Cloning expression and application of bifunctional glycosyl transferase ScUGT gene in strobilanthes cusia
By cloning and expressing the gene of the glycosyltransferase ScUGT in Malan, the problem of insufficient research on key enzymes in indigoglycoside synthesis is solved, and the key role in indigoglycoside synthesis is revealed and the possibility of industrial production of glycoside substances is realized.
Patent Information
- Application Number
- CN202411651795.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-04-08
AI Technical Summary
There is currently no in-depth study on the key enzyme glycosyltransferases in the synthesis of indigoside in Malan, which has affected the understanding of the development of medicinal resources and medicinal mechanisms of medicinal use.
The gene of the glycosyltransferase ScUGT in Malan was cloned and expressed, and the expression vector was constructed through recombinant technology and heterologous expression was achieved in the host cell, and finally the ScUGT enzyme with enzymatic activity was obtained.
The successful cloning and expression of ScUGT enzyme revealed its key role in indigoglycopy, enriched the understanding of the physiological mechanism of marzi blue plants, and provided new possibilities for the industrial production of glycosides such as indigoglycopy.
Smart Images
Figure CN119776308A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the cloning, expression and application of a bifunctional glycoside hydrolase ScUGT gene. Background Art
[0002] Indigofera tinctoria is a perennial herb of the genus Indigofera of the family Acanthaceae, which is widely distributed in tropical and subtropical regions. The medicinal parts of Indigofera tinctoria are often used as traditional herbal medicines for clearing away heat and detoxifying, as well as for treating common diseases such as colds and coughs. At present, a variety of bioactive ingredients have been isolated and identified from Indigofera tinctoria, such as indigo, indigotin, and a variety of flavonoid compounds, which show significant physiological activities in antioxidant, anti-inflammatory, and anti-tumor aspects. However, no research has been reported on the key enzyme for the synthesis of indigosides in Indigofera tinctoria, glycosyltransferase. In-depth research on this important enzyme in Indigofera tinctoria is expected to provide new scientific basis for the development of medicinal resources of Indigofera tinctoria and the elucidation of its medicinal mechanism.
[0003] As an important active ingredient in Indigo, the synthesis route of Indigo has attracted much attention. The specific role of glycosyltransferase in this process and how to regulate the synthesis of Indigo are still mysteries to be explored. In-depth analysis of the relationship between glycosyltransferase and Indigo in Indigo will not only help us understand this medicinal plant more comprehensively, but also open up new paths for future drug development and resource utilization. Summary of the invention
[0004] The purpose of the present invention is to provide a ScUGT gene and its cloning, expression and application. The recombinant ScUGT enzyme has enzyme activity.
[0005] In a first aspect of the present invention, a gene of glycosyltransferase ScUGT is provided, and the nucleotide sequence thereof is shown as SEQ ID NO.1.
[0006] The second aspect of the present invention provides a gene of glycosyltransferase ScUGT, whose amino acid sequence is shown in SEQ ID NO.2.
[0007] Using cDNA obtained from fresh indigofera leaves as a template, specific primers UGT-F and UGT-R were designed to construct plasmid Bluntzero-ScUGT, which was amplified and sequenced in a DH5a competent state to obtain the glycosyltransferase ScUGT of the present invention.
[0008] In the third aspect of the present invention, the nucleotide sequence of the glycosyltransferase ScUGT gene is constructed into an expression plasmid to form a recombinant expression vector.
[0009] In the fourth aspect of the present invention, a recombinant strain is formed by transforming a recombinant expression vector of the glycosyltransferase ScUGT gene into a host cell Escherichia coli BL21 (DE3).
[0010] Furthermore, the cloning and expression method of the glycosyltransferase ScUGT provided by the present invention comprises the following steps: The gene fragment of the glycosyltransferase ScUGT according to claim 1 is obtained by PCR amplification using the cDNA obtained by reverse transcription of the total RNA of Malanthes indica as a template.
[0011] The target gene fragment obtained in step (1) is cloned into an expression vector to form a recombinant expression vector, and then the recombinant expression vector is transferred into a prokaryotic expression system for heterologous expression, and finally the glycosyltransferase ScUGT is purified.
[0012] Furthermore, PCR amplified the glycosyltransferase ScUGT gene, and the primer pair sequence used was: Furthermore, according to the present invention, a recombinant expression vector is constructed, and the target gene fragment obtained in step (1) is integrated into the expression vector. The specific method includes introducing restriction endonuclease cutting sites (EcoRⅠ, HindⅢ) at both ends of the target gene fragment, then double-digesting the expression vector, connecting the target gene and the expression vector, and obtaining a recombinant expression vector.
[0013] The fifth aspect of the present invention provides a specific preparation method of glycosyltransferase ScUGT, comprising a recombinant expression vector p ET-28a(+)-ScUGT, recombinant strain, and the steps of obtaining glycosyltransferase ScUGT by protein induction expression, purification, etc., include the following steps: 1. Amplify the nucleotide sequence shown in SEQ ID NO.1 by PCR; 2. Construction of recombinant plasmid p ET-28a(+)-ScUGT; 3. Construction of expression strain p ET-28a(+)-ScUGT-BL21(DE3); 4. Recombinant plasmid p ET-28a(+)-ScUGT was introduced into Escherichia coli BL21(DE3) and named as recombinant bacteria; 5. Select a single clone of the recombinant bacteria and culture it in LB medium containing kanamycin (100 mg / L), then expand the culture, culture it on a shaker overnight, add an inducer for induction culture, collect the bacterial solution, centrifuge it, and collect the precipitate; 6. Add buffer to the precipitate to resuspend the strain, ultrasonically lyse, centrifuge, collect the supernatant and freeze for later use; 7. Use a nickel column to grade and purify the supernatant in step F, and elute with 50 mM-300 mM imidazole / Tri-HCl solution to finally obtain the purified protein.
[0014] The sixth aspect of the present invention provides a glycosyltransferase ScUGT, its encoding gene, recombinant expression vector, and recombinant bacteria for use in the production of oxygen glycosides and nitrogen glycosides.
[0015] In a seventh aspect, the present invention provides a co-expression vector pCOLADuet-ScFMO-ScUGT for catalyzing the synthesis of glycosides in vitro.
[0016] The advantages of the present invention are: The present invention reveals a bifunctional glycosyltransferase ScUGT in Indigofera ovata, which can catalyze the glycosylation reaction of indoxyl to produce glycosides such as indigo. This discovery not only enriches our understanding of the physiological mechanism of Indigofera ovata plants, but also provides a new perspective for the study of related biosynthetic pathways.
[0017] The present invention provides the nucleotide sequence (SEQ ID NO.1) and amino acid sequence (SEQ ID NO.2) of the ScUGT enzyme, which provides a solid foundation for subsequent gene cloning, protein expression and functional research.
[0018] ScUGT enzymes show broad substrate specificity and can catalyze a variety of substrates to generate oxygen and nitrogen glycosides. This property makes the enzyme have a wide range of application potential in the field of biosynthesis and can be used to synthesize a variety of different types of glycoside compounds.
[0019] The present invention confirms that ScUGT enzymes can catalyze the synthesis of indigoside in vitro, which provides new possibilities for the industrial production of glycoside compounds such as indigoside. Through in vitro enzyme-catalyzed synthesis, these valuable compounds can be produced more efficiently and environmentally friendly, reducing production costs and dependence on natural resources. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The embodiments of the present invention are described in more detail by means of the accompanying drawings, and the accompanying drawings used will be briefly introduced below.
[0021] Figure 1 This is the electrophoresis result of the PCR amplification product of the ScUGT gene in the present invention.
[0022] Figure 2 This is the map of the ScUGT gene recombinant plasmid in the present invention.
[0023] Figure 3 It is the SDS-PAGE gel image of the ScUGT recombinant protein in the present invention; M is protein Maker, and lane 1 is glycosyltransferase ScUGT.
[0024] Figure 4 and Figure 5 The ScUGT in the present invention synthesizes indigoside in vitro. Figure 4 A is the bacterial solution containing the pCOLADuet-ScFMO recombinant plasmid, Figure 4 B is the bacterial solution containing the pCOLADuet-ScFMO-ScUGT recombinant plasmid.
[0025] Figure 6 The results are the identification results of the catalytic products of the recombinant protein glycosyltransferase ScUGT on 3,4-dichlorophenol and 3,4-dichloroaniline. DETAILED DESCRIPTION
[0026] The specific implementation methods provided by the present invention are described in detail below in conjunction with examples.
[0027] Example 1: Cloning of the glycosyltransferase ScUGT gene.
[0028] (1) Glycosyltransferase ScUGT, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of which is shown in SEQ ID NO.2.
[0029] (2) Design primers ScUGTF and ScUGTR based on the gene sequence, and perform PCR amplification using the cDNA of Echinops indigofera as a template. ScUGT primer sequences: (5'→3') ScUGT-F: ATGGCCGATGATTCCCAAAC, ScUGT-R: ATGATTCCCCACTCCACTCG.
[0030] (3) PCR reaction conditions: pre-denaturation at 95°C for 5 min; 94°C for 30 sec, 55°C for 30 sec; 72°C for 40 sec, 35 cycles; final extension at 72°C for 10 min.
[0031] (4) The PCR amplification product was subjected to agarose gel electrophoresis and then recovered. After ligation with Bluntzero, it was transformed into E. coli DH5α and cultured overnight at 37°C. Positive transformants were screened on LB plates containing kanamycin resistance (100 mg / L). Positive single colonies were selected and cultured in LB liquid medium at 37°C for 12-16 hours. The plasmid was extracted and named Bluntzero-ScUGT, which was sent to the company for sequencing.
[0032] Example 2: Construction of pET28a-ScUGT recombinant vector and cloning strains p Preparation of ET28a-ScUGT-E. coli DH5a.
[0033] (1) Based on the gene sequence, primers 28a-ScUGT-F: TGGGTCGCGGATCCGAATTCATGGCCGATGATTCCCAAAC and 28a-ScUGT-R: TCGAGTGCGGCCGCAAGCTTATGATTCCCCACTCCACTCG were designed with EcoRI and HindⅢ restriction sites, respectively. PCR was performed using the correctly sequenced Bluntzero-ScUGT as a template.
[0034] (2) PCR reaction conditions: pre-denaturation at 95°C for 5 min; 94°C for 30 sec, 56°C for 30 sec; 72°C for 40 sec, 35 cycles; extension at 72°C for 10 min after the cycle.
[0035] (3) After the PCR reaction, agarose gel electrophoresis was performed to detect a bright band at 1500 bp. The gel was cut and recovered for purification, which was the glycosyltransferase ScUGT gene fragment.
[0036] (4) Double digestion with restriction endonucleases (EcoRI, HindⅢ) p The ET-28a vector was detected by agarose gel electrophoresis, and the enzyme digestion product was recovered and purified.
[0037] (5) After connecting the PCR product and the enzyme digestion product, transform them into E. coli DH5a competent cells, culture them at 37°C overnight, and screen positive transformants on LB plates containing kanamycin resistance (100 mg / L). Select positive single colonies and culture them in LB liquid medium at 37°C for 12-16 hours, extract the plasmid, name it pET28a-ScUGT, and send it to the company for sequencing.
[0038] Example 3: Protein expression and purification of glycosyltransferase ScUGT gene.
[0039] (1) The correctly sequenced recombinant plasmid pET-28a(+)-ScUGT was transferred into E. coli BL21(DE3) competent cells to obtain recombinant bacteria.
[0040] (2) Pick 1-2 positive single colonies and inoculate them into 1 mL LB liquid medium containing kanamycin at a final concentration of 100 mg / L and culture for 3-4 hours. Then transfer them into 50 mL LB liquid medium containing kanamycin at a final concentration of 100 mg / L and culture at 37°C with shaking until the OD 600 It is 0.6-0.8.
[0041] (3) Add IPTG at a final concentration of 0.1 mM for induction and culture at 16°C, 180 rpm, and shaking for 20 h.
[0042] (4) After induction, collect the cells by centrifugation at 8000 rpm for 10 min at 4°C, resuspend the cells in 10 mL of PBS buffer, and lyse the bacteria by ultrasonication until the liquid is transparent.
[0043] (5) Centrifuge at 8000 rpm for 10 min at 4°C to collect the supernatant of the lysate. The supernatant is the soluble protein.
[0044] (6) The target protein ScUGT was subjected to SDS-PAGE electrophoresis. The results are shown in the figure. The size of the ScUGT fusion protein is 52.3 kDa, which confirms the successful expression of the protein. Figure 3 .
[0045] Example 4: In vitro expression to produce indigoside.
[0046] (1) The pCOLADuet-ScFMO-ScUGT in the present invention is constructed based on the pCOLADuet-ScFMO recombinant plasmid constructed in this laboratory. The vector restriction sites are NdeⅠ and XhoⅠ. The remaining steps refer to Example 1. The primer sequences are designed as follows: pCOLADuet-ScUGT-F: AAGAAGGAGATATACATATGATGGCCGATGATTCCCAAAC and pCOLADuet-ScUGT-R: GGTTTCTTTACCAGACTCGAGATGATTCCCCACTCCACTCG.
[0047] (2) Transform the correctly sequenced recombinant plasmid pCOLADuet-ScFMO-ScUGT into BL21(DE3) competent cells to obtain recombinant bacteria. pCOLADuet-ScFMO was used as a control.
[0048] (3) Pick 1-2 positive single colonies and inoculate them into 1 mL LB liquid medium containing kanamycin at a final concentration of 100 mg / L and culture for 3-4 h. Then transfer them into 50 mL M9 liquid medium (containing 17.08 g / L disodium hydrogen phosphate dodecahydrate, 3.0 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 1.0 g / L ammonium chloride, 2 mM magnesium sulfate heptahydrate, 0.1 Mm calcium chloride, 1 µM nicotine, 1 µM flavin, 0.2% glycerol, 0.8 mM tryptophan, 0.5 g / L arabinose) containing kanamycin at a final concentration of 100 mg / L and culture at 28°C with shaking for 4-6 h.
[0049] (4) Add IPTG at a final concentration of 0.1 mM for induction, culture at 25°C and 180 rpm for 20 h, and observe the color change of the bacterial solution. Indigo was produced in both the control group and the experimental group, but less indigo was produced in the experimental group. It is speculated that indoxyphenol produced glycosides under the action of glycosyltransferase ScUGT.
[0050] (5) Take 1 mL of bacterial solution, add 1 mL of methanol to terminate the reaction, mix well, centrifuge at 8000 rpm for 10 min, take the supernatant, and perform LC-MS detection. Compared with the standard, the generated glycoside (indole glycoside) is as follows: Figure 4 , Figure 5 shown.
[0051] Example 5: In vitro expression to produce oxygen and nitrogen glycosides.
[0052] (1) Referring to steps 1 and 2 in Example 3, the substrates 3,4-dichlorophenol and 3,4-dichloroaniline were added to the culture medium for 4-6 hours, and then IPTG was added at a final concentration of 0.1 mM for induction for 20 hours.
[0053] (2) Take 1 mL of bacterial solution respectively, add 1 mL of methanol to terminate the reaction, mix well, centrifuge at 8000 rpm for 10 min, and take the supernatant.
[0054] (3) The fermentation products containing the substrates 3,4-dichlorophenol and 3,4-dichloroaniline were subjected to LC-MS detection, and the results showed that oxygen glycosides and nitrogen glycosides corresponding to the substrates were generated. Figure 6 .
Claims
1. A gene of ScUGT, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.
1.
2. A gene encoding the glycosyltransferase ScUGT according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.
2.
3. A recombinant expression vector, characterized in that: The nucleotide sequence of the glycosyltransferase ScUGT gene according to claim 1 is recombinantly expressed to form a recombinant expression vector.
4. A recombinant bacterium, characterized in that: The recombinant expression vector according to claim 3 is transformed into a host cell to form a recombinant engineered bacterium.
5. The host cell according to claim 4 is Escherichia coli, preferably Escherichia coli E. coli BL21(DE3).
6. A method for cloning and expressing a glycosyltransferase ScUGT gene, characterized in that: The method comprises the following steps: (1) Using the cDNA obtained by reverse transcription of total RNA of Malan as a template, amplifying by PCR the gene fragment of the glycosyltransferase ScUGT according to claim 1; (2) cloning the target gene fragment obtained in step (1) into an expression vector to form a recombinant expression vector, then transferring the recombinant expression vector into a prokaryotic expression system for heterologous expression, and finally purifying to obtain the glycosyltransferase ScUGT.
7. Amplify the glycosyltransferase ScUGT gene according to claim 6, the primer pair sequence is: ScUGT-F: ATGGCCGATGATTCCCAAAC; ScUGT-R: ATGATTCCCCACTCCACTCG.
8. Amplification of the cloning expression method according to claim 6, characterized in that: The target gene fragment obtained in step (1) is integrated into an expression vector to form a recombinant expression vector. The specific method includes introducing restriction endonuclease cutting sites (EcoRⅠ, HindⅢ) at both ends of the target gene fragment, then double-digesting the expression vector, connecting the target gene and the expression vector, and obtaining a recombinant expression vector.
9. The method for preparing the glycosyltransferase ScUGT according to claim 2, characterized in that: The host cell according to claim 4 is cultured to obtain the glycosyltransferase ScUGT.
10. The use of the bifunctional glycosyltransferase ScUGT according to claim 1, characterized in that: When UDP-glucose is used as the sugar donor, it catalyzes the production of oxygen glycosides and nitrogen glycosides.