Wheat e3 ubiquitin ligase gene RFEL1 and application thereof in wheat disease resistance
By overexpressing the E3 ubiquitin ligase gene RFEL1 in wheat, the problem of wheat resistance to stripe rust, powdery mildew and leaf rust was solved, achieving the effect of broad-spectrum resistance breeding.
Patent Information
- Application Number
- CN202411962799.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2044-12-30
AI Technical Summary
Existing technologies are insufficient to effectively utilize wheat resistance genes to combat stripe rust, powdery mildew, and leaf rust. Furthermore, mutations in stripe rust fungi can render resistant varieties ineffective, impacting wheat yield and quality.
The wheat E3 ubiquitin ligase gene RFEL1 was overexpressed. By constructing an overexpression vector and transforming wheat, the expression level of RFEL1 was increased to enhance the resistance of wheat to stripe rust, powdery mildew and leaf rust.
RFEL1 overexpression lines showed significant resistance to various stripe rust races, powdery mildew, and leaf rust, providing genetic resources and theoretical guidance for broad-spectrum resistance breeding.
Smart Images

Figure CN119776385B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a wheat E3 ubiquitin ligase gene RFEL1 and its application in wheat disease resistance. Background Technology
[0002] Wheat is one of the most important food crops in the world and in my country, with the world's planting area second only to maize and rice, providing food for approximately 35% of the world's population. Ensuring the safe and efficient production of wheat is crucial to guaranteeing global food and nutrition security. However, the presence and persistent prevalence of plant diseases pose serious challenges to the safe production of wheat. Several serious fungal diseases continuously and frequently damage wheat yield and quality during its growth process, including stripe rust caused by *Strombus styracifolius*, leaf rust caused by *Strombus cryptus*, powdery mildew specifically caused by *Bruchwegium brevicornu*, and Fusarium head blight and stem rot caused by various Fusarium species.
[0003] Planting resistant wheat varieties is a highly effective, economical, and environmentally friendly measure for controlling stripe rust. However, due to the continuous mutation of stripe rust fungi and the emergence of new physiological races, the resistance of long-term and monoculture resistant varieties can be overcome. With the intensification of global climate change, the epidemic area of stripe rust is constantly expanding, causing increasing losses. In order to efficiently breed wheat varieties resistant to stripe rust, it is necessary to discover more wheat stripe rust resistance genes and fully understand their molecular mechanisms of action, so as to provide genetic resources and theoretical basis for better breeding wheat varieties with durable and stable stripe rust resistance. Summary of the Invention
[0004] The purpose of this invention is to provide a wheat E3 ubiquitin ligase gene RFEL1 and its application in wheat disease resistance, thereby solving the problems existing in the prior art. This wheat E3 ubiquitin ligase gene RFEL1 can be used for broad-spectrum resistance breeding in wheat.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] Technical Solution 1: Wheat E3 ubiquitin ligase gene RFEL1, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0007] Technical Solution 2: The application of the wheat E3 ubiquitin ligase gene RFEL1 or its related biological materials includes any of the following applications:
[0008] A1. Improve wheat's resistance to stripe rust;
[0009] A2. Improve wheat's resistance to powdery mildew;
[0010] A3. Improve wheat's resistance to leaf rust.
[0011] Furthermore, the relevant biomaterials include any one of the following B1-B5:
[0012] B1, the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1;
[0013] B2, an expression cassette containing the wheat E3 ubiquitin ligase gene RFEL1;
[0014] B3, a recombinant vector containing the wheat E3 ubiquitin ligase gene RFEL1;
[0015] B4. Recombinant microorganisms containing the wheat E3 ubiquitin ligase gene RFEL1;
[0016] B5. Transgenic material containing the wheat E3 ubiquitin ligase gene RFEL1.
[0017] Furthermore, the amino acid sequence of the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.4.
