Construction method and application of pichia pastoris strain capable of efficiently secreting and expressing recombinant human protein

Abstract

The invention provides a construction method and application of a pichia pastoris strain capable of efficiently secreting and expressing recombinant human-derived protein, and relates to the technical field of synthetic biology. According to the invention, pichia pastoris is used as a chassis strain, a ku70 gene and / or a pep4 gene in a pichia pastoris genome are / is knocked out through a gene editing technology, and a new signal peptide O factor signal is introduced, so that the secretion efficiency of the pichia pastoris for secreting and expressing recombinant human-derived protein can be remarkably improved, the problem of protein degradation is effectively improved, and the recombinant human-derived protein can be obtained. And meanwhile, a high-copy pichia pastoris strain is efficiently obtained, so that the expression quantity of recombinant human protein is improved, and powerful support is provided for research and development of related drugs and biological manufacturing.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology, and in particular to a method for constructing a Pichia pastoris strain capable of efficiently secreting and expressing a recombinant human protein and an application thereof. Background Art

[0002] There are four common protein expression systems: (1) Escherichia coli expression system (2) yeast expression system (3) insect cell baculovirus expression system (4) mammalian cell expression system. The yeast expression system has the greatest commercial value. The most commonly used chassis cells are Saccharomyces cerevisiae and Pichia pastoris. They both have the ability to post-translationally modify foreign proteins that prokaryotes lack, such as glycosylation and protein phosphorylation. Pichia pastoris overcomes the defects of Saccharomyces cerevisiae such as low secretion efficiency, unstable expression, and low conversion rate. However, due to its late development, there is little research on various regulatory elements of Pichia pastoris, which still needs to be further explored. In addition, the repair mechanism of DNA double-strand breaks in Pichia pastoris is different from that in Saccharomyces cerevisiae. The proportion of NHEJ mechanism is higher than that of HR mechanism, resulting in the efficiency of constructing high-copy integration strains of Pichia pastoris or gene editing being much lower than that of Saccharomyces cerevisiae. The above factors have greatly increased the difficulty of strain transformation and development of Pichia pastoris, limiting the rapid development of Pichia pastoris expression systems.

[0003] Human protein has always been a hot field of recombinant protein. It has the advantages of weak antigenicity and good absorption. It is an important material in the fields of wound dressings, medical devices or cosmetics. However, due to technical limitations, recombinant human proteins currently generally have problems such as low yield, low secretion efficiency or severe protein degradation. Taking human type III collagen as an example, due to the presence of multiple protease recognition sites in its sequence, there are serious degradation problems during the fermentation process. To this end, some researchers have eliminated protease recognition sites through sequence optimization to alleviate the degree of protein degradation, such as patents 201110327865.5 and 201810049618.5; some researchers have competitively reduced the degradation of recombinant proteins by adding excipients during the fermentation process, such as patents 202111190388.2 and 201810049618.5. However, the above processes either change the amino acids, do not meet the latest national industry standards for "Recombinant Humanized Collagen", limit their application and value, or make the process more complicated and increase production costs. Targeted optimization is required based on the properties of the protein, which is not universal and does not fundamentally solve the problem.

[0004] How to optimize the chassis strain, construct a chassis strain with high yield, high secretion efficiency and reduced protein degradation, and solve the above problems from the root, is a difficult problem that needs to be solved urgently in Pichia pastoris to express recombinant human proteins. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a method for constructing a Pichia pastoris strain that efficiently secretes and expresses recombinant human proteins and its application, optimize the Pichia pastoris strain through gene editing technology, and improve the efficiency and quality of Pichia pastoris in expressing recombinant human proteins.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a method for constructing a Pichia pastoris strain that efficiently secretes and expresses a recombinant human protein, the method comprising the following steps:

[0008] S1. Obtain the knockout donor fragments, using the genomic DNA of Pichia pastoris strain GS115 as a template, and obtain the donor-ku70 fragment and the donor-pep4 fragment by fusion PCR;

[0009] S2, design sgRNAs for ku70 gene and pep4 gene, and then assemble them onto Cas9 plasmid respectively by Gibson method;

[0010] S3, preparing Pichia pastoris competent cells;

[0011] S4, electro-transforming the donor-ku70 fragment and donor-pep4 fragment obtained in step S1 and the Cas9 plasmid obtained in step S2 into the Pichia competent cells prepared in step S3, culturing at a constant temperature, screening knockout strains, and performing knockout identification and base sequence comparison on the target sites, and finally obtaining three knockout strains, namely, strain GS115 ku70, strain GS115 pep4 and strain GS115 ku70pep4;

[0012] S5. Linearize and recover the expression vector, and electrotransform it into the strain GS115 Δ ku70、GS115 Δ pep4 or GS115 Δ ku70 Δ pep4 competent cells, and finally obtain the recombinant strain.

