A maize dwarfing gene br2-d2308, its molecular marker and application

Abstract

The present invention discloses a maize dwarfing gene br2-d2308, its molecular marker and application, which relates to the technical field of maize breeding. The br2-d2308 gene is obtained by mutating the 1276th base of the 5th exon of the maize Br2 gene from G to A, and the nucleotide sequence of the 5th exon of the br2-d2308 gene is as shown in SEQ ID NO.1. The research of the present invention finds that the plant height and ear height of the mutant d2308 are significantly reduced compared with the wild type B73, and the mutant d2308 has less yield loss compared with other maize dwarf mutants and has no obvious other adverse traits. The br2-d2308 gene can be used to create high-yield maize new varieties with lodging resistance, dwarfing and density tolerance and to improve existing varieties, which has important breeding application value. The present invention also develops a dCAPS marker based on the maize br2-d2308 gene. This dCAPS marker can effectively distinguish dwarf-improved and non-dwarf maize plants and can improve the genetic improvement efficiency of dwarf and density-tolerant maize varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of maize breeding, and particularly relates to a maize dwarfing gene br2-d2308, its molecular marker and application. Background Art

[0002] Maize is an important food, feed and industrial raw material crop in China. With the rapid development of animal husbandry and processing industries, its demand shows an increasing trend. The improvement of maize yield per unit area is closely related to the planting density. Compared with developed foreign countries, the maize planting density in China is generally low, which severely restricts the improvement of maize yield per unit area. Plant height is one of the key plant type traits determining maize planting density. Dwarf breeding can enable plants to maintain better photosynthesis efficiency and lodging resistance under high-density planting conditions. Identifying excellent dwarf genes and carrying out the breeding, selection, promotion and application of new dwarf varieties are important ways to increase maize planting density and yield per unit area.

[0003] Plant height belongs to a complex quantitative trait controlled by multiple genes. More than 60 maize dwarf genes have been reported at home and abroad. These genes are mainly involved in processes such as the synthesis, metabolism and signal transduction of different types of hormones, including Gibberellin (GA), Auxin (IAA), Brassinosteroids (BR), etc. Among the reported dwarf genes, those that can be directly applied to maize dwarf breeding are still few. The main reasons are that many of these genes show an excessive reduction in plant height or even extreme dwarfing, large yield losses, and more linked burdens of unfavorable traits. Using biological breeding technologies such as gene mutagenesis and gene editing to discover excellent dwarf genes and excellent allelic variations of known functional genes is an important research content of current dwarf breeding.

[0004] Auxin is a very important class of plant hormones, and its synthesis, metabolism, signal transduction, and polar transport are encoded by a multigene family. Brachytic2 (Br2) is the first dwarf gene discovered in maize. This gene plays an important role in the auxin transport process. Its functional loss leads to abnormal polar transport of auxin in the internode meristem, which inhibits cell elongation. The main characteristics of Br2 gene-related mutants are a significant reduction in plant height, especially the shortening of internodes below the ear. Due to its small impact on yield, it has become one of the dwarf genes with great potential for breeding applications. In recent years, multiple allelic variations of Br2 have been discovered using various technologies and methods, and these mutants also show different phenotypes. In previous studies, we also screened an allelic mutation d129 (patent number CN202210885719.2) of the Br2 gene through EMS mutagenesis. Its plant height and ear height were significantly reduced, and the field plant type was excellent, but it had a significant impact on grain weight and yield. Therefore, further creation and selection of excellent allelic variations of Br2 will provide excellent genetic resources for corn dwarf breeding, and significantly promote the improvement of corn planting density and yield level. Summary of the invention

[0005] The purpose of the present invention is to provide a maize dwarfing gene br2-d2308 and its molecular marker and application. The present invention achieves the above purpose through the following technical solutions:

[0006] The invention provides a corn dwarfing gene br2-d2308. The br2-d2308 gene is obtained by mutating the 1276th base of the 5th exon of the corn Br2 gene from G to A, and the mutation causes the encoded amino acid to mutate from glycine (G) to arginine (R). The nucleotide sequence of the 5th exon of the br2-d2308 gene is shown in SEQ ID NO.1.

[0007] The present invention also provides an application of a corn dwarfing gene br2-d2308 in corn molecular breeding.

[0008] A further improvement is to hybridize and backcross the corn germplasm to be improved with the corn germplasm containing the corn dwarfing gene br2-d2308, screen the offspring containing the relevant traits of the corn germplasm to be improved and the corn dwarfing gene br2-d2308, and obtain new dwarfed improved corn germplasm.

[0009] A further improvement is that, using gene editing technology, the 1276th base of the 5th exon of the Br2 gene in the genome of the corn to be improved is mutated from G to A, so as to obtain a dwarf strain of the corn germplasm to be improved.

[0010] The present invention also provides a molecular marker based on the maize dwarfing gene br2-d2308. The molecular marker is a dCAPS marker, and the dCAPS marker includes amplification primers for amplifying a nucleotide sequence containing the 1276th base of the 5th exon of the maize Br2 gene, and the base type at the 1276th position is G / A;

[0011] It also includes a restriction endonuclease for verifying the base type.

[0012] A further improvement lies in that the restriction endonuclease is ApaI.

[0013] A further improvement lies in that the nucleotide sequence of the amplification primers is as follows:

[0014] SEQ ID NO.7: M2308-F: 5'-TGCTGCAGAAGATGTTCATGAAGG-3';

[0015] SEQ ID NO.8: M2308-R: 5'-CCGTAGCCGCTGCCGGCGATGGGCC-3'.

[0016] The present invention also provides an application of the above-mentioned molecular marker in the assisted breeding of dwarf maize varieties.

[0017] A further improvement lies in that using the genomic DNA of the maize germplasm to be tested as a template, PCR amplification of the target sequence is carried out using the amplification primers of the dCAPS marker. The PCR amplification product is digested with the restriction endonuclease ApaI, and genotyping detection is carried out on the digested product to obtain the molecular marker type of the maize germplasm to be tested;

[0018] The plant height of the maize germplasm or variety to be tested with the molecular marker type of A is significantly shorter than that of the maize plant to be tested with the molecular marker type of G.

[0019] The present invention has the following beneficial effects: By analyzing the plant types of the mutant d2308 and the wild-type B73 plants, it can be found that the plant height of the mutant d2308 is significantly lower than that of the wild-type B73, and the plant type is compact. In addition, compared with some other maize dwarf mutants, the mutant d2308 of the present invention has very little yield loss and fewer adverse traits. The br2-d2308 gene can be used to create high-yield maize varieties with lodging resistance, dwarfing, and density tolerance, as well as to improve existing varieties, which has important breeding application value. In addition, the present invention also developed a dCAPS marker based on the maize dwarfing gene br2-d2308. The amplified products obtained by PCR amplification with the amplification primers of the dCAPS marker were electrophoretically detected after enzymatic digestion. The band patterns between the control plants and the dwarf mutants were significantly different, indicating that the dCAPS marker can effectively distinguish dwarf-improved and non-dwarf maize plants, and can improve the efficiency of genetic improvement of dwarf and density-tolerant maize germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 For phenotypic analysis of the dwarf mutant d2308 ( Figure 1 A shows the phenotypic analysis of the B73 maize inbred line and the dwarf mutant d2308; Figure 1 B-C show the comparison of plant height and ear height of B73 and d2308, respectively; Figure 1 D shows the comparison of the stem diameter of the third internode above the ground of B73 and d2308; Figure 1 E-G show the comparison of leaf length, leaf width, and leaf angle of B73 and d2308, respectively; where S: ear leaf; S+1: the first leaf above the ear; S-1: the first leaf below the ear; S+5: the second leaf from the top).

[0021] Figure 2 For analysis of yield-related traits of the dwarf mutant d2308 ( Figure 2 A shows the comparison of ear phenotypes of the B73 maize inbred line and the dwarf mutant d2308; Figure 2 B shows the comparison of kernel length (I), kernel width (II), and kernel thickness (III) phenotypes of B73 and d2308; Figure 2 C-J show the statistics of ear length, number of kernels per row, ear kernel weight, seed setting rate, 100-kernel weight, kernel thickness, kernel length, and kernel width of B73 and d2308 in sequence).