[0018] The recombinant vector contains the wheat E3 ubiquitin ligase gene RFEL1 with the sequence shown in SEQ ID NO.3; the recombinant microorganism contains the wheat E3 ubiquitin ligase gene RFEL1 with the sequence shown in SEQ ID NO.3.
[0019] Technical Solution 3: Application of the functional product that upregulates the expression level of the wheat E3 ubiquitin ligase gene RFEL1 in improving wheat stripe rust, wheat powdery mildew resistance and wheat leaf rust resistance, wherein the functional product is an RFEL1 gene overexpression vector.
[0020] Technical Solution 4: A method for improving wheat resistance to stripe rust, powdery mildew and leaf rust, comprising the following steps:
[0021] S1. Construct an overexpression vector using the wheat E3 ubiquitin ligase gene RFEL1 as the target gene.
[0022] S2. The constructed overexpression vector was transformed into wheat;
[0023] S3. Positive transgenic wheat was obtained through screening.
[0024] The present invention discloses the following technical effects:
[0025] This invention used transcriptome sequencing analysis of samples from the Urartu wheat material PI428322 before and after inoculation with wheat stripe rust to identify an E3 ubiquitin ligase gene, RFEL1, which was upregulated by stripe rust. Virus-induced gene silencing technology was used to preliminarily verify the resistance of wheat with positively regulated RFEL1 expression to stripe rust. Urartu wheat (Triticum urartu) is a diploid wild single-grain wheat, an ancestral species of the tetraploid and hexaploid wheat A genome, and has abundant germplasm resources in nature, which can be used as gene resources for stripe rust resistance gene discovery and application in common wheat breeding. Further transgenic technology was used to introduce it into the common hexaploid wheat Fielder to verify its positive regulation of wheat resistance to stripe rust. Stripe rust resistance identification results showed that RFEL1 overexpressing lines were resistant to different stripe rust physiological races CYR17, CYR32, CYR33, and CYR34. Further resistance identification showed that the RFEL1 overexpressing lines were resistant to both powdery mildew and stripe rust. This E3 ubiquitin ligase RFEL1 gene can be used for broad-spectrum resistance breeding of wheat and has significant application value. This invention identifies a broad-spectrum disease resistance gene, providing theoretical guidance and genetic resources for wheat disease resistance breeding. Attached Figure Description
[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0027] Figure 1 To investigate the effect of silencing RFEL1 with barley mosaic virus in the Urartu wheat material PI428322 on reducing its resistance to stripe rust fungus CYR34, the following indicators were observed: A: Relative expression levels of the RFEL1 gene in BSMV:GFP and BSMV:RFEL1 plants; B: Silencing RFEL1 weakened the resistance of the resistant material PI428322 to stripe rust fungus CYR34; C: The area occupied by stripe rust fungal spores on the leaf surface of BSMV:RFEL1 plants was significantly higher than that of BSMV:GFP plants.
[0028] Figure 2To stably transform the common wheat variety Fielder with the RFEL1 gene, RFEL1 overexpression enhanced the resistance of Fielder to stripe rust fungus CYR34. Specifically: A: The expression level of the RFEL1 gene in positive overexpression lines and wild-type Fielder was identified by qRT-PCR; B: RFEL1 overexpression enhanced the resistance of common wheat Fielder to stripe rust fungus CYR34; C: The biomass of stripe rust fungus in the infected leaves of positive RFEL1 overexpression lines was significantly lower than that in wild-type Fielder.
[0029] Figure 3 RFEL1 overexpression enhanced wheat resistance to stripe rust fungi CYR17, CYR32 and CYR33;
[0030] Figure 4 RFEL1 overexpression enhanced wheat resistance to powdery mildew E09. A: Cell death and H2O2 accumulation in RFEL1-overexpressing and wild-type Fielder wheat plants 48 h after inoculation with powdery mildew E09; B: RFEL1 overexpression enhanced resistance of common wheat Fielder to powdery mildew E09.
[0031] Figure 5 RFEL1 overexpression enhanced wheat resistance to leