Nucleic acid fragment, coxsackie virus replicon and pseudovirus thereof, and application thereof

Abstract

The present invention relates to the field of biotechnology, and in particular to nucleic acid fragments, coxsackie virus replicons and pseudoviruses thereof, and applications thereof. The nucleic acid fragments realize effective fusion replication of genes such as BSD, hGluc, and EMCV IRES by combining appropriate linking fragments and cutting fragments with base mutations of 5'UTR, without affecting the replication efficiency of the replicons, and solving the problem that the traditional CVB3 replicons cannot be effectively screened and the detection is cumbersome. The virus constructed using the replicons is easy to detect, and the sensitivity is greatly improved. Moreover, the test can be carried out in a conventional laboratory, and the real virus can be completely simulated, which has a very broad space in large-scale screening of antibodies, and has higher detection efficiency (increased by about 50 times), sensitivity and convenience. It provides an extremely important research tool for laboratory research on the pathogenic mechanism of CVB3, industrial anti-CVB3 drug screening and vaccine development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to nucleic acid fragments, Coxsackie virus replicons and pseudoviruses thereof, and applications thereof. Background Art

[0002] Coxsackie B group 3 (CVB3) is the most common pathogen causing viral myocarditis. Children are at high risk of viral myocarditis, which can lead to acute heart failure, ventricular arrhythmia or cardiogenic shock in severe cases. The mortality rate of children caused by fulminant viral myocarditis is as high as 90%, and 12% of sudden cardiac death in young people is related to viral myocarditis. Viral myocarditis is also an important predisposing factor for dilated cardiomyopathy (DCM), which seriously threatens human health. However, there is currently no specific therapeutic drug for viral myocarditis. Finding drugs that target and inhibit CVB3 replication and clarifying its inhibitory mechanism are important for the effective treatment of viral myocarditis caused by CVB3 infection. However, at present, due to the fact that CVB3 virus can only be operated in biosafety level 2 and above laboratories, the CVB3 drug screening system is cumbersome, and the sensitivity and large-scale operability are limited, there is currently a lack of effective large-scale CVB3 drug screening systems.

[0003] The CVB3 subgenomic replicon is a CVB3 structural protein VP1, VP2, VP3 and VP4 removed, leaving only the non-structural proteins and 5'UTR, 3'UTR and other replication components used by the virus for replication. It can be operated in a general biological laboratory. Since its establishment, the viral replicon has been widely used in large-scale targeted drug screening. Through the construction of the hepatitis C virus subgenomic replicon, humans have successfully screened direct antiviral small molecule drugs that inhibit the replication of hepatitis C virus, and successfully controlled the hepatitis C virus, saving a large number of patients infected with hepatitis C virus. However, unfortunately, the existing CVB3 subgenomic replicons are not good in terms of detection efficiency, detection sensitivity, and detection performance, and cannot be used for large-scale anti-CVB3 drug screening.

[0004] The present invention transforms the traditional method of constructing CVB3 subgenomic replicon, selects appropriate insertion sites, adds genes such as BSD, hGluc, EMCV IRES and performs effective fusion, so that the CVB3 replicon is easy to screen and detect, and the detection efficiency of the CVB3 replicon is greatly improved. The replication efficiency of the modified CVB3 replicon is about 50 times higher than that of the CVB3 subgenomic replicon constructed by the existing traditional method. The CVB3 trans-packaged pseudoviral particles constructed in combination with the present invention can be used for anti-CVB3 drug screening on a large scale in the industry. It provides an extremely important research tool for laboratory research on the pathogenic mechanism of CVB3, industrial anti-CVB3 drug screening and vaccine research and development. Summary of the invention

[0005] In view of this, the present invention provides nucleic acid fragments, Coxsackie virus replicons and pseudoviruses thereof, and applications thereof.

[0006] Includes reporter gene, linker fragment 1, screening gene, linker fragment 2, IRES gene and cleavage fragment;

[0007] The linker fragment 1 has a nucleic acid fragment as shown in SEQ ID NO: 1 or a nucleic acid sequence having at least 80% homology thereto;

[0008] The linker fragment 2 has a nucleic acid fragment as shown in SEQ ID NO: 2 or a nucleic acid sequence having at least 80% homology thereto;

[0009] The cleavage fragment has a nucleic acid sequence as shown in SEQ ID NO: 3 or a nucleic acid sequence having at least 80% homology thereto.

[0010] In the present invention, the nucleic acid fragments include sequentially linked link fragment 1, BSD fragment, link fragment 2, IRES gene and cleavage fragment.

[0011] The invention selects the specific link fragment 1, link fragment 2 and cutting fragment through screening and optimization, fuses the screening gene, the reporter gene and the internal ribosome entry site gene (EMCV IRES) of the encephalomyocarditis virus for increasing the transcription efficiency, effectively avoids the influence of the insertion of the above-mentioned genes on the replication, realizes the effective fusion replication of genes such as BSD, hGluc and EMCV IRES, greatly enhances the replication efficiency of the replicon, and realizes the efficient replication of the CVB3 subgenomic replicon. According to research, the nucleic acid fragment has a certain enhancement effect in other Coxsackievirus types.

[0012] In some embodiments, the IRES gene (internal ribosome entry site gene) is derived from encephalomyocarditis virus, referred to as EMCV IRES gene. In some specific embodiments, the EMCV IRES gene has a sequence shown in any of the following:

[0013] 1) the nucleic acid sequence shown in SEQ ID NO: 4;

[0014] 2) A nucleic acid sequence having the same or similar function as 1) obtained by replacing, deleting, adding or modifying one or more bases in the nucleic acid sequence shown in 1);

[0015] 3) A nucleic acid sequence having at least 80% homology with the sequence shown in 1) or 2).