[0022] Figure 3 For gene mapping of the d2308 dwarf mutant ( Figure 3 A shows the gene mapping analysis of the d2308 mutant; Figure 3 B shows the analysis of the mutation positions of d2308 and the br2 mutant; Figure 3 C shows the sequencing analysis of the mutation sites of d2308 and the br2 mutant).

[0023] Figure 4Allelic verification of the dwarf mutant effector gene br2-d2308( Figure 4 A shows the phenotypic comparison of B73, d2308, d2308×br2, and br2 plants; Figure 4 B shows the statistical analysis of plant height; Figure 4 C shows the statistical analysis of ear height; Figure 4 D shows the statistical analysis of the height of the last internode (including tassel length);

[0024] Figure 5 Sequence analysis for the development of dCAPS markers based on the br2-d2308 gene (in the figure, B73-Ref is the B73 maize reference genome sequence; B73-dCAPS is the amplified sequence for the development of B73 maize dCAPS markers; d2308-dCAPS is the amplified sequence for the development of dCAPS markers for the d2308 mutant);

[0025] Figure 6 Electrophoresis analysis for the development of dCAPS markers based on the br2-d2308 gene (in the figure, M: DNA Marker 500, and the band sizes from top to bottom are 500, 400, 300, 200, 150, 100, and 50 bp in turn; 1: Electrophoresis of the amplification product of B73 before digestion; 2: Electrophoresis of the amplification product of the d2308 mutant before digestion; 3: Electrophoresis of the amplification product of B73 maize after digestion; 4: Electrophoresis of the amplification product of the d2308 mutant after digestion). Detailed implementation mode

[0026] The present application will be further described in detail below with reference to the accompanying drawings. It is necessary to point out here that the following specific implementation modes are only used to further illustrate the present application and cannot be understood as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0027] 1. Materials

[0028] 1.1 The maize dwarf mutant d2308 used in this experiment was created by EMS mutagenesis, and the preservation number is CCTCC NO: P202426. The br2 mutant is a loss-of-function mutant of the reported Br2 gene (Zhao et al. An EMS-induced allele of the brachytic2 gene can reduce plant height in maize. Plant Cell Rep. 2023, 42(4): 749-761).

[0029] 1.2 The B73 maize inbred line used in this experiment is preserved by the National and Local Joint Engineering Laboratory of Crop Stress Resistance Breeding and Disaster Reduction, College of Life Sciences, Anhui Agricultural University.

[0030] All reagents used in this experiment are conventional reagents unless otherwise specified, and are prepared with deionized water. All instruments used are conventional laboratory instruments. The methods used in this experiment are conventional methods known to those skilled in the art unless otherwise specified.

[0031] 2. Method

[0032] 2.1 Creation of Maize EMS Mutants

[0033] The maize inbred line B73 was bagged with kraft paper bags after the emergence of the female ear. At the peak of pollen shedding, fresh pollen was collected and the anthers were filtered through a sieve. The ethyl methane sulfonate (EMS) stock solution was added to mineral oil at a ratio of 1:1000 to prepare a working solution. The pollen and the EMS working solution were evenly mixed at a ratio of about 1:10 (V / V), and left to stand in the dark for 40 min, with gentle shaking every 10 min. The above pollen mixture was evenly applied to the maize silk with a writing brush or a small brush, and the female ear was bagged again and marked. After the ear matured, the M1 generation seeds were harvested. The M1 seeds were sown individually and self-crossed to obtain the M2 generation. 20 - 40 grains were randomly selected from the M2 generation ears for single-grain single-row sowing and phenotypic screening.

[0034] Among the M2 progeny plants with phenotypic variations identified, the plant height and ear height of 1 plant were significantly reduced, the ear setting was good, and there were no obvious other adverse traits. After self-crossing the dwarf individual plant and planting it in a uniform experimental field with the maize inbred line B73, it was found that it still showed the dwarf trait. After backcrossing the dwarf individual plant and continuously self-crossing for 2 generations, the dwarf phenotype could still be stably inherited, indicating that the dwarf trait of this plant might be caused by a gene mutation induced by EMS. The dwarf mutant maize seeds Zea mays L. d2308 obtained by EMS mutagenesis were registered and preserved at the China Center for Type Culture Collection. The preservation address is on the campus of Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation date is October 9, 2024, and the preservation number is CCTCC NO: P202426.

