Saccharomyces cerevisiae with high ester yield and application of saccharomyces cerevisiae in rice wine

Abstract

The invention discloses ester-producing yeast, which is classified and named as Saccharomyces cerevisiae SAU-NN1, and is preserved in China General Microbiological Culture Collection Center (CGMCC), the address is No.3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC No.32819, and the preservation time is November 27, 2024. The invention also discloses a screening method of the saccharomycetes, a strain fermentation characteristic and an aroma-producing characteristic in rice wine application. The saccharomyces cerevisiae obtained by the invention has huge application potential in rice wine.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and specifically relates to the screening of a strain of brewer's yeast and the fermentation characteristics of the strain, and the research on the aroma production characteristics of the strain in bean sprout juice culture medium and fermented rice wine. Background Art

[0002] Rice wine is an alcoholic beverage produced from rice through the fermentation of microorganisms. The quality characteristics of rice wine are closely related to the brewing microorganisms, raw materials and fermentation processes. The flavor substances of rice wine include esters, organic acids, esters and a small amount of aldehydes and ketones. These compounds have different aromas and coordinate with each other or react chemically, which together constitute the flavor diversity of rice wine. Esters are the most abundant compounds in rice wine. They usually have floral, fruity and milky characteristics and are the main factor that gives rice wine a rich aroma. The volatile ester components in rice wine are mainly ethyl ester compounds, the precursors of which are ethanol and higher alcohols produced by yeast metabolism.

[0003] The selection of excellent brewing microorganisms has an important influence on the quality characteristics of rice wine, such as the aroma, sensory taste, and antioxidant properties, and is also one of the hot topics in the field of rice wine research. During the fermentation process of rice wine, the growth and metabolism of yeast mainly plays a key role in the wine-making stage. The primary metabolites necessary for its growth are ethanol, acetaldehyde, and acetic acid, while the secondary metabolism mainly produces higher alcohols, esters, thiols, and terpene compounds. Saccharomyces cerevisiae is one of the dominant fungal genera in rice wine, and Saccharomyces cerevisiae is the main yeast that can be isolated through traditional microbial culture techniques. Saccharomyces cerevisiae is a wine-making yeast with a strong ethanol production ability. During the fermentation process of rice wine, ethanol is produced through the glycolysis pathway and the acetaldehyde pathway, and higher alcohols are produced through the amino acid metabolism pathway. Saccharomyces cerevisiae ( Saccharomyces cerevisiae )SAU-NN1, has good alcohol and ester production capabilities. The yeast can produce more ester aroma substances during its growth process, which can complicate the aroma during the brewing process of rice wine and has the ability to improve product quality. Tu Tingyao et al. measured the volatile substances in fermented rice wine in four production areas, namely Hubei, Jiangxi, Jiangsu and Guizhou. Among them, most products had the most alcohol substances, while the relative content of ester substances was about 20%. Wu Jiamin et al. mixed Wickham yeast with Xiaoqu to ferment rice wine, and a total of 13 ester substances were detected, with a relative content of 33.75%. The present invention uses brewer's yeast ( Saccharomyces cerevisiae ) SAU-NN1 was used to make koji, which was then applied to rice wine fermentation. After volatile substance detection, 15 ester substances were found in the rice wine, with a relative content of up to 38.09%, which had a strong rice wine aroma. Summary of the invention

[0004] The present invention aims to screen and provide a kind of brewer's yeast ( Saccharomyces cerevisiae )SAU-NN1, and used the yeast to make koji-fermented rice wine, providing microbial resources for enhancing the flavor of rice wine brewing.

[0005] The strain provided by the present invention is Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) SAU-NN1, which is deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 32819 and the deposit date is November 27, 2024.

[0006] The brewer's yeast SAU-NN1 is separated from the koji, and is screened, screened, purified, and identified to have good ester production ability. The storage conditions are as follows: a single colony is picked from a well-growing plate and transferred to a YPD medium, cultured at 28°C for 48 hours, 600 μL of the culture solution is transferred to a storage tube containing 600 μL of 60% glycerol, and stored in a -20°C refrigerator.

[0007] The YPD medium formula is 10g yeast extract, 20g peptone, 20g glucose, 1000mL distilled water, natural pH, and if a solid medium is required, 2% agar is added.

[0008] The bean sprout juice culture medium formula is 10g soybean sprouts, 5g glucose, 100mL distilled water, natural pH, and if a solid culture medium is required, 2% agar is added.

[0009] The culture characteristics of the brewer's yeast SAU-NN1 are: cultured in YPD solid medium at 28°C for 48 hours, the colony morphology is round, with regular edges, smooth and moist surface, soft and sticky texture, easy to pick up, opaque, shiny, and white in color. The brewer's yeast SAU-NN1 requires facultative anaerobicity, and the bacteria are oval under an oil immersion lens (100×10), with unilateral budding. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 (a) is the cell morphology of SAU-NN1 under a 100×10 microscope, and (b) is the single colony morphology of SAU-NN1.

[0011] Figure 2 This is a graph showing the growth of SAU-NN1 strain at different temperatures.

[0012] Figure 3 This is a graph showing the growth of SAU-NN1 strain at different pH levels.

[0013] Figure 4 This is a graph showing the growth of SAU-NN1 strain under different alcohol concentrations.

[0014] Figure 5 This is a graph showing the growth of SAU-NN1 strain under different sugar contents. DETAILED DESCRIPTION

[0015] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are commercially available unless otherwise specified.

[0016] In the following examples, the percentages are by mass unless otherwise specified.

[0017] The following examples further illustrate the specific implementation of the present invention, but are not limited to these examples.

[0018] Case study 1: Screening and identification of ester-producing yeast

[0019] (1) Isolation and purification of yeast from koji: Powder the koji sample, weigh 5.0 g of koji powder and add it to 45 ml of physiological saline, add a small amount of sterile glass beads, shake and incubate at 200 r / min for 30 min to break up the bacteria. Take the supernatant and dilute it in a gradient manner and apply it to the yeast isolation medium (10 -2 ~10 -6 ), cultured in a constant temperature incubator at 28±1℃ for 48 h, picked single colonies according to the morphological characteristics of the colonies and repeatedly streaked them on YPD plates until a pure strain without contamination by foreign bacteria was obtained, and the purified yeast was transferred to YPD slant culture medium and stored at 4℃ for later use.

[0020] (2) Initial screening of ester-producing yeast: The isolated yeast was inoculated into YPD liquid culture medium and cultured in a constant temperature incubator at 28±1℃ for 48 h. The yeast was screened by olfactory smell. The result of the initial olfactory screening was +++, which was described as a strong aroma.

[0021] (3) Determination of total esters of ester-producing yeast: The yeast obtained in the initial screening was used to ferment bean sprout juice culture medium. After 3 days of cultivation, the total ester content of the fermentation liquid was determined by the saponification reflux method. Among them, SAU-NN1 had the best ester production effect, and its total ester was 3.87 g / L.

[0022] (4) Identification of strain SAU-NN1.

[0023] Morphological identification: After activating with YPD liquid medium for 24 hours, use a sterile inoculation loop to pick a loop of bacterial liquid and streak it on the YPD plate. After culturing at 28±1℃ for 48 hours, record the characteristics of the colony according to size, color, texture, edge shape, etc.; wash the colony with sterile saline and observe the single cell morphology under a 100x microscope. The colony and cell morphology of strain SAU-NN1 are as follows Figure 1 shown.

[0024] Molecular identification: Extraction of SAU-NN1 genome: strain SAU-NN1 was inoculated into YPD liquid medium and cultured on a shaker at 28±1℃ and 200 r / min for 48 h. The total genome of SAU-NN1 was extracted according to the instructions of the genome kit. 5 μl of PCR product was separated by 1.2% (1×TAE) agarose gel electrophoresis, detected and imaged by UV gel imaging system, and PCR amplification products were sent to Sangon Biotech Co., Ltd. for sequencing.

[0025] The strain SAU-NN1 was sequenced and the following ITS sequence was obtained: CGGGCGGCATATAACCATTATGCCAGCATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCTGGCAGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTACATTCCTATGGATTTATCCTGCCACCAAAACTGATGCTGGC CCAGTGAAATGCGAGATTCCCCTACCCACAAGGAGCAGAGGGCACAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGT TCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTCGAAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGGATTCTCACCCTCTATGACGT CCTGTTCCAAGGAACATAGACAAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCC

[0026] The sequence was imported into NCBI for BLAST homology comparison, and combined with morphological characteristics, the strain SAU-NN1 was identified as Saccharomyces cerevisiae ( Saccharomyces cerevisiae ). It was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No.32819 and the deposit date is November 27, 2024.