[0013] Preferably, in step S1, the genomic DNA of Pichia pastoris strain GS115 is used as a template, and two pairs of primers (ku70-up-F, ku70-up-R, ku70-down-F, ku70-down-R) are used to amplify 1000 bp sequences upstream and downstream of the ku70 knockout site as homologous recombination arms, respectively, and fusion PCR is used to splice the upstream and downstream homologous arms into the donor-ku70 fragment using ku70-up-F / ku70-down-R primers.

[0014] Preferably, the nucleotide sequences of the primers ku70-up-F, ku70-up-R, ku70-down-F, and ku70-down-R are shown in SEQ ID NO.1 to SEQ ID NO.4.

[0015] SEQ ID NO.1: catccagatacggggagctttatcaggaaga

[0016] SEQ ID NO.2:

[0017] gcattgcaagatgagtgttgtcagcaagcacaattgtaccaagtcttggaggaccat

[0018] SEQ ID NO.3:

[0019] tacatggtcctccaagacttggtacaattgtgcttgctgacaacactcatcttg

[0020] SEQ ID NO.4: cagcagtaggctgaatatagagcatgg

[0021] Preferably, in step S1, the genomic DNA of Pichia pastoris strain GS115 is used as a template, and two pairs of primers (pep4-up-F, pep4-up-R, pep4-down-F, pep4-down-R) are used to amplify 1000 bp sequences upstream and downstream of the pep4 knockout site as homologous recombination arms, respectively, and fusion PCR is used to splice the upstream and downstream homologous arms into the donor-pep4 fragment using pep4-up-F / pep4-down-R primers.

[0022] Preferably, the nucleotide sequences of the primers pep4-up-F, pep4-up-R, pep4-down-F, and pep4-down-R are shown in SEQ ID NO.5 to SEQ ID NO.8.

[0023] SEQ ID NO.5: acatacctttagttaccaaccgca

[0024] SEQ ID NO.6:

[0025] gacaaatctaagtatgaaggaaagatcaccctgtgacactagagactctttgcc

[0026] SEQ ID NO.7:

[0027] aagagtctctagtgtcacagggtgatctttccttcatacttagatttgtcc

[0028] SEQ ID NO.8: cacctttctttatctgtaactctgtcg

[0029] Preferably, in step S2, sgRNAs for the ku70 gene and the pep4 gene are designed respectively, and two sgRNAs are selected for each gene based on the comprehensive score and sequence position, namely ku70-sgRNA1, ku70-sgRNA2, pep4-sgRNA1, and pep4-sgRNA2, and the nucleotide sequences are shown in SEQ ID NO.9 to SEQ ID NO.12.

[0030] Preferably, the expression vector in step S5 is a pPIC9K expression vector.

[0031] Preferably, a new signal peptide sequence (SEQ ID NO.20) is synthesized de novo to replace the presequence region of the α signal peptide of the expression vector pPIC9K, and then the expression vector is linearized and recovered, and electrotransformed into competent cells of strain GS115 pep4 or GS115 ku70 pep4 to finally obtain a recombinant strain.

[0032] SEQ ID NO.20:

[0033] agcagaagacacgttgaaaaaacataggaacaatcccacaatccaagagaaccaaacctgcct cat

[0034] In a second aspect, the present invention provides a Pichia pastoris strain that efficiently secretes and expresses recombinant human proteins, wherein the Pichia pastoris strain is constructed by the construction method described in the first aspect.

[0035] In a third aspect, the present invention provides the use of the construction method described in the first aspect or the Pichia pastoris strain described in the second aspect in the large-scale production of recombinant human proteins.

[0036] Beneficial effects of the present invention:

[0037] 1. The present invention significantly improves the integration efficiency of Pichia pastoris strains by knocking out the ku70 gene in the Pichia pastoris genome, greatly increases the success rate of high-copy strain construction, and thus improves the yield of recombinant protein in Pichia pastoris strains.

[0038] 2. The present invention greatly improves the protein degradation problem of the strain when expressing recombinant human proteins by knocking out the pep4 gene in the Pichia pastoris genome, thereby improving the stability and yield of the recombinant human proteins.

[0039] 3. The present invention effectively promotes the secretory expression of recombinant human proteins, significantly improves the secretion efficiency of heterologous protein expression in Pichia pastoris, and shortens the construction cycle of high-copy strains by introducing a new signal peptide O factorsignal into the Pichia pastoris strain in which the pep4 gene has been knocked out, replacing the presequence region of the α signal peptide of the expression vector pPIC9K. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Pichia pastoris strain GS115 in Example 1 Δ ku70(a) and GS115 Δ Figure 3. PCR amplification results of pep4(b) gene knockout strain.

[0041] Figure 2 Pichia pastoris strain GS115 in Example 1 Δ ku70(a) and GS115 Δ Comparison of sequencing results of pep4(b) gene knockout strains.

[0042] Figure 3 For the Pichia yeast strains GS115 and GS115 in Example 2 Δ ku70, GS115Δpep4 and GS115 Δ ku70 Δ Growth curve of pep4.

[0043] Figure 4 For the Pichia yeast strains GS115 and GS115 in Example 2 Δ ku70, GS115Δpep4 and GS115 Δ ku70 Δ Plot of the integration efficiency of Pep4.

[0044] Figure 5 This is a graph showing the expression results of human type III collagen peptides in Pichia pastoris strains SynPc1 to SynPc4 in Example 3.

[0045] Figure 6 This is a graph showing the expression results of human type III collagen peptide in Pichia pastoris strains SynPc3 and SynPc5 in Example 4.

[0046] Figure 7 The standard curve of real-time fluorescence quantitative PCR in Example 7 and the copy number of different strains.

[0047] Figure 8 These are the protein expression results of different strains in Example 8. DETAILED DESCRIPTION

[0048] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0049] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0050] Example 1: Pichia pastoris GS115 Δ ku70 and GS115 Δ Construction of pep4 knockout strain

[0051] (1) Obtaining knockout donor fragments:

[0052] Take out the glycerol culture of Pichia pastoris strain GS115 from the ultra-low temperature refrigerator, and use an inoculation loop to inoculate the strain onto a sterile YPD plate after it is slightly thawed, and culture at 30°C for 2 to 3 days; when obvious white colonies appear on the plate, randomly pick a single colony and inoculate it onto a sterile YPD liquid culture medium, and culture at 30°C, 200 rpm for 2 days; after 2 days, collect the yeast cells by centrifugation, and extract genomic DNA according to the instructions of the kit.

[0053] Using GS115 genomic DNA as a template, two pairs of primers (SEQ ID NO.1 to SEQ ID NO.4) were used to amplify the 1000bp sequence upstream and downstream of the ku70 knockout site as homologous recombination arms; using fusion PCR, the upstream and downstream homologous arms were spliced ​​into a complete donor-ku70 fragment using SEQ ID NO.1 / SEQ ID NO.4 primers. The donor-pep4 fragment was obtained in the same way, with primers SEQ ID NO.5 to SEQ ID NO.8.

[0054] All the above primers were synthesized by Hongxun Biotechnology, and Phusion high-fidelity DNA polymerase was a self-produced reagent of our company. The PCR reaction conditions used were: 98℃ pre-denaturation for 1min; 98℃ denaturation for 15s; 50-60℃ annealing for 30s; 72℃ extension for Xs (the specific time depends on the length of the target fragment); 35 cycles; 72℃ extension for another 10min, and storage at 4℃.

[0055] (2) Design and synthesis of target gene sgRNA:

[0056] The software was used to design sgRNAs for the ku70 and pep4 genes, respectively, and two sgRNAs were selected for each gene based on the comprehensive scores and sequence positions, as shown below.

[0057] ku70-sgRNA1: catcttagagaatgtcagtgagg (SEQ ID NO.9)

[0058] ku70-sgRNA2: ccttgcccggtacaggaataggg (SEQ ID NO.10)

[0059] pep4-sgRNA1: actgggcaaagcaatcaatgagg (SEQ ID NO.11)

[0060] pep4-sgRNA2:gtattgaccagaccaacccttgg (SEQ ID NO.12)

[0061] The above sgRNAs were assembled onto the Cas9 plasmids by the Gibson method. The 20ul reaction system is: 2ul DNA fragment, 1ul vector fragment, 7ul H2O, 10ul Gibson reagent. The above reaction system was placed on a PCR instrument and reacted at 50°C for 45min. After the reaction, the reaction solution was directly added to the just-thawed E. coli competent cells, placed on ice for 1h, heat-shocked at 42°C for 30s, and then ice-bathed again for 10min. Then 900ul preheated LB culture medium was added to the competent cells, incubated at 37°C for 1h, and then the bacterial solution was spread on the LB plate of the corresponding resistance. Incubate at 37°C overnight.

[0062] (3) Preparation of Pichia pastoris competent cells:

[0063] Take out the glycerol culture of Pichia yeast strain GS115 from the ultra-low temperature refrigerator, and use an inoculation loop to inoculate the strain onto a sterile YPD plate after it is slightly thawed, and culture at 30°C for 2-3 days; when obvious white colonies appear on the plate, randomly pick a single colony and inoculate it onto a sterile YPD liquid culture medium, and culture it at 30°C and 200rpm overnight; inoculate the bacterial solution into 50 ml of fresh YPD culture medium, and the initial OD600 of the fresh bacterial solution is about 0.4-0.5; place it at 30°C and 220rpm for constant temperature culture until the OD600 of the culture solution reaches 0.9-1.0.

[0064] Transfer the bacterial solution to a centrifuge tube, and collect the yeast cells by centrifugation at 4000rpm for 10min; resuspend and wash the cells with 0.5 times volume (25mL) of sterile water, and centrifuge at 4000rpm for 10min to collect the yeast cells; repeat the above steps once; resuspend the yeast cells with 25mL of 0.1MLiAc and 0.25ml of 1M DTT solution, and culture at 30℃ and 100rpm for 1h; collect the yeast cells by centrifugation at 4000rpm for 10min; resuspend and wash the cells with 25mL of 1M sorbitol solution, and collect the yeast cells by centrifugation at 4000rpm for 10min; discard the supernatant, resuspend the cells with the remaining sorbitol, and dispense the cells into 1.5ml centrifuge tubes at a specification of 100ul / tube, which are Pichia competent cells.

[0065] (4) Pichia pastoris electrotransformation:

[0066] Add Cas9 plasmid and donor fragment to 100ul competent cells, transfer to an electroporation cup, and let stand on ice for 5min; perform electroporation according to the recommended program of the electroporator; immediately add 1ml 1M sorbitol solution, resuspend the cells, transfer to a clean centrifuge tube, and incubate at 30℃ for 3h; collect yeast cells by centrifugation at 4000rpm and discard the supernatant; add 0.1ml YPD culture medium to resuspend the cells, and spread them on the corresponding resistance plate; and culture at 30℃ for 2-3 days.

[0067] (5) Screening and identification of knockout strains:

[0068] A single colony was randomly picked from the plate and inoculated into a sterile YPD liquid medium, and cultured at 30°C and 200 rpm for 2 to 3 days. The knockout site of the bacterial solution was identified by PCR, and the primer sequences used were SEQ ID NO.13 to SEQ ID NO.16. The results were as follows: Figure 1 Then, the knockout gene PCR is performed on the positive clones to amplify and recover the amplified sequence of the knockout gene. The recovered PCR product is sent for testing to determine the base sequence at the target site of the positive clone. The sequence comparison result is shown in Figure 2 As shown. Finally, strain GS115 was obtained Δ ku70, strain GS115 Δ pep4 and strain GS115 Δ ku70 Δ pep4 triple knockout strains.

[0069] Example 2: Determination of integration efficiency and growth rate after knockout

[0070] (1) Linearization of pPIC9K plasmid

[0071] According to the Pichia manual, use SacI endonuclease to linearize the pPIC9K plasmid. The endonuclease will cut at the 5'AOX1 site of the expression vector. Usually the enzyme digestion system is 100ul. After the digestion, run agarose gel electrophoresis to ensure that the plasmid is completely cut.

[0072] (2) Preparation of Pichia pastoris competent cells and electroporation

[0073] The strain GS115 and the strain GS115 were prepared according to the steps in Example 1. Δ ku70, strain GS115 Δ pep4 and strain GS115 Δ ku70 Δ pep4 competent cells, and the linearized pPIC9K plasmid was electroporated into the Pichia pastoris strain.

[0074] (3) Determination of growth rate and integration efficiency of Pichia pastoris strains

[0075] Inoculate a single colony into 5 mL YPD medium and grow at 30°C, 200 rpm for 16 hours. Inoculate the overnight culture into 25 mL sterile YPD medium and grow in a 250 mL Erlenmeyer flask at 30°C, 200 rpm. Measure the OD600 of the culture every hour for the first 8 hours, and make the final measurement at 24 hours. The results are as follows: Figure 3 As shown. ku70 knockout strain GS115 Δ ku70 and GS115 Δ ku70 Δ The growth rate of pep4 was significantly lower than that of the initial strain GS115 and GS115 Δ This may be related to the importance of the NHEJ mechanism mediated by Ku70 in Pichia pastoris in the process of DNA replication and repair.

[0076] Refer to the Pichia pastoris manual for screening and the PTVA method to screen out strains that are tolerant to different antibiotic concentrations.

[0077] The transformed cells in step (2) were plated with a low G418 concentration (200 ug ml -1 ) on a YPD plate. After 2 to 3 days, obvious single colonies appeared on the plate. At this time, most of the colonies on the plate were single-copy strains. Select several G418-resistant colonies from the transformation plate for further use. First, streak each selected single colony on the YPD plate. This single colony selection process was repeated 3 times to ensure that each transformant was a descendant of a single cell. Spot each single-copy strain sample on a plate containing 0.5 mg ml -1Repeat the above process to obtain 1.0, 2.0, 3.0 and 5.0 mg ml -1 The concentration of G418 on the plate was increased sequentially. The number of colonies on the plates with different G418 concentrations was counted, and the integration efficiency of different strains was calculated. The results are as follows: Figure 4 shown.

[0078] ku70 knockout strain GS115 Δ ku70 and GS115 Δ ku70 Δ The integration efficiency of pep4 was significantly higher than that of the original strain GS115 and GS115 Δ pep4 strains, especially high-concentration G418 plates that require more copies. After ku70 was knocked out, the NHEJ activity of Pichia pastoris cells was reduced and the HR activity was enhanced, which promoted the high-copy integration of the expression plasmid in the genome.

[0079] Example 3: Comparison of expression effects of ku70 and pep4

[0080] (1) Construction of expression vector for recombinant human collagen

[0081] The sequence of human type III collagen was downloaded from NCBI, and the non-structural sequences at the N-terminus and C-terminus were deleted. The sequence of the triple helix region was codon optimized to obtain the DNA sequence of the recombinant protein. The DNA sequence of the protein was synthesized de novo (SEQ ID NO.17), and the coding DNA was assembled into the expression vector pPIC9K by the Gibson homologous recombination method and named R0362.

[0082] (2) Expression plasmid linearization and electroporation

[0083] R0362 was linearized and recovered using SacI endonuclease, and the recovered linear plasmid was electroporated into GS115 and GS115 Δ ku70、GS115 Δ pep4 and GS115 Δ ku70 Δ In pep4 competent cells, the transformed cells were plated with low G418 concentration (200ug ml -1 ) on a YPD plate, and the specific method was the same as in Example 2. The final recombinant strains were named SynPc1, SynPc2, SynPc3 and SynPc4 in sequence.

[0084] (3) Transformant identification and expression

[0085] When a single colony grows on the YPD plate, pick a single colony and inoculate it into liquid culture medium, and culture it at 30℃ for 24h. Use primers to perform PCR colony screening and verification. The PCR system is as follows:

[0086]

[0087] PCR reaction program (35 cycles in total): 94°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 60°C annealing for 30 s, 68°C extension for 10 s, 68°C full extension for 5 min. After the PCR reaction program is completed, 5 ul of each sample is aspirated into a 1.2% agarose gel for 5-10 min nucleic acid electrophoresis detection.

[0088] According to the results, select positive monoclonal colonies, place them in a test tube containing 50ml BMGY medium, and culture at 28℃ / 250-300rpm until OD600 reaches 2-6 (16-18h). Centrifuge at 3000rpm for 5min at room temperature, collect the bacteria, resuspend the cell pellet with sterile BMMY, and dilute the suspension OD600 to about 0.3. Transfer the fresh suspension obtained in the above steps to a large triangular flask with a volume of 500ml, start inducing expression culture at 30℃200rpm, add methanol at a final concentration of 0.5-1.0%, and place on a shaker at 28℃250-300rpm to continue growing. Add methanol to the culture medium every 24h to a final concentration of 0.5-1.0%, and culture for 72h.

[0089] (4) Protein extraction and identification

[0090] The fermentation broth was centrifuged at 12000 rpm for 10 min to separate the supernatant and the precipitate, the supernatant was stored at 4°C, and the bacterial cells were frozen at -20°C.

[0091] The cells were dissolved in 50 mL of equilibrium buffer and then ultrasonically disrupted. Disruption conditions: 350 W power, 4 s of disruption, 8 s interval, 30 cycles in total, equilibrium buffer: 20 mM Tris, 500 mM NaCl, pH 7.5, 1 mM TCEP, 20 mM imidazole. After disruption, the liquid was centrifuged at 12,000 rpm for 10 min and the supernatant was collected.

[0092] Prepare 12% SDS-PAGE gel according to the standard process, and let it stand until it is completely solidified. Add an appropriate amount of loading buffer to the supernatant of the fermentation broth and the supernatant sample after the bacterial cell is crushed, mix well and add to the loading well (the loading amount is generally controlled at 10-15ul). 100-120V constant voltage, change to 120-160V constant voltage after seeing the indicator completely enter the gel, and stop electrophoresis when the indicator moves to the bottom of the gel plate. Take out the gel plate and place it in 0.25% Coomassie Brilliant Blue staining solution, microwave heating for 2 minutes, stain for about 30 minutes, pour out the staining solution, and rinse the PAGE gel with distilled water. Add decolorizing solution to the decolorizing box, microwave heating for 2 minutes, place it on a horizontal shaker and shake slowly, pay attention to changing the staining solution until the bands are clearly visible. Use an imaging system to take a picture of the PAGE gel after decolorization.

[0093] like Figure 5 As shown, SynPc1 can secrete and express human collagen, but a large amount of target protein is still not secreted in the broken cells; and there is also a small non-target protein band in lane 1, which we speculate to be the band after the degradation of the target protein. It can be found that the initial strain GS115 is insufficient as an expression host. The protein expression of the knockout strain SynPc2 is similar to that of the initial strain, and there is no significant improvement. However, after knocking out pep4, no visible miscellaneous bands were found in the supernatant of strains SynPc3 and SynPc4, which can confirm that knocking out pep4 can greatly improve the problem of Pichia pastoris protein degradation. In summary, ku70 knockout has no obvious effect on protein expression, while pep4 knockout can reduce the degradation of Pichia pastoris when expressing recombinant proteins.

[0094] Example 4: Optimization of secretion tags

[0095] For heterologous protein production in Pichia pastoris, the most common secretion signal is the secretion signal of the Saccharomyces cerevisiae α-factor mating pheromone. One limitation of the α-factor secretion signal is that the signal sequence partially directs the post-translational protein translocation across the ER membrane. Therefore, many heterologous proteins cannot cross the ER membrane and enter the secretory pathway when they are folded in the yeast cytoplasm. To solve this problem, we screened a co-translational translocation signal peptide signal from Saccharomyces cerevisiae to replace the conventional α-factor signal sequence, which directs co-translational translocation across the ER membrane.

[0096] (1) Construction of a new signal peptide expression vector for recombinant human collagen

[0097] The new signal peptide sequence (SEQ ID NO.20) replaced the presequence region of the α signal peptide of the expression vector pPIC9K, and a new signal peptide sequence was synthesized from scratch; the expression plasmid R0362 was digested with BamHI / EcoRI, and the new signal peptide was assembled into the linearized vector using the Gibson homologous recombination method. The final construction was named R0362-O.

[0098] (2) Expression plasmid linearization and electroporation

[0099] The expression plasmid R0362-O was linearized and recovered using SacI endonuclease, and the recovered linear plasmid was electroporated into the strain GS115 Δ In pep4 competent cells, the transformed cells were plated with low G418 concentration (200ug ml -1 ) on a YPD plate, and the specific method is the same as in Example 2.

[0100] (3) Transformant identification and expression

[0101] When a single colony grows on the YPD plate, pick a single colony, inoculate it into a liquid culture medium, and culture it at 30°C for 24 hours. Use primers to perform PCR colony screening and verification. The PCR system and reaction procedure are the same as in Example 3. According to the results, select positive monoclonal colonies, perform strain fermentation and protein induction expression, and the specific method is the same as in Example 3. The final recombinant strain is named SynPc5.

[0102] (4) Protein extraction and identification

[0103] As described in Example 3, protein extraction and identification were performed on the fermentation broth of the new strain.

[0104] like Figure 6 As shown in the figure, the protein production of the SynPc5 strain was significantly improved after the signal peptide was optimized, and the target protein production in lane 3 of its fermentation supernatant was significantly higher than that in lane 1 representing the SynPc3 strain; at the same time, the target protein content in the broken cells was also significantly reduced, further proving that the optimized signal peptide effectively promoted the secretory expression of human type III collagen peptide.

[0105] Example 5: Construction of other recombinant human protein expression vectors and strains

[0106] (1) Construction of expression vectors for recombinant human fibronectin and serum albumin

[0107] The sequences of human fibronectin (SEQ ID NO.21) and serum albumin (SEQ ID NO.22) were downloaded from NCBI, and the coding sequences were optimized for Pichia pastoris-preferred codons to obtain the DNA sequences of the recombinant proteins. The new signal peptide was replaced, the DNA sequence of the protein was synthesized from scratch, and the coding DNA was assembled into the expression vector pPIC9K by the Gibson homologous recombination method, and named R0376-O and R0417-O, respectively.

[0108] (2) Expression plasmid linearization and electroporation

[0109] The expression plasmids R0376-O and R0417-O were linearized and recovered using SacI endonuclease, and the recovered linear plasmids were electroporated into the strain GS115 Δ In pep4 competent cells, the transformed cells were plated with low G418 concentration (200ug ml -1 ) on a YPD plate, and the specific method is the same as in Example 2.

[0110] (3) Transformant identification and expression

[0111] When a single colony grows on the YPD plate, pick a single colony, inoculate it into a liquid culture medium, and culture it at 30°C for 24 hours. Use primers to perform PCR colony screening and verification. The PCR system and reaction procedure are the same as in Example 3. Finally, low-copy recombinant human fibronectin and serum albumin Pichia yeast expression strains were screened. The final recombinant strains were named SynPc6 and SynPc7.

[0112] Example 6: Screening and construction of high-copy expression strains of different recombinant human proteins

[0113] As mentioned above, ku70 knockout can greatly improve the integration efficiency of Pichia pastoris multi-copy, but it will also slow down the growth rate of the strain. Because the three human proteins expressed in the present invention can screen strains with high G418 resistance without knocking out ku70, GS115Δpep4 was selected in Example 6 for subsequent experiments.

[0114] The new signal peptide low-copy GS115Δpep4 expression strains in Examples 4 and 5 were streaked onto YPD plates and the process was repeated three times. The high-copy expression strains were screened on high-concentration G418 plates according to the method described in Example 2. The high-copy strains obtained by the final screening were plated at 5.0 mg ml -1 The process was repeated 3 times. Finally, 3 strains expressing high-copy recombinant human protein were obtained. It was verified that these 3 high-copy strains could express recombinant human protein at a concentration of up to 10 mg ml -1 G418 can still grow in liquid culture medium.

[0115] Example 7: Copy number screening and quantification

[0116] Table 1 summarizes all strains used in this example and their related information. The new signal peptide low-copy GS115Δpep4 expression strain in Examples 4 and 5 was streaked onto a YPD plate, and the process was repeated 3 times. The high-copy expression strain was screened on a high-concentration G418 plate according to the method described in Example 2. The high-copy strain finally screened was plated at 5.0 mg ml -1 The process was repeated 3 times. Finally, 3 strains expressing high-copy recombinant human protein were obtained. It was verified that these 3 high-copy strains could express recombinant human protein at a concentration of up to 10 mg ml -1 G418 can still grow in liquid culture medium.

[0117] Table 1

[0118]

[0119] The real-time fluorescence quantitative PCR method was used to determine the integration copy number of different strains. The pPIC9K plasmid was used as the standard plasmid for real-time fluorescence quantitative analysis. As in Example 1, SynPc5-SynPc10 strains were cultured and their genomic DNA was extracted as a sample DNA template. The reaction system for quantitative PCR was:

[0120]

[0121] The specific sequences of quantitative PCR primers for different genes are shown in SEQ ID NO. 23 to SEQ ID NO. 30. The reaction conditions are: pre-denaturation at 98°C for 30s, denaturation at 98°C for 10s, annealing at 58°C for 20s, extension at 72°C for 10s, 40 cycles, and post-extension at 72°C for 1min.

[0122] Prepare pPIC9K plasmid and determine its DNA concentration. Calculate the plasmid copy number concentration (copies / ul) based on the mass fraction of the plasmid and Avogadro's constant. Dilute the plasmid solution to 10 8 , 10 9 , 10 10 , 10 11 and 10 12 The standard curve was drawn using the specific primer pair of G418, with 4 parallels set for each concentration. The Cp value calculated by the real-time fluorescence quantitative PCR instrument manufacturer's software was used as the ordinate, and the lg value of the copy number concentration of the standard plasmid was used as the abscissa to establish the standard curve. 2 It is 0.9957, and the linear equation is y=-2.97x+51.65.

[0123] According to the quantitative PCR results Figure 7 The results showed that the copy number concentration of low-copy strains SynPc5, SynPc6 and SynPc7 was 8.5*10 9 ,8.8*10 8 and 1.1*10 11 copies / ul, while the copy number concentration of high-copy strains SynPc8, SynPc9 and SynPc10 was 1.6*10 23 、78*10 18 and 3.8*10 23 After statistical analysis, there were significant differences between the two strains in the same group.

[0124] Example 8: Expression of high copy number expression strains

[0125] (1) Strain fermentation and induced expression

[0126] The strain in Example 7 was activated, and a single clone was picked and inoculated into BMGY culture medium for culture. The strain fermentation and protein induction expression were carried out as described in Example 3.

[0127] (2) Protein extraction and identification

[0128] The steps are the same as those described in Example 3, and the fermentation broth in step (1) is subjected to cell disruption, protein extraction and protein identification. The results are as follows: Figure 8 As shown. According to the SDS-PAGE results of the protein, we can see that the protein yields of the high-copy strains of the three recombinant human proteins are significantly higher than those of the low-copy strains. The high-copy expression frame on the Pichia genome greatly increases protein production, and the highest shake flask fermentation yield of the SynPc8 strain can reach 1.4g / L. This is only the yield data obtained at the laboratory shake flask level. Higher yields can undoubtedly be obtained in larger-volume high-density fermenters, which has great potential and prospects for industrialization.

[0129] Knockout of ku70 significantly improved the integration efficiency of Pichia pastoris strains, greatly increased the success rate of high-copy strain construction, and thus increased the yield of recombinant protein in Pichia pastoris strains. Δ pep4 is used as a chassis strain for screening high-copy strains, but there is no doubt that the method of knocking out the Pichia pastoris ku70 gene is beneficial to improving the expression of heterologous recombinant proteins by Pichia pastoris. In the embodiments of the present invention, only human type III collagen, fibronectin and serum albumin are used as cases for verification, and practical applications are not limited to this. As described above, the present invention can significantly improve the secretion efficiency of heterologous protein expression in Pichia pastoris, shorten the construction cycle of high-copy strains, and is more efficient, convenient and economical than existing methods.

[0130] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for constructing a Pichia pastoris strain that efficiently secretes and expresses a recombinant human protein, characterized in that: The method comprises the following steps: S1. Obtain the knockout donor fragments, using the genomic DNA of Pichia pastoris strain GS115 as a template, and obtain the donor-ku70 fragment and the donor-pep4 fragment by fusion PCR; S2, design sgRNAs for ku70 gene and pep4 gene, and then assemble them onto Cas9 plasmid respectively by Gibson method; S3, preparing Pichia pastoris competent cells; S4, the donor-ku70 fragment and donor-pep4 fragment obtained in step S1, and the Cas9 plasmid obtained in step S2, are electroporated into the Pichia competent cells prepared in step S3, cultured at a constant temperature, and the knockout strain is screened. The target site is identified for knockout and the base sequence is aligned, and finally the strain GS115 is obtained. Δ ku70, strain GS115 Δ pep4 and strain GS115Δku70 Δ pep4 three knockout strains; S5. Linearize and recover the expression vector, and electrotransform it into the strain GS115 Δ ku70、GS115 Δ pep4 or GS115 Δ ku70 Δ pep4 competent cells, and finally obtain the recombinant strain.

2. The construction method according to claim 1, characterized in that: In step S1, the genomic DNA of Pichia pastoris strain GS115 is used as a template, and two pairs of primers (ku70-up-F, ku70-up-R, ku70-down-F, ku70-down-R) are used to amplify 1000 bp sequences upstream and downstream of the ku70 knockout site as homologous recombination arms, respectively. Fusion PCR is performed using ku70-up-F / ku70-down-R primers to splice the upstream and downstream homologous arms into the donor-ku70 fragment.

3. The construction method according to claim 2, characterized in that: The nucleotide sequences of the primers ku70-up-F, ku70-up-R, ku70-down-F, and ku70-down-R are shown in SEQ ID NO.1 to SEQ ID NO.

4.

4. The construction method according to claim 1, characterized in that: In step S1, the genomic DNA of Pichia pastoris strain GS115 is used as a template, and two pairs of primers (pep4-up-F, pep4-up-R, pep4-down-F, pep4-down-R) are used to amplify 1000 bp sequences upstream and downstream of the pep4 knockout site as homologous recombination arms, respectively. Fusion PCR is performed using pep4-up-F / pep4-down-R primers to splice the upstream and downstream homologous arms into the donor-pep4 fragment.

5. The construction method according to claim 4, characterized in that: The nucleotide sequences of the primers pep4-up-F, pep4-up-R, pep4-down-F, and pep4-down-R are shown in SEQ ID NO.5 to SEQ ID NO.

8.

6. The construction method according to claim 1, characterized in that: In step S2, sgRNAs for the ku70 gene and the pep4 gene were designed respectively, and two sgRNAs were selected for each gene based on the comprehensive score and sequence position, namely ku70-sgRNA1, ku70-sgRNA2, pep4-sgRNA1, and pep4-sgRNA2, and the nucleotide sequences were shown in SEQ ID NO.9 to SEQ ID NO.

12.

7. The construction method according to claim 1, characterized in that: The expression vector in step S5 is a pPIC9K expression vector.

8. The construction method according to claim 7, characterized in that: A new signal peptide sequence (SEQ ID NO. 20) was synthesized from scratch to replace the presequence region of the α signal peptide of the pPIC9K expression vector, and then the expression vector was linearized and recovered, and electroporated into the strain GS115. Δ pep4 or GS115 Δ ku70 Δ pep4 competent cells, and finally obtain the recombinant strain.

9. A Pichia pastoris strain that efficiently secretes and expresses a recombinant human protein, characterized in that: The Pichia pastoris strain is constructed by the construction method according to any one of claims 1 to 8.

10. Use of the construction method according to any one of claims 1 to 8 or the Pichia pastoris strain according to claim 9 in large-scale production of recombinant human proteins.

Images