[0016] In some embodiments, the screening gene includes a BSD gene. In some specific embodiments, the screening gene is a Blasticidin S HCl screening gene, i.e., a BSD gene. Further, the BSD gene has a nucleic acid sequence as shown in SEQ ID NO: 5 or a nucleic acid sequence having at least 80% homology thereto.

[0017] In some embodiments, the reporter gene includes hGluc gene (secreted fluorescein hGluc gene), GFP gene, EGFP gene, YFP gene, RFP gene, mCherry gene, Nluc gene, etc. In some specific embodiments, the reporter gene is hGluc gene, which has a nucleic acid sequence as shown in SEQ ID NO: 6 or a nucleic acid sequence having at least 80% homology thereto.

[0018] The present invention also provides a viral replicon, comprising: a promoter, the nucleic acid fragment of the present invention as described above, and a viral non-structural protein gene.

[0019] In some embodiments, the replicon further comprises 3'UTR and / or 5'UTR. In some embodiments, the replicon of the present invention comprises a promoter, a 5'UTR, a nucleic acid fragment of the present invention, a viral non-structural protein gene and a 3'UTR in sequence, that is, the replicon comprises a promoter, a 5'UTR, a reporter gene, a linker fragment 1, a BSD fragment, a linker fragment 2, an IRES gene, a cleavage fragment, a viral non-structural protein gene and a 3'UTR in sequence.

[0020] The 3'UTR and / or 5'UTR are derived from the virus. The specific sequences of the 3'UTR and / or 5'UTR are determined according to the prepared viral replicon. For example, when preparing the Coxsackievirus CVB3 replicon, the 3'UTR and 5'UTR are the 3'UTR and 5'UTR of the CVB3 strain.

[0021] In some embodiments, the replicon of the present invention is a coxsackie virus replicon, wherein the coxsackie virus includes CVB1, CVB2, CVB3, CVB4, CVB5 or CVB6 type virus.

[0022] The non-structural protein genes of the Coxsackievirus include sequentially linked 2A, 2B, 2C, 3A, 3B, 3C, and 3D genes.

[0023] In some embodiments, the promoter comprises a T7 promoter, a T3 promoter or an SP6 promoter.

[0024] In the present invention, the replicon also includes a PolyA fragment. The present invention has no special requirements for the specific length of the PolyA fragment, and any common length in the art can be used. In some specific embodiments, the length of the PolyA fragment is 15bP to 40bP, specifically 20bP, 25bP, 30bP, 35bP, 40bP; in a specific embodiment of the present invention, the PolyA fragment is a fragment composed of 30 A.

[0025] In some specific embodiments, the present invention specifically takes the CVB3 virus with a deposit number of CGMCC NO.26797 as an example, and uses the strain and the nucleic acid fragment described in the present invention to construct a CVB3 replicon, which is referred to as the CVB3 subgenomic replicon herein, also known as SgCVB3-CI-sGluc-EMCV.IRES-BSD. The SgCVB3-CI-sGluc-EMCV.IRES-BSD includes sequentially connected: promoter, 5'UTR, hGluc gene, link fragment 1, BSD gene, link fragment 2, EMCV IRES gene, cleavage fragment, viral non-structural protein gene and 3'UTR. Among them, the promoter, hGluc gene, link fragment 1, BSD gene, link fragment 2, EMCV IRES gene, and cleavage fragment are as described above, and will not be repeated one by one. The viral non-structural protein gene and 3'UTR are from the CVB3 virus of CGMCCNO.26797.

[0026] The present invention transforms the 5'UTR sequence, and the 5'UTR before the transformation is the 5'UTR sequence of the CVB3-CI virus with the deposit number of CGMCC NO.26797 (SEQ ID NO: 7). Based on the 5'UTR sequence, the present invention mutates the base C at position 455 to G. The transformed 5'UTR has a nucleic acid sequence as shown in SEQ ID NO: 8 or a nucleic acid sequence having at least 80% homology thereto. The results show that the structure of the 5'UTR transformed by the present invention is stable enough, which is conducive to the replication of the replicon and the reproduction of the virus.

[0027] The present invention verifies the effects of 5'UTR modification and modification of the nucleic acid fragment on the replication efficiency of the replicon and the inhibition multiple of the drug screening. The results show that the modification greatly enhances the replication efficiency of the replicon, realizes the efficient replication of the CVB3 subgenomic replicon, and greatly simplifies the detection efficiency.

[0028] The present invention also provides a recombinant vector, including a vector backbone, and the nucleic acid fragment of the present invention or the replicon of the present invention. The present invention has no special restrictions on the vector backbone, and any commercial eukaryotic in vitro transcription vector commonly used in the art can be used, such as Bio-Tech's pT3 / SP6 / T7-RNA-Template (RNA in vitro transcription plasmid, item number: D2310);

[0029] pRNA-T3-T7 (RNA in vitro transcription plasmid, item number D2312), pRNA-SP6-T7 (RNA in vitro transcription plasmid, item number D2314). In a specific embodiment of the present invention, the vector backbone includes pRNA-T3-T7.

[0030] The present invention also provides a trans-packaged Cassage virus group B type 3, which is packaged by packaging cells using the recombinant vector of the present invention and a recombinant vector expressing CVB3 structural protein.

[0031] In some embodiments, the packaging cells include 293T cells or Hela cells.

[0032] The present invention also provides a host, which is transfected with the recombinant vector of the present invention.

[0033] The present invention also provides a CVB3 trans-packaging pseudovirus system, comprising the recombinant vector of the present invention, an auxiliary plasmid containing the CVB3 virus structural gene, and a packaging cell.

[0034] The present invention also provides the use of any one of the following 1)~ in the preparation of a vaccine for preventing and / or treating coxsackievirus infection or a disease caused by coxsackievirus infection, or in the evaluation of the immunogenicity and / or protectiveness of a coxsackievirus vaccine for non-diagnostic and therapeutic purposes, or in the screening of anti-CVB3 drugs:

[0035] 1), the nucleic acid fragment of the present invention;

[0036] II), the replicon of the present invention;

[0037] III), the recombinant vector of the present invention;

[0038] VI), the pseudovirus of the present invention;

[0039] V), the host of the present invention;

[0040] VI) The CVB3 trans-packaging pseudovirus system described in the present invention.

[0041] Studies have shown that compared with the replicon of comparative example 1 constructed by the traditional method, the replicon of the present invention has higher detection efficiency (increased by about 50 times), sensitivity and convenience, and is more conducive to screening drugs that inhibit CVB3 replication (the inhibitory effect is increased by 30 times). The drug screening effect of the pseudovirus constructed using the replicon of the present invention is better (the screening effect is increased by about 20 times).

[0042] The replication efficiency of the CVB3 subgenomic replicon SgCVB3-CI-sGluc-EMCV.IRES-BSD prepared using the nucleic acid fragment described in the present invention is about 50 times higher than that of the replicon in comparative example 1 in HEK-293T cells; at the same time, compared with the traditional CVB3 subgenomic replicon that cannot be effectively screened and the cumbersome detection problem, the detection efficiency is greatly simplified.

[0043] The present invention provides a nucleic acid fragment, a Coxsackie virus replicon and a pseudovirus thereof, and an application thereof. The nucleic acid fragment is combined with a base mutation of 5'UTR by a suitable linking fragment and a cutting fragment, and the prepared replicon realizes effective fusion replication of genes such as BSD, hGluc, and EMCVIRES, greatly enhances the replication efficiency of the replicon, realizes efficient replication of the CVB3 subgenomic replicon, and solves the problem that the traditional CVB3 subgenomic replicon cannot effectively screen and detect cumbersome problems. The replicon constructed by the present invention has a higher inhibition multiple than the comparative example 1 replicon constructed by the traditional method for screening drugs that inhibit CVB3 replication, and the inhibition effect is improved by about 30 times, which is more suitable for screening drugs that inhibit CVB3 replication. The present invention successfully constructs CVB3 trans-packaging pseudovirus particles using the subgenomic replicon, and it is found that the CVB3 trans-packaging pseudovirus is successfully constructed using the CVB3 subgenomic replicon modified by the present invention, and the pseudovirus particles constructed by the comparative example 1 replicon using the traditional method have higher hGluc after infecting Hela cells. It can be further used to screen drugs for inhibiting the invasion process of CVB3 virus. Further verification found that: the CVB3 trans-packaged pseudovirus was successfully constructed using the CVB3 subgenomic replicon modified by the invention, and the pseudovirus particles constructed by the replicon of comparative example 1 using the traditional method had a higher drug inhibition multiple in screening the CVB3 entry stage, and the inhibition effect was about 20 times higher, which was more suitable for screening drugs that inhibit CVB3 Entry. And the present invention can be used to effectively distinguish whether the drug inhibits the CVB3 virus replication process or the invasion process. In short, the nucleic acid fragment provided by the present invention and the replicon constructed using the nucleic acid fragment have a very broad space for large-scale screening of anti-CVB3 drugs in industry. Compared with the replicon of comparative example 1 constructed by the traditional method, it has higher detection efficiency (increased by about 50 times), sensitivity and convenience, and is more conducive to screening drugs that inhibit CVB3 replication (the inhibition effect is increased by 30 times). The pseudovirus drug screening effect of the replicon constructed by the present invention is better (the screening effect is about 20 times higher). It provides an extremely important research tool for laboratory research on the pathogenic mechanism of CVB3, industrial anti-CVB3 drug screening and vaccine development. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1Schematic diagrams of the structures of the replicon (A) of Comparative Example 1 and the replicon (B) of the present invention are shown;

[0045] Figure 2 Schematic diagrams showing the specific construction of the replicon (A) of Comparative Example 1 and the replicon (B) of the present invention;

[0046] Figure 3 Schematic diagram of the sequence and structure of the 5'UTR of the replicon (A) of Comparative Example 1 and the replicon (B) of the present invention;

[0047] Figure 4 The hGluc contents of the replicon of the present invention and the replicon of Comparative Example 1 in HEK-293T cells are shown;

[0048] Figure 5 The hGluc contents of the replicon of the present invention and the replicon of Comparative Example 1 in Vero cells are shown;

[0049] Figure 6 The inhibition folds of the replicon of the present invention and the replicon of Comparative Example 1 are shown;

[0050] Figure 7 Schematic diagram of constructing a CVB3 trans-packaging pseudovirus system using the replicon of the present invention, A is a schematic diagram of the structure of the replicon of the present invention, B is a schematic diagram of the structure of the pCMV-P plasmid, and C is a flow chart of trans-packaging pseudovirus particles;

[0051] Figure 8 The hGluc content after Hela cells were infected by CVB3 trans-packaged pseudovirus constructed by the replicon of the present invention and the replicon of Comparative Example 1;

[0052] Fig. 9 The inhibitory effect of bafilomycin A1 on the CVB3 trans-packaged pseudovirus of the present invention and the CVB3 trans-packaged pseudovirus of Comparative Example 1;

[0053] Fig.10 Schematic diagrams of the structures of the replicon of Comparative Example 2 (B) and the replicon of the present invention (A) and hGluc test results (C) are shown. DETAILED DESCRIPTION

[0054] The present invention provides nucleic acid fragments, coxsackie virus replicons and pseudoviruses thereof, and applications. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the above. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0055] Unless otherwise defined herein, scientific and technical terms related to the present invention shall have the meanings understood by those of ordinary skill in the art.

[0056] Furthermore, unless otherwise indicated herein, singular terms shall include pluralities and plural terms shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless expressly indicated otherwise.

[0057] In the present invention, the terms "include", "comprising" and "having" are used interchangeably, and are intended to indicate the inclusiveness of the solution, meaning that the solution may have other elements besides the listed elements. At the same time, it should be understood that the use of "include", "comprising" and "having" in this article also provides a "consisting of..." solution.

[0058] In the present invention, the term "and / or" includes the meanings of "and", "or" and "all or any other combinations of elements linked by the corresponding terms".

[0059] In the present invention, the term "nucleic acid" includes any compound and / or substance comprising a polymer of nucleotides. Each nucleotide is composed of a base, particularly a purine or pyrimidine base (i.e., cytosine (C), guanine (G), adenine (A), thymine (T) or uracil (U), a sugar (i.e., deoxyribose or ribose) and a phosphate group. Typically, nucleic acid molecules are described by a sequence of bases, whereby the bases represent the primary structure (linear structure) of the nucleic acid molecule. The sequence of bases is typically expressed as 5' to 3'. In this article, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA), including, for example, complementary DNA (cDNA) and genomic DNA, ribonucleic acid (RNA), particularly messenger RNA (mRNA), synthetic forms of DNA or RNA, and polymers comprising a mixture of two or more of these molecules. Nucleic acid molecules can be linear or circular. In addition, the term nucleic acid molecule includes both sense and antisense strands, as well as single-stranded and double-stranded forms.

[0060] The term "homology" herein can be calculated in the following manner: to determine the percentage of "homology" of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of the first and second amino acid sequences or nucleic acid sequences for optimal comparison or non-homologous sequences can be discarded for comparison purposes). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at this position.

[0061] The term "vector" or "plasmid vector" herein refers to a nucleic acid molecule capable of amplifying another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures as well as vectors that integrate into the genome of a host cell into which the vector has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0062] The term "host" or "host cell" herein refers to a cell into which an exogenous nucleic acid is introduced, including the offspring of such a cell. Host cells include "transformants" and "transformed cells", which include primary transformed cells and offspring derived therefrom, without considering the number of passages. Offspring may not be completely identical to the parent cell in nucleic acid content, but may contain mutations. Mutant offspring having the same function or biological activity as screened or selected in the initially transformed cell are included herein.

[0063] Based on a new coxsackievirus group B type 3 strain (named CVB3-CI) isolated in the early stage (deposit number CGMCC NO.26797), the present invention successfully constructed a CVB3-CI subgenomic replicon, which was named SgCVB3-CI-sGluc-EMCV.IRES-BSD in the present invention.

[0064] The SgCVB3-CI-sGluc-EMCV.IRES-BSD replicon of the invention avoids the influence of the insertion of genes such as BSD, hGluc, EMCV IRES, etc. on replication by adaptive base mutation of 5'UTR and addition of Blasticidin S HCl screening gene (BSD) for easy screening, Gaussia fluorescein detection gene (hGluc), internal ribosome entry site gene (EMCV IRES) of encephalomyocarditis virus for increasing transcription efficiency and the like, by finding suitable insertion sites of these genes, and at the same time, realizes effective fusion replication of genes such as BSD, hGluc, EMCV IRES, etc. through suitable linker genes, greatly enhances the replication efficiency of the replicon, and realizes the efficient replication of the CVB3 subgenomic replicon.

[0065] After testing, compared with the replicon of comparative example 1 constructed by the existing traditional method, the modified replicon SgCVB3-CI-sGluc-EMCV.IRES-BSD of the present invention has a replication efficiency of about 50 times in HEK-293T cells; at the same time, it solves the problem that the traditional CVB3 subgenomic replicon cannot be effectively screened and the detection is cumbersome. In the replicon of the present invention, the effective screening of the replication of the CVB3 subgenomic replicon is achieved by adding the BSD gene; the hGluc gene in the replicon of the present invention can be effectively secreted into the supernatant, and the replication efficiency of the replicon can be determined by only detecting the supernatant, which greatly simplifies the detection efficiency and avoids the cumbersome steps of the traditional CVB3 subgenomic replicon that requires cell lysis to detect fluorescein.

[0066] The present invention also detects the sensitivity of the modified replicon of the present invention to the drug anisomycin, and the result shows that, compared with the replicon of comparative example 1, the replicon of the present invention has a higher inhibition multiple for screening drugs that inhibit CVB3 replication, and the inhibition effect is improved by about 30 times, which is more suitable for screening drugs that inhibit CVB3 replication. The present invention also successfully constructs CVB3 trans-packaged pseudovirus particles using the subgenomic replicon, and finds that the CVB3 trans-packaged pseudovirus successfully constructed using the CVB3 subgenomic replicon of the present invention has higher hGluc after infecting Hela cells than the pseudovirus particles constructed using the traditional method. It can be further used to screen drugs for inhibiting the CVB3 virus invasion process.

[0067] Further verification found that: the CVB3 trans-packaged pseudovirus was successfully constructed using the modified CVB3 subgenomic replicon of the present invention, and the inhibition multiple of the drug that inhibits the CVB3 entry stage was higher than that of the pseudovirus particles constructed by the replicon of comparative example 1 using the traditional method, and the inhibition effect was improved by about 20 times, which is more suitable for screening drugs that inhibit CVB3 Entry. And the present invention can be used to effectively distinguish whether the drug inhibits the CVB3 virus replication process or the invasion process.

[0068] In summary, the CVB3 subgenomic replicon of the present invention has a very broad space for large-scale screening of anti-CVB3 drugs in industry. Compared with the replicon of comparative example 1, it has higher detection efficiency (increased by about 50 times), sensitivity and convenience, and is more conducive to screening drugs that inhibit CVB3 replication (the inhibitory effect is increased by 30 times). The pseudovirus drug screening effect constructed by the replicon of the present invention is better (the screening effect is increased by about 20 times). It provides an extremely important research tool for laboratory research on the pathogenic mechanism of CVB3, industrial anti-CVB3 drug screening and vaccine development.

[0069] Gene sequences involved in the present invention:

[0070] T7: TAATACGACTCACTATAggg (SEQ ID NO: 10).

[0071] Fluorescent luciferase NLUC sequence (SEQ ID NO: 11):

[0072] ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGC.

[0073] Linking fragment 1 (SEQ ID NO: 1):

[0074] AGATCTAACTTTGACCTTCTCAAGTTGGCCGGCGACGTCGAGTCCAACCCAGGGCCC.

[0075] Linking fragment 2 (SEQ ID NO: 2): AAAC.

[0076] Cleavage fragment (denoted as cleavage fragment 2 in the present invention) (SEQ ID NO: 3):

[0077] ATGACAATGACAAATACGGGCGCATTT.

[0078] EMCV IRES sequence (SEQ ID NO: 4):

[0079] AGACCACAACGGTTTCCCTCTAGCGGGATCAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATAATACC。

[0080] BCD gene (SEQ ID NO: 5):

[0081] ATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGAAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAA。

[0082] Fluorescein hGluc sequence (SEQ ID NO: 6):

[0083] ATGGGAGTCAAAGTTCTGTTTGCCCTGATCTGCATCGCTGTGGCCGAGGCCAAGCCCACCGAGAACAACGAAGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCGACCACGGATCTCGATGCTGACCGCGGGAAGTTGCCCGGCAAGAAGCTGCCGCTGGAGGTGCTCAAAGAGATGGAAGCCAATGCCCGGAAAGCTGGCTGCACCAGGGGCTGTCTGATCTGCCTGTCCCACATCAAGTGCACGCCCAAGATGAAGAAGTTCATCCCAGGACGCTGCCACACCTACGAAGGCGACAAAGAGTCCGCACAGGGCGGCATAGGCGAGGCGATCGTCGACATTCCTGAGATTCCTGGGTTCAAGGACTTGGAGCCCATGGAGCAGTTCATCGCACAGGTCGATCTGTGTGTGGACTGCACAACTGGCTGCCTCAAAGGGCTTGCCAACGTGCAGTGTTCTGACCTGCTCAAGAAGTGGCTGCCGCAACGCTGTGCGACCTTTGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGGGCCGGTGGTGAC。

[0084] 5' UTR before modification (SEQ ID NO: 7):

[0085] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGGCCTATTGGGCGCTAGCACTCT

[0086] GGTATCACGGTACCTTTGTGCGCCTGTTTTATATCCCCTCCCCCAACTGTAACTTAGAA

[0087] GTAACACACTCCGATCAACAGTCAGCGTGGCACACCAGCCATGTTTTGATCAAGCAC

[0088] TTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCG

[0089] TTCGTTATCCGGCCAACTACTTCGAAAAACCCAGTAACACCATAGAGGTTGCAGAGT

[0090] GTTTCGCTCAGCACTACCCCAGTGTAGACCAGGCCGATGAGTCACCGCATTCCCCAC

[0091] GGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCTATGGGGAAACCCATAGGACG

[0092] CTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAATCCTCCGG C CCC

[0093] TGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAACCAGAGGGCAGTGTGT

[0094] CGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTAT

[0095] TCCTATACTGGCTGCTTATGGTGACAATTGAGAGATTGTTACCATATAGCTATTGGATTG

[0096] GCCATCCGGTGTCTAATAGAGCTATTATATATCTCTTTGTTGGATTTATACCACTTAGCTTGAGAGAGGTTAAAACATTACAATTCATTGTTAAATTGAATACAACAAA。

[0097] 5’UTR modified (SEQ ID NO: 8):

[0098] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGGCCTATTGGGCGCTAGCACT

[0099] CTGGTATCACGGTACCTTTGTGCGCCTGTTTTATATCCCCTCCCCCAACTGTAACTTA

[0100] GAAGTAACACACTCCGATCAACAGTCAGCGTGGCACACCAGCCATGTTTTGATCAA

[0101] GCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGA

[0102] AAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCCAGTAACACCATAGAGGTTG

[0103] CAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGACCAGGCCGATGAGTCACCGCAT

[0104] TCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCTATGGGGAAACC

[0105] CATAGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAATC

[0106] CTCCGG G CCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAACCAG

[0107] AGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTC

[0108] CGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATTGTTACC

[0109] ATATAGCTATTGGATTGGCCATCCGGTGTCTAATAGAGCTATTATATATCTCTTTGTTG

[0110] GATTTATACCACTTAGCTTGAGAGAGGTTAAAACATTACAATTCATTGTTAAATTGA

[0111] ATACAACAAA。

[0112] Cleavage fragment 1 (SEQ ID NO: 9): GCGATCACCACTCTT。

[0113] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0114] The present invention will be further described below in conjunction with embodiments:

[0115] Example 1 Construction and transformation of CVB3 subgenomic replicon

[0116] The schematic diagram of the structure of the replicon of Comparative Example 1 constructed by the traditional method is shown in Figure 1 Figure A in the middle, the construction method is shown in Figure 2 A. Comparative Example 1: Fluorescent mycin Nluc for intracellular detection was added after 5'UTR of the replicon. Cells need to be lysed to detect the replication of CVB3 replicon, which is a cumbersome operation. After Nluc, cleavage fragment 1 is connected. Cleavage fragment 1 is a universal cleavage fragment of enterovirus, and the cleavage efficiency is low.

[0117] The schematic diagram of the CVB3 subgenomic replicon structure of the present invention is shown in Figure 1 Middle B, construction method see Figure 2 In B, the specific steps include:

[0118] (I) Construction of Comparative Example 1 CVB3 replicon and CVB3 replicon plasmid of the present invention

[0119] Construction steps: Design primers, respectively Figure 2 The gene shown is used as a template, primers are designed, and fragments P1, P2, P3, P4, P5, P6, and P7 are amplified; homologous recombination is used, and homologous recombination enzyme ( Ultra One Step Cloning Kit; Vazyme; C115), according to the instructions, the amplified P1, P2, P3 fragments and plasmid vector pRNA-T3-T7 (Biyuntian, D2312, EcoRI and HindIII enzymes) were connected to construct the comparative example 1 CVB3 replicon plasmid. In the same way, the amplified fragments P4, P5, P6, P7 and plasmid vector pRNA-T3-T7 (Biyuntian, D2312, EcoRI and HindIII enzymes) were connected to construct the CVB3 subgenomic replicon plasmid of the present invention (referred to as the replicon plasmid of the present invention).

[0120] Among them, the primer sequences used by P1-P7 are as follows:

[0121] The primer sequence for fragment P1 is:

[0122] P1-F:5'-ACAGCTATGACCATGATTACGAATTCGCGGCCGCTAATACGACTCACTATAGGGTTAAAACAGCC-3';

[0123] P1-R:5'-AACAGAACTTTGACTCCCATTTTGTTGTATTCAATTTAACAAT GAAT-3';

[0124] The primer sequence for fragment P2 is:

[0125] P1-F:5'-GTTAAATTGAATACAACAAAATGGGAGTCAAAGTTCTGTTTGCC CTGATC-3';

[0126] P1-R:5'-GTCCAAGAGTGGTGATCGCGTCACCACCGGCCCCCTTGATCTT GTCCACC-3';

[0127] The primer sequence for fragment P3 is:

[0128] P1-F:5'-GCGATCACCACTCTTGGACAACAATCAGGGGCAGTATAC GTAGGGAACT-3';

[0129] P1-R:5'-GTAAAACGACGGCCAGTGCCAAGCTTAGCGCTTTTTT TTTTTTTTTTTTTTTTTTTTTTTCCGCACCGAATGCGGAGAATTTACCC CTACT-3';

[0130] The primer sequence for fragment P4 is:

[0131] P1-F:5'-ACAGCTATGACCATGATTACGAATTCGCGGCCGCTAATACGACTCACTATAGGGTTAAAACAGCC-3';

[0132] P1-R:5'-GCATTCAGGGCCCGGAGGACTACCAAC-3';

[0133] The primer sequence for fragment P5 is:

[0134] P1-F:5'-GTCCTCCGGGCCCTGAATGCGGCTAATCC-3';

[0135] P1-R:5'-AACAGAACTTTGACTCCCATTTTGTTGTATTCAAT;

[0136] TTAACAATGAAT-3'.

[0137] The primer sequence for fragment P6 is:

[0138] P1-F:5'-GTTAAATTGAATACAACAAAATGGGAGTCAAAGTTC TGTTTGCCCTGATC-3'.

[0139] P1-R:5'-CCCGTATTTGTCATTGTcatGGTATTATCGTGTTTTTTCA AAGGAAAAC-3';

[0140] The primer sequence for fragment P7 is:

[0141] P1-F:5'-atgACAATGACAAATACGGGCGCATTTGGACAAC-3';

[0142] P1-R:5'-GTAAAACGACGGCCAGTGCCAAGCTTAGCGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCGCACCGAATGCGGAGAATTTACCCCTACT-3'.

[0143] The present invention is modified on the basis of the traditional CVB3 replicon (i.e. the replicon of comparative example 1), and through adaptive mutation, the 455th base in the 5'UTR is changed from C to G, so that its structure is more stable. After the 5'UTR, the secretory fluorescein hGluc is added, and the replication of the CVB3 replicon can be detected by absorbing the supernatant, which is simple to manufacture. The gene sequence after hGluc is a BSD fragment, and BSD can be used as a screening agent for whether the CVB3 replicon is replicated and expressed, so as to facilitate the screening of the CVB3 replicon that is successfully replicated and translated. Between the hGluc sequence and the BSD fragment is a linking fragment 1, and the linking fragment 1 enables the hGluc sequence and the BSD fragment to be directly and orderly fused and translated. After the BSD fragment is the internal ribosome entry site gene (EMCVIRES) gene of the encephalomyocarditis virus, which can be used as a gene to enhance the translation of the replicon, strengthen the translation and secretion of the replicon protein, and is conducive to detection. The sequence between EMCV IRES and BSD is a linking fragment 2, and the linking fragment 2 can better directly and orderly fuse and translate the EMCV IRES and BSD fragments. The EMCV IRES fragment is followed by a cleavage fragment 2, which after modification by the present invention becomes a more easily recognized cleavage fragment specifically used by CVB3 (see Figure 1 (B).

[0144] (II) After the CVB3 subgenomic replicon was modified, the base 455 in the modified 5'UTR was changed from C to G, which enhanced the stability of the 5'UTR.

[0145] contrast Figure 3 It can be found from Figures A and B in that the structure of the 5'UTR of CVB3 will not be changed after the 455th base is changed, but after the modification of the 455th base in the 5'UTR from C to G in the present invention, the structure of the 5'UTR of CVB3 is more stable.

[0146] (III) Comparison and detection of replication efficiency of the replicon of comparative example 1 constructed by the modified CVB3 subgenomic replicon and the traditional construction method

[0147] (1) Construction of in vitro transcription replicon of comparative example 1 and CVB3 subgenomic replicon RNA of the present invention

[0148] Construction of replicon RNA: The plasmid of the replicon of comparative example 1 constructed in the above (I) and the plasmid of the replicon of the present invention were linearized by restriction endonuclease AfeI (AGCGCT), purified by gel recovery, and transcribed into RNA in vitro using a T7 promoter kit (T7 High Yield RNA Transcription Kit; Vazyme; TR101-01), and purified by column purification ( Viral DNA / RNA Mini Kit; Vazyme; RC311), and the purified RNA was stored at -80℃.

[0149] The RNA was transfected into HEK-293T or Vero cells using an RNA transfection kit (EntransterTM-H4000; Engreen Biosystem Co, Ltd.; Cat. No. 4000-05) according to the methods shown in (2) to (3) below. The hGluc content secreted into the supernatant after transfection was detected. The replication efficiency of the two replicons in HEK-293T cells and Vero cells was compared based on the hGluc content. An irrelevant RNA group (RNA transcribed from an empty plasmid) was collected as a mock negative control group.

[0150] (2) Comparison of the replication efficiency of the replicon of the present invention and the replicon of Comparative Example 1 in HEK-293T cells

[0151] Method: HEK-293T cells were co-transfected with the replicon RNA of the present invention and the replicon RNA of comparative example 1 using an RNA transfection kit. The supernatant was removed 24 hours after transfection, washed four times with PBS, and then new supernatant was added. The supernatant was collected at 24 hours, 48 ​​hours, 96 hours, and 120 hours after transfection, and the hGluc content secreted into the supernatant was detected. The CVB3 replication was determined based on the hGluc content. Mock was the negative control group. Results are shown in Figure 4 .

[0152] Results: The results of the 293T cell detection system showed that the replication efficiency of the modified CVB3 replicon was 50 times higher than that of the replicon in comparative example 1.

[0153] (2) Comparison of the replication efficiency of the replicon of the present invention and the replicon of Comparative Example 1 in Vero cells

[0154] Method: The CVB3 subgenomic replicon constructed by the present invention and the replicon of comparative example 1 constructed by the traditional construction method were co-transfected into Vero cells. The supernatant was removed 24 hours after transfection, washed four times with PBS, and then new supernatant was added. The supernatant was collected at 24 hours, 48 ​​hours, 96 hours, and 120 hours after transfection, and the hGluc content secreted into the supernatant was detected. The CVB3 replication was determined according to the hGluc content. Mock was the negative control group, and the results were shown in Figure 5 .

[0155] The results showed that the Vero cell detection system showed that the replication efficiency of the modified CVB3 replicon was 200% higher than that of the comparative example 1.

[0156] (IV) Comparison of the inhibition folds of drugs that inhibit CVB3 replication by screening different replicons

[0157] The drug anisomycin has been shown to inhibit CVB3 virus replication. The replicon of the present invention and the replicon of Comparative Example 1 were used to verify the inhibitory effect of the drug anisomycin. The experimental process is as follows:

[0158] The CVB3 subgenomic replicon constructed by the present invention and the replicon of comparative example 1 constructed by the traditional construction method were co-transfected into HEK-293T cells. The supernatant was removed 24 hours after transfection, washed four times with PBS, and then new supernatant was added, and 200nM anisomycin was added. The supernatant was collected 96 hours after transfection, and the hGluc content secreted into the supernatant was detected. The inhibition of CVB3 replication by the drug anisomycin was determined based on the hGluc content.

[0159] Results Figure 6 .

[0160] The results showed that the CVB3 subgenomic replicon constructed by the present invention can greatly increase the inhibition multiple of screening and is more suitable for screening drugs that inhibit CVB3 replication.

[0161] (V) Construction of CVB3 trans-packaging pseudovirus system using the CVB3 subgenomic replicon of the present invention

[0162] Schematic diagram of CVB3 replicon structure and strategy for constructing CVB3 trans-packaged pseudovirus can be found in Figure 7 The construction method is as follows:

[0163] 293T with 5*105 / ml of cells were plated, and when the cells grew to a density of more than 70%, the CVB3 subgenomic replicon constructed by the present invention and the CVB3 subgenomic replicon RNA constructed by the traditional construction method were co-transfected into HEK-293T cells using a transfection kit (EntransterTM-H4000; Engreen Biosystem Co, Ltd.; Cat. No.4000-05). The supernatant was removed 24 hours after transfection, and PBS was washed four times, and then new supernatant was added, and then transfected according to Figure 7 Figure B shows the construction of the CVB3 structural protein plasmid pCMV-P1-EGFP. The supernatant was collected 96 hours after transfection with the pCMV-P1-EGFP plasmid. The supernatant contained a large amount of reverse genetic rescued trans-packaged viruses, which were filtered through a 0.45 μM filter membrane, aliquoted, and stored at -80°C.

[0164] Green fluorescence EGFP and cleavage fragment 1: GCGATCACCACTCTT that can cut EGFP are added before CVB3 structural protein VP1. After transfection, the expression efficiency of CVB3 structural protein can be determined based on green fluorescence.

[0165] (VI) hGluc test experiment.

[0166] according to Figure 7 The method shown in C is to construct CVB3 trans-packaged pseudovirion particles using the CVB3 replicon constructed by the present invention and the pseudovirion particles of Comparative Example 1 constructed by the traditional replicon (i.e., the replicon of Comparative Example 1), infect Hela cells, replace the cells with PBS 12 hours after infection, wash three times with PBS, collect the supernatant 48 hours after infection, and detect hGluc, respectively. The results are shown in Figure 8 .

[0167] The results showed that the CVB3 trans-packaged pseudovirus constructed by the modified CVB3 subgenomic replicon of the present invention had higher hGluc, which was increased by about 60 times compared with the traditional method after infecting Hela cells.

[0168] 7. Trans-packaged pseudovirus system infection and drug screening

[0169] Previous studies have shown that the drug bafilomycin A1 has been shown to inhibit viral entry. This experiment uses the replicon of the present invention and the replicon of Comparative Example 1 to verify the inhibitory effect of the drug bafilomycin A1.

[0170] The experimental process includes: Figure 7The method shown in Figure C is to use the CVB3 replicon of the present invention to construct CVB3 trans-packaged pseudovirus particles and the pseudovirus particles of Comparative Example 1 constructed by the replicon of Comparative Example 1, respectively. 100ul of each of the two viruses is taken to infect Hela cells, and 30nM bafilomycin A1 or DMSO is added at the same time. After 12 hours of infection, the culture medium is replaced. After washing three times with PBS, new culture medium is added, and the supernatant is collected 48 hours after infection, and hGluc is detected respectively. The inhibitory effect of bafilomycin A1 on the CVB3 trans-packaged pseudovirus constructed by the two replicons is compared. The results are shown in Fig. 9 .

[0171] The results showed that compared with the pseudovirus particles constructed by the traditional method of CVB3 subgenomic replicon, the successful construction of CVB3 trans-packaged pseudovirus using the modified CVB3 subgenomic replicon greatly improved the screening inhibition multiple.

[0172] It shows that, compared with the pseudovirus particles constructed by the traditional CVB3 subgenomic replicon, the CVB3 trans-packaged pseudovirus constructed by the CVB3 subgenomic replicon modified by the present invention has a higher inhibition multiple in screening drugs that inhibit CVB3 entry, and is more suitable for screening drugs that inhibit CVB3 Entry.

[0173] Example 2 Replicon Optimization Experiment

[0174] Comparative Example 2 Construction of Replicon: Fig.10 Figure B shows the construction of the CVB3 subgenomic replicon of Comparative Example 2 (hereinafter referred to as Comparative Example 2 replicon), in which the order of linker fragment 1 and linker fragment 2 is opposite to that of the replicon of the present invention, and the rest of the structure is the same.

[0175] The replicon of the present invention and the replicon of comparative example 2 were co-transfected into HEK-293T cells. The supernatant was removed 24 h after transfection, washed four times with PBS, and then new supernatant was added. The supernatant was collected at 24 h, 48 h, 96 h, and 120 h after transfection, and the hGluc content secreted into the supernatant was detected. The CVB3 replication was determined based on the hGluc content. Mock was the negative control group, and the results were shown in Fig.10 Middle C.

[0176] The results showed that the replicon of comparative example 2 could not replicate effectively after the linker fragment 1 and linker fragment 2 were reversed, indicating that only by inserting specific linker fragments and cleavage fragments into specific positions in the present invention can the effective fusion replication of genes such as BSD, hGluc, and EMCV IRES be achieved, thereby greatly improving the replication efficiency of the replicon.

[0177] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid fragment, characterized in that Includes reporter gene, linker fragment 1, screening gene, linker fragment 2, IRES gene and cleavage fragment; The linker fragment 1 has a nucleic acid fragment as shown in SEQ ID NO: 1 or a nucleic acid sequence having at least 80% homology thereto; The linker fragment 2 has a nucleic acid fragment as shown in SEQ ID NO: 2 or a nucleic acid sequence having at least 80% homology thereto; The cleavage fragment has a nucleic acid sequence as shown in SEQ ID NO: 3 or a nucleic acid sequence having at least 80% homology thereto.

2. The nucleic acid fragment according to claim 1, characterized in that It includes a reporter gene, a linker fragment 1, a screening gene, a linker fragment 2, an IRES gene and a cleavage fragment which are linked in sequence.

3. The replicon according to any one of claims 1 to 2, characterized in that The IRES gene has a sequence shown in any one of the following: 1) the nucleic acid sequence shown in SEQ ID NO: 4; 2) A nucleic acid sequence having the same or similar function as 1) obtained by replacing, deleting, adding or modifying one or more bases in the nucleic acid sequence shown in 1); 3) A nucleic acid sequence having at least 80% homology with the sequence shown in 1) or 2).

4. The nucleic acid fragment according to any one of claims 1 to 3, characterized in that The reporter gene includes the hGluc gene; the screening gene includes the BSD gene; Preferably, the BSD gene has a nucleic acid sequence as shown in SEQ ID NO: 5 or a nucleic acid sequence having at least 80% homology thereto; Preferably, the hGluc gene has a nucleic acid sequence as shown in SEQ ID NO: 6 or a nucleic acid sequence having at least 80% homology thereto.

5. A replicon, characterized in that include: A promoter, a nucleic acid fragment according to any one of claims 1 to 5, and a viral nonstructural protein gene.

6. The replicon according to claim 5, characterized in that The method comprises, in sequence, a promoter, a 5'UTR, a nucleic acid fragment according to any one of claims 1 to 4, a viral nonstructural protein gene and a 3'UTR; Preferably, the 5'UTR has a nucleic acid sequence as shown in SEQ ID NO: 8 or a nucleic acid sequence having at least 80% homology thereto.

7. The replicon according to any one of claims 5 to 6, characterized in that The source of the non-structural protein gene includes Coxsackie virus; the Coxsackie virus includes CVB1, CVB2, CVB3, CVB4, CVB5 or CVB6 virus.

8. The replicon according to claims 5 to 7, characterized in that The non-structural protein gene is the non-structural protein gene of the CVB3 virus with a deposit number of CGMCC NO.26797.

9. The replicon according to any one of claims 5 to 8, characterized in that The replicon also includes a PolyA fragment, and / or The promoter includes a T7 promoter.

10. A recombinant vector comprising a vector backbone and the nucleic acid fragment according to any one of claims 1 to 4 or the replicon according to any one of claims 5 to 8.

11. A trans-packaged Kassage virus group B type 3, characterized in that The recombinant vector according to claim 10 and the recombinant vector expressing the CVB3 structural protein are packaged by packaging cells.

12. The CVB3 trans-packaging pseudovirus system is characterized in that It comprises the recombinant vector according to claim 10, an auxiliary plasmid containing the CVB3 virus structural gene, and packaging cells.

13. Use of any one of the following I) to VI in the preparation of a vaccine for the prevention and / or treatment of coxsackievirus infection or a disease caused by coxsackievirus infection, or in the evaluation of the immunogenicity and / or protective properties of coxsackievirus vaccines for non-diagnostic and therapeutic purposes, or in the screening of anti-CVB3 drugs: I), the nucleic acid fragment according to any one of claims 1 to 4; II), the replicon according to any one of claims 5 to 9; III), the recombinant vector according to claim 10; VI), the trans-packaged Cardassia virus group B type 3 according to claim 11; VI) The CVB3 trans-packaging pseudovirus system according to claim 12.

Images