[0027] Case study 2: Fermentation performance determination of strain SAU-NN1

[0028] (1) Temperature tolerance test: The purified Saccharomyces cerevisiae SAU-NN1 strain was activated and inoculated into YPD liquid medium at a 2% inoculum (v / v). After culturing at 24°C, 28°C, 32°C, 36°C, and 40°C for 24 h, the uninoculated YPD liquid medium was used as the blank zero parameter to measure the OD 600nm , draw the yeast growth tolerance curve. Figure 2 As shown, the OD value of Saccharomyces cerevisiae SAU-NN1 strain is the largest at 28°C, indicating that the strain grows best at 28°C.

[0029] (2) pH tolerance test: The activated SAU-NN1 strain seed solution was inoculated at a 2% inoculum (v / v) into YPD liquid medium at pH 3.0, 3.5, 4.0, 4.5, and 5.0, respectively. The OD was measured after culturing at 28±1℃ for 24 h. 600nm , draw the pH growth tolerance curve of yeast. Figure 3 As shown, when the pH was 4.5, the OD value was the largest and the growth amount was the highest.

[0030] (3) Alcohol tolerance test: The activated SAU-NN1 strain seed liquid was inoculated at a 2% inoculum (v / v) into YPD liquid medium with alcohol content of 3%, 6%, 9%, 12%, 13%, 14%, and 15% (v / v), and the OD was measured after culturing at 28±1℃ for 24 h. 600nm , draw the alcohol tolerance curve of yeast. Figure 4 As shown, as the alcohol concentration increases, the OD value decreases and the growth rate decreases. When the alcohol content is 6-9%, the decrease suddenly increases, indicating that the cell growth is greatly inhibited at an alcohol content of 9%, but it can still maintain a good growth rate at an alcohol content of 15%, indicating that the yeast has good alcohol tolerance.

[0031] (4) Sugar tolerance test: The activated SAU-NN1 strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with glucose content of 16%, 20%, 24%, 28%, and 32%, respectively. The OD was measured after culturing at 28±1℃ for 24h. 600nm , draw the sugar tolerance curve of yeast. Figure 5 As shown, when the sugar content is less than 20%, the cell growth rate increases with the increase of sugar content, but when it is greater than 20g / L, the cell growth rate decreases with the increase of sugar content, indicating that high sugar content will inhibit the growth of strains.

[0032] Case study 3: Determination of volatile substances in fermented bean sprout juice medium inoculated with strain SAU-NN1

[0033] The activated SAU-NN1 seed solution was inoculated into bean sprout juice medium at 2% (v / v), and the volatile substances were determined after culturing at 30±1℃ for 3 days.

[0034] Determination method of volatile substances:

[0035] Headspace solid phase micro extraction (SPME) conditions: 4 mL of sample, 1.0 g of sodium chloride, 10 μL of 2-octanol (0.1 mg / mL) were added to the headspace bottle, equilibrated for 30 min, and headspace adsorption at 45 °C for 30 min.

[0036] Gas chromatography conditions: Agilent VF-Waxms column (60m×0.25mm, 0.5μm), helium (He) flow rate 1m L / min; temperature program: splitless injection; initial temperature 40℃, hold for 3 min, increase to 60℃ at 2℃ / min, hold for 1 min, then increase to 120℃ at 4℃ / min, hold for 1 min, then increase to 240℃ at 6℃ / min, hold for 3 min; injection port temperature 260℃, detector temperature 260℃.

[0037] Mass spectrometry conditions: electron ionization (EI) source, interface temperature 250°C, ion source temperature 200°C, electron energy 70 eV, mass spectrometry scanning range 40.00~800.00 m / z.

[0038] The results of the determination of volatile substances are as follows: they mainly include esters and alcohols. There are 13 ester substances, among which ethyl acetate has the highest content; there are also isoamyl acetate, ethyl octanoate, and a small amount of phenylethyl acetate, ethyl hexanoate, ethyl caprylate and other esters. Esters have strong floral and fruity aromas and can enrich the aroma of rice wine. Five alcohol substances include heptanol, octanol, β-citronellol, etc., which can provide floral aromas. There are also a small amount of acids, aldehydes and other substances.

[0039] Case study 4: Determination of volatile substances in fermented rice wine inoculated with strain SAU-NN1

[0040] Preparation of koji: Take 500 g glutinous rice flour, 60 g Polygonum hydropiper, 20 g Poria cocos, and 20 g Licorice. Put Polygonum hydropiper, Poria cocos, and Licorice into a wall-breaking machine and grind them into powder. After passing through an 80-mesh sieve, mix them evenly with the glutinous rice flour. Add 500 g of clean water in small batches, take an appropriate amount of SAU-NN1 bacterial suspension and mix with commercial koji, knead it into a koji ball with a diameter of about 2 cm, cover it with plastic wrap, ferment it in an incubator at 30°C for three days, and finally dry the koji at 45°C and store it in a vacuum bag at 4°C.

