CGG-3'; ITS4 5'-TCCT CC CGC TTAT TGAT ATGC-3'). After amplification, gel electrophoresis was used for detection, and the results were sent to a sequencing company for sequencing. The sequencing results were compared with the sequences in the GenBank nucleic acid database using a tool to evaluate the homology between the ITS rDNA sequence and the corresponding sequences of known yeast.

[0064] Yeast genomic DNA was extracted according to the instructions of the fungal genomic DNA extraction kit, and the variable region sequence of yeast ITS rDNA was amplified according to the universal primers of yeast, and imaged by 1% agarose gel electrophoresis. The 8 isolated strains were amplified by ITS rDNA PCR, and the sequencing results are shown in the following table. Eight strains were isolated from pig manure, and the identification results are shown in Table 1.

[0065] Table 1 Identification results of strains

[0066]

[0067]

[0068] 2.3 Lipase production experiment

[0069] Initial screening of strains: Select strains that meet the requirements for purification, and inoculate the purified bacteria into Tween-20 medium for initial screening, and place them in a 28°C constant temperature incubator for 48h-72h. Observe the growth of the colonies and the changes in the culture medium, take photos of yeasts with obvious transparent hydrolysis circles, and record the ratio of the hydrolysis circle diameter (D) to the colony diameter (d) (D / d). Some lipase-producing strains have hydrolysis circles (visible Figure 2 ), and screen the strains with larger hydrolysis circles for rescreening.

[0070] Figure 2 is the hydrolysis circle diagram of the lipase-producing strain;

[0071] Strain rescreening: Inoculate the strain obtained in the initial screening into the lipase fermentation medium according to the culture temperature of the initial screening, culture in a constant temperature incubator at 28°C for 72h, take 2ml of the fermentation liquid, centrifuge at 10000r / min for 10min, and use the obtained supernatant as the crude enzyme liquid. For the lipase activity determination, p-nitrophenol palmitate (p-NPP) was selected as the substrate, and appropriate adjustments were made according to the method of UK Winkler et al. First, add 600μL of the substrate solution to the sample in a 1.5mL centrifuge tube, and add 25μL of the appropriately diluted crude enzyme liquid. Add 25μL of pH 7.0 Tris-HCl buffer to the control group, keep it at 40°C for 15 minutes, and then add 500μL of 95% ethanol solution to terminate the reaction. After centrifugation at 10,000 r / min for 3 min, the absorbance was measured at 410 nm. The amount of enzyme required to catalyze the hydrolysis of the substrate p-nitrophenol palmitate (pNPP) to produce 1 μmol p-nitrophenol (pNP) within 1 min was defined as 1 enzyme activity unit (U).

[0072] Drawing of the standard curve: Prepare 20mmol / L of 2.0mmol / L isopropanol solution. First, dissolve 0.1391g pNP (i.e., 10mg / mL) in 50mL isopropanol. Then, take out 10mL from the mother solution to accurately dilute to 100mL, that is, obtain 2.0mmol / L working solution. The amount of each reagent added is in accordance with Table 2 to ensure that the reaction volume and conditions are consistent with the sample enzyme activity measured in the experiment.

[0073] Standard curve visible Figure 3 ;

[0074] Figure 3 is the lipase standard curve;

[0075] Table 2 Determination of p-nitrophenol (pNP) standard curve

[0076]

[0077]

[0078] Distilled water was used as the blank control of the experiment, and the absorbance was measured at a wavelength of 410 nm. A p-nitrophenol standard curve was drawn based on the measured data, and the correlation formula Y=aX+b (Y: pNP concentration, X: absorbance value, a, b: reaction coefficient) for absorbance value and pNP content was calculated. The results of the D / d ratio and enzyme activity determination of the lipase-producing strain are shown in Table 3.

[0079] Table 3 Ratio D / d and enzyme activity of lipase-producing strains

[0080]

[0081] As shown in Table 3, the enzyme activity of strain No. 11 (i.e., Candida glabrata of the present invention) is the strongest, far exceeding that of other strains.

[0082] 2.4 Functional assay of strains

[0083] (1) Antibacterial experiment of strains: The Oxford cup method was used to evaluate the inhibitory ability of the strains against Escherichia coli (three replicates were set). MHA culture medium was prepared. The thickness of the culture medium in each culture dish was about 4 mm. 1.0×10 8 Spread evenly on MHA culture medium, place in a sterilized Oxford cup, add 200 μL of bacterial solution to each well, place in a 37°C incubator for 16-24 hours, and observe whether an inhibition zone appears.

[0084] The antibacterial experiment was carried out on the above-screened strains. Figure 4 It can be seen that strains 02#, 03#, 04#, 05#, 11#, 15#, 17# and 20# have no inhibitory effect on Escherichia coli.

[0085] (2) Determination of growth curve

[0086] Pick up an activated single colony (strain 11#) and inoculate it into YPD liquid medium. Cultivate it at 35℃, 180r / min with shaking for 1 day. Add 2% (V / V) inoculum into YPD liquid medium. Cultivate it at 30℃, 180r / min with shaking. Take samples every 2h. Use distilled water as blank control. Measure OD 560 , 3 parallel experiments were performed in each group. With time as the horizontal axis, OD 560 The growth curve of the target strain is plotted on the ordinate.

[0087] The strain growth curve can be seen Figure 5The bacteria has a lag phase of about 5 hours, during which the cell number does not change significantly; after 5 hours, it enters the logarithmic phase, the cells begin to grow rapidly, and the cell number increases exponentially; after 14 hours, the cells enter the stable phase, during which the cell number does not change much; after 24 hours, the cells begin to enter the decay phase, and the cell number begins to decrease.