[0035] 2.2 Phenotypic Analysis and Yield Trait Analysis of Dwarf Mutant d2308

[0036] 2.2.1 The dwarf mutant d2308 obtained in step 2.1 above was systematically compared with the phenotype of maize B73, such as Figure 1As shown, compared with the B73 plants, the plant height and ear height of d2308 decreased by about 31.8% and 51.5% respectively, and the reduction in ear height was greater. The leaf length of the dwarf mutant d2308 was significantly reduced compared with that of the B73 plants, the leaf width was significantly increased, the leaf angle of the second-to-last leaf was significantly reduced, and the leaf angles of the first leaf above the ear and the first leaf below the ear increased to a certain extent. At the same time, the stem diameter of the third internode above the ground of the d2308 plants increased significantly, indicating that the lodging resistance and density tolerance of the dwarf mutant d2308 may be significantly improved.

[0037] 2.2.2 Analyze the related traits such as the yield per plant of the B73 inbred line and the dwarf mutant d2308 obtained in the above step 2.1 to further analyze its potential for increasing density and yield. As Figure 2 shown, compared with the B73 inbred line, the ear length, grain length, and grain thickness of d2308 decreased to varying degrees, the grain width increased significantly, but there was no significant difference in the 100-grain weight between B73 and d2308, and there was also no significant difference in the seed setting rate. Further analyze the grain weight of the ears per plant of d2308 and B73, and the yield loss per plant of d2308 was about 5.7%. Therefore, when the plant height of d2308 decreased significantly, its yield loss was small, and it had great potential for application in dwarf breeding to increase density and yield.

[0038] 2.3 Genetic law analysis of the dwarf mutant d2308

[0039] To analyze whether the dwarf mutant d2308 was caused by a single-gene mutation, the dwarf mutant d2308 obtained in step 2.1 was crossed with B73 to obtain F1-generation plants, and an F2-generation segregation population was constructed by self-crossing. The F2 population was sown single-grain in a uniform experimental field, and the segregation ratio was analyzed with plant height as the main trait 10 - 15 days after pollination. By counting the F2-generation segregation population in the field, among 106 plants, 28 dwarf plants with a phenotype similar to d2308 appeared. After chi-square test (χ 2 = 0.11 < χ 2 0.05 = 3.84), it conformed to the theoretical segregation ratio of 3:1, indicating that the dwarf phenotype of d2308 was controlled by a recessive single gene.

[0040] 2.4 Gene mapping of the d2308 mutant

[0041] The plants with the d2308 dwarf phenotype in the F2 population in Step 2.3 above were used for individual leaf sampling. Genomic DNA of 19 individual plants was extracted and its quality was detected. After passing the quality inspection, the extracted individual genomic DNAs were mixed in equal mass and proportion to construct a library, and then BSA high-throughput sequencing was carried out. Quality control analysis was performed on the sequenced data. The filtered sequencing reads were aligned and assembled with the maize B73 genome (V4.32), and the mutated SNP sites were analyzed. Using the optimized Mutmap localization analysis program package, SNP sites of mutant effect genes were screened. SNP screening was carried out according to the G->A (C->T) base mutation mode and the SNP-Index = 1.0 standard, and the variant types of the screened SNPs were analyzed, including premature transcriptional termination / termination loss, splice site donor / acceptor, start codon ATG gain / loss, non-synonymous mutation, etc. At the same time, a corresponding relationship diagram between the average SNP-Index value in the 3Mb interval and the chromosome position was drawn to screen for major SNP sites.

[0042] According to the above analysis method, a significant signal peak was found on maize chromosome 1 ( Figure 3 A). Annotation analysis was carried out on the SNP sites screened in this interval and their corresponding genes. One SNP site in this interval met the screening criteria of SNP-Index = 1.0 and the G->A (C->T) base mutation mode, and this SNP site occurred at the 1276bp position of the 5th exon of the Br2 gene (as Figure 3 shown in B), with a mutation from G to A, resulting in a mutation from glycine (G) to arginine (R). The Br2 gene has been reported to affect plant height development regulation. Further combining with the dwarf phenotype characteristics of d2308, it is speculated that the mutation at this site may be the d2308 effect mutation site. To further verify the authenticity of the mutation at this site, specific primers were designed on both sides of the mutation site, and the BSA sequencing DNA samples were subjected to pooled PCR amplification using Primer STAR Max Premix (2×), with B73 plants as a control at the same time;

[0043] The primers for PCR amplification are as follows:

[0044] SEQ ID NO.3: d2308-F: 5'-GGGGTTCGTCCTCCAGTG-3';

[0045] SEQ ID NO.4: d2308-R: 5'-GGCTCCACCTCCGTCTTG-3'.

[0046] The sample loading system for PCR amplification is shown in Table 1:

[0047] Table 1 Sample loading system for PCR

[0048]

[0049] The reaction procedure for PCR amplification was as follows: denaturation at 98°C for 5 min; denaturation at 98°C for 10 sec, annealing at 59°C for 15 sec, extension at 72°C for 30 sec, for 35 cycles; extension at 72°C for 10 min, and preservation at 4°C. The PCR-amplified fragments were detected by 2.0% agarose gel electrophoresis and then subjected to sequencing analysis. The sequencing results were analyzed using Sequencher software, and it was found that a homozygous mutation from G to A occurred at the predicted mutation position (as Figure 3 shown in SEQ ID NO.1-2, the nucleotide sequence of the 5th exon of the Br2 gene in the dwarf mutant d2308 was as shown in SEQ ID NO.1, and the nucleotide sequence of the 5th exon of the Br2 gene in the wild type B73 was as shown in SEQ ID NO.2), which proved the authenticity of the mutation site.

[0050] 2.5 Allelic verification of the dwarfing mutant effector gene br2-d2308

[0051] To further verify that the mutation occurring in the 5th exon of the Br2 gene is the effector mutation site of the dwarf mutant d2308, another mutant of the Br2 gene (named the br2 mutant; Zhao et al. An EMS-induced allele of the brachytic2 gene can reduce plant height in maize. Plant Cell Rep. 2023, 42(4): 749-761) was used for allelic testing of gene function, and the detection primers were as follows:

[0052] SEQ ID NO.5: br2-F: 5'-CTCATCCGCATGCAGGAG-3';

[0053] SEQ ID NO.6: br2-R: 5'-CGAACATCTTCTCGCGCA-3'.

[0054] The detection results were as Figure 3 shown in Fig. C. The br2 mutant had a mutation from G to A in the 5th exon of the Br2 gene, resulting in premature termination of gene translation and a relatively significant dwarfing trait in the plants.

[0055] The mutant d2308 was crossed with the br2 mutant to obtain F1 generation plants. Then, the B73, d2308, br2, and F1 generation plants of d2308×br2 were planted in a uniform experimental field for phenotypic analysis of plant height, etc., as Figure 4As shown in the figure, among the four different types of germplasms of the Br2 gene, the plant height of the br2 mutant is the shortest. The plant height of the d2308 mutant is higher than that of br2, but significantly shorter than that of B73. The plant height phenotype of the F1 generation of d2308×br2 is more similar to that of d2308 and does not restore the plant height of B73, indicating that the mutation from G to A at the 5th exon of the Br2 gene is the effector mutation site of d2308.

[0056] 3. Development of dCAPS markers based on the br2-d2308 gene

[0057] Leaves of wild-type maize B73 plants and d2308 dwarf mutant plants at the three-leaf stage were taken, and their genomic DNAs were extracted separately using the CTAB method. After electrophoresis detection showed that the quality was qualified, they were used for subsequent PCR amplification and marker development. As Figure 5 shown, according to the gene mapping results of the d2308 dwarf mutant, dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html) was used to develop dCAPS markers for the d2308 mutation site. 25 bp sequences were taken at both ends of the d2308 mutation site and its corresponding site in B73, and were respectively input into the corresponding text boxes of the dCAPS Finder 2.0 website. According to the sequence analysis results and the characteristics of the restriction enzyme, the number of primer mismatches was set to 2 bases, and the restriction enzyme ApaI (GGGCCC) was selected for the design of specific primers. The amplified sequence length was 211 bp. Among them, the amplified sequence of wild-type maize B73 could be cut into (25 bp + 186 bp). The sequences of the amplification primers are as follows:

[0058] SEQ ID NO.7: M2308-F: 5'-TGCTGCAGAAGATGTTCATGAAGG-3';

[0059] SEQ ID NO.8: M2308-R: 5'-CCGTAGCCGCTGCCGGCGAT GG GCC-3' (underlined bases are mismatched bases).

[0060] 2×Accurate Taq Master Mix (dye plus) was used to amplify the genomes of B73 and d2308 respectively. The sample addition system for PCR amplification was referred to Table 1, and the amplification reaction procedure of PCR was as follows: pre-denaturation at 94°C for 5 min, denaturation at 98°C for 10 sec, annealing at 67°C for 30 sec, extension at 72°C for 20 sec, 35 cycles, and total extension at 72°C for 10 min. After the PCR reaction was completed, 3% agarose gel electrophoresis was used for detection, and it was found that the product size was consistent with the theoretical fragment size. The target band was cut out of the gel and recovered for later use.

[0061] The above-mentioned purified PCR products of B73 and d2308 were respectively ligated with the blunt T vector, and the ligation system is shown in Table 2:

[0062] Table 2 T vector ligation sample addition system

[0063]

[0064] After mixing, it was placed in a 25°C metal bath for 30 min to complete the ligation. The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method. Single colonies were picked and cultured, and then sent to a biological company for sequencing verification.

[0065] The purified PCR products of B73 and d2308 were respectively digested with ApaI, and the sample addition system is shown in Table 3:

[0066] Table 3 Restriction enzyme digestion sample addition system

[0067]

[0068] After mixing, it was placed in a 37°C metal bath for 30 min. Then, using the PCR products of B73 and d2308 without restriction enzyme digestion as controls, 3% agarose gel electrophoresis was used for detection. As Figure 6 shown, the electrophoresis results showed that the migration speed of the PCR product amplified using the B73 genomic DNA as a template was significantly faster after digestion (lane 3) than that of d2308 (lane 4), while there was no significant difference between the two PCR products before digestion, indicating that the dCAPS marker development was successful and could be applied to marker-assisted selection in dwarfing improvement breeding.

[0069] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A maize dwarfing gene br2-d2308 , characterized in that The said br2-d2308 gene is from maize Br2 and is obtained by mutating the 1276th base of the 5th exon of the gene from G to A. The br2-d2308 nucleotide sequence of the 5th exon of the gene is shown in SEQ ID NO.

1.

2. Application of the maize dwarfing gene as described in claim 1 br2-d2308 in maize molecular breeding, characterized in that The application is to hybridize and backcross the maize germplasm to be improved with the maize germplasm containing the maize dwarfing gene br2-d2308 to screen for the offspring that contain the relevant traits of the maize germplasm to be improved and the maize dwarfing gene br2-d2308 and obtain a new maize germplasm with dwarfing improvement.

3. Application of the maize dwarfing gene as described in claim 1 br2-d2308 in maize molecular breeding, characterized in that The application is to use gene editing technology to mutate the 1276th base of the 5th exon of the Br2 gene from G to A in the genome of the maize to be improved, so as to obtain a dwarf strain of the maize germplasm to be improved.

4. A molecular marker based on the maize dwarfing gene as described in claim 1 br2-d2308 , characterized in that The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 1276th base of the nucleotide sequence is A or G.

5. Use of a molecular marker as described in claim 4 in assisting the breeding of dwarf maize varieties, characterized in that, Design specific amplification primers using the sequence composed of the locus where the molecular marker is located and the upstream and downstream bases as the target sequence. Using the genomic DNA of the maize germplasm to be tested as a template, perform PCR amplification with the specific amplification primers to obtain the amplification product, the PCR amplification product. The PCR amplification product is digested with a restriction endonuclease ApaI for digestion, and the digested product is subjected to genotyping detection to obtain the molecular marker type of the maize germplasm to be tested; The plant height of the maize germplasm or variety to be tested with the molecular marker type A is significantly shorter than that of the maize plant to be tested with the molecular marker type G; The nucleotide sequence of the specific amplification primer is: SEQ ID NO.7: M2308-F: 5'- TGCTGCAGAAGATGTTCATGAAGG -3'; SEQ ID NO.8: M2308-R: 5'- CCGTAGCCGCTGCCGGCGATGGGCC -3'.

Images