[0041] Inoculation fermentation: 1000 kg of glutinous rice was soaked overnight for 12 hours, and then placed in boiling water and steamed at normal pressure for 30 minutes. After steaming, the rice was broken up, the temperature was controlled to 60°C, 0.16% amylase was added, liquefied for 45 minutes, cooled to room temperature, 2% saccharifying enzyme was added, and saccharification was performed at 60°C for 6.0 hours. The control group added commercial koji at a 0.6% inoculation rate, and the experimental group added koji containing SAU-NN1 brewer's yeast at a 0.6% inoculation rate, and fermented at 30±1°C for 3 days. After fermentation, it was placed in a boiling water bath for 10 minutes to stop fermentation.

[0042] Determination of volatile substances: After the fermentation is completed, the samples are taken to determine the volatile substances in the rice wine according to the volatile substance determination method in Implementation Case 3.

[0043] The results of volatile substance determination are as follows: 45 volatile substances were detected in rice wine fermented with SAU-NN1 strain koji (experimental group), while 36 volatile substances were detected in rice wine fermented with commercial koji (control group). Among the many identified compounds, esters, alcohols, aldehydes, ketones, acids and other five categories were mainly involved. As shown in Table 1, 15 ester substances were detected in the experiment, and the relative content of ester substances in the experimental group was higher, among which phenylethyl acetate had the highest content, accounting for 14.46% of the total, showing rose and honey aroma, followed by ethyl caprylate, ethyl caprylate, ethyl acetate, ethyl laurate, isopentyl acetate, etc., which mainly provide floral and tropical fruit aroma. There are 5 alcohol substances, and the types and contents of alcohol substances in the experimental group are higher than those in the control group. Among them, higher alcohols such as isopentanol and 5-nonanol provide floral and ester wax aromas, which can increase the coordination and fullness of the wine. There are 4 kinds of aldehydes and ketones, including n-nosanal, phenylacetaldehyde, nonanal, and sec-octanone, which are unique to the experimental group and provide cream and mushroom aroma. One kind of phenolic substance provides woody and baking aroma. There are 5 kinds of acidic substances. Acidic substances show irritating sour taste. Too much will bring unpleasant odor. The relative content of acidic substances in the control group is 12.03%, and the relative content of acidic substances in the experimental group is 1.47%, which is lower. The above research results show that the volatile flavor components produced by fermenting rice wine in the experimental group and the control group are quite different. The esters, alcohols and aldehydes and ketones in the experimental group are higher and the acidic substances are lower, indicating that the rice wine fermented with SAU-NN-5 koji contains richer aroma substances than the rice wine fermented with commercial koji, and has the ability to enhance and improve the aroma of rice wine.

[0044] Table 1 Relative content of volatile substances

Claims

1. A strain of Saccharomyces cerevisiae ( Saccharomyces cerevisiae )SAU-NN1, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 32819 and the deposit date is November 27, 2024. Saccharomyces cerevisiae (Saccharomyces cerevisiae )SAU-NN1 is characterized by: The colony morphology is round, with regular edges, smooth and moist surface, easy to pick up, opaque, shiny, and white. The bacterial agent is characterized by containing brewer's yeast ( Saccharomyces cerevisiae ) SAU-NN1 or from Saccharomyces cerevisiae ( Saccharomyces cerevisiae )SAU-NN1 was prepared.

2. The bacterial agent is a freeze-dried bacterial agent; the preparation method of the freeze-dried bacterial agent includes: The brewer's yeast according to claim 1 ( Saccharomyces cerevisiae ) SAU-NN1 was cultured to obtain bacterial cells, which were freeze-dried.

3. A method for making distiller's yeast, comprising adding the saccharomyces cerevisiae yeast as claimed in claim 1 ( Saccharomyces cerevisiae ) The koji made with SAU-NN1.

4. A method for making rice wine, comprising using the brewer's yeast as claimed in claim 1 ( Saccharomyces cerevisiae The distiller's yeast prepared by SAU-NN1 was inoculated with glutinous rice to obtain rice wine with rich aroma and harmonious body.

Images