[0088] (3) Temperature tolerance of strains: The activated strain (strain #11) was inoculated into a centrifuge tube containing 1 mL YPD liquid culture medium at a 2% (V / V) inoculation rate to form three groups of bacterial liquid samples. Each group of bacterial liquid was placed in a constant temperature water bath at 30°C (as a control), 60°C, and 80°C for 10 minutes of heat treatment. The bacterial liquid was taken out and cultured in a 30°C incubator for 24 hours. The absorbance of the strain was then measured at a wavelength of 600 nm to calculate the survival rate of the strain at different temperatures.

[0089] refer to Figure 6 When the temperature is lower than 35℃, the growth rate of the bacteria increases with the increase of temperature; when the temperature reaches 35℃, its growth value reaches the maximum; after the temperature continues to rise, the growth shows a downward trend.

[0090] (4) Acid resistance of the strain: The activated strain (strain #11) was inoculated at a 2% (V / V) in YPD liquid medium with pH values ​​of 2.0, 3.0, 4.0, 5.0 and 6.5, respectively, and cultured at 28°C for 24 hours. The absorbance was measured at a wavelength of 600 nm. The pH value of 6.5 was used as the control, and the survival rate was recorded.

[0091] The results of survival rate can be found in Figure 7 When the pH value is 3-5, the survival rate of the bacteria is above 85%, and it has good acid tolerance.

[0092] (6) Simulated gastric and intestinal fluid experiments: Artificial gastric and intestinal fluids were prepared with reference to the Pharmacopoeia of the People's Republic of China (2020 edition). The activated strains (02#, 03#, 04#, 05#, 11#, 15#, 17# and 20# strains) were inoculated into intestinal fluid, gastric fluid and normal saline at a ratio of 2% (V / V). After incubation at 28°C for 4 hours, the absorbance of the bacterial fluid was measured at 600nm. The measurement was repeated 4 times for each strain. The survival rate of the strains in gastric and intestinal fluids was calculated using the absorbance of the normal saline group as a control.

[0093] The results of survival rate can be found in Table 4;

[0094] Table 5 Survival rate of gastric juice and intestinal juice resistance

[0095] Strain No. | Survival rate Gastric juice Intestinal fluid 02 43.48％±0.28g 122.155±0.27g 03 83.95％±0.95f 67.715±1.87f 04 79.00％±0.67e 133.46％±1.45f 05 91.69％±0.68e 92.84％±2.10e 11 87.97％±0.64d 128.21％±1.24d 15 74.68％±1.24c 87.38％±1.25c 17 73.08％±0.24b 105.43％±1.23b 20 65.06％±0.30a 87.70％±0.79a

[0096] As shown in Table 4, the survival rates of the eight strains were high in the artificial gastric juice and artificial intestinal juice environments. 03, 04, 05, 11, 15 and 17 had a high survival rate in the simulated artificial gastric juice OD 600 The values ​​were 84.62%, 79.67%, 91.69%, 88.60%, 75.92% and 72.84% respectively. In the simulated artificial intestinal fluid environment, except for strain 03, the survival rates of all strains were relatively high, and the differences among the strains in gastric juice and intestinal fluid were significant.

[0097] Summarize:

[0098] The following conclusions can be drawn from the above experiments:

[0099] 1. The Candida glabrata (bacteria #11) of the present invention has the ability to produce lipase, and the lipase produced by it has extremely high enzyme activity characteristics, which means that the Candida glabrata of the present invention can be used as an industrial bacterium for producing lipase;

[0100] Lipases with high enzyme activity are of great significance in industrial production. Lipases are one of the important industrial enzyme preparations. They can catalyze reactions such as lipolysis, transesterification, and ester synthesis, and are widely used in oil processing, food, medicine, daily chemicals, and other industries. Lipases from different sources have different catalytic characteristics and catalytic activities. Among them, the large-scale production of lipases with transesterification or esterification functions for organic phase synthesis is of great significance for the enzyme-catalyzed synthesis of fine chemicals and chiral compounds.

[0101] 2. The Candida glabrata (bacteria #11) of the present invention is isolated from the intestines of healthy Ningxiang pigs. It has very excellent acid resistance and gastrointestinal fluid resistance. When it is used as an oral probiotic, it can reach the intestines of animals with a high survival ability and has the potential to be used as a probiotic.

[0102] The embodiments presented herein are only embodiments selected according to the combination of all possible embodiments. The appended claims should not be limited by the embodiments describing the present invention. Some numerical ranges used in the claims include sub-ranges therein, and the changes in these ranges should also be covered by the appended claims.

Claims

1. A strain of Candida glabrata, characterized in that The classification name of the Candida glabratus is: Nakaseomyces glabratus YX2024; the preservation unit of the Candida glabratus is the China Center for Type Culture Collection; the preservation time is December 23, 2024; the preservation number is CCTCC NO: M 20242881; the preservation address is: Wuhan University, Wuhan, China.

2. Use of the Candida glabrata as claimed in claim 1 to prepare industrial bacteria for producing lipase.

3. Use of the Candida glabrata as claimed in claim 1 in preparing probiotics.

4. The use according to claim 3, characterized in that The probiotics are added to feed in the form of feed additives.

5. An industrial bacterium producing lipase, characterized in that: Contains the Candida glabrata as claimed in claim 1.

6. A probiotic, characterized in that: Contains the Candida glabrata as claimed in claim 1.

7. An animal feed, characterized in that: Contains the Candida glabrata as claimed in claim 1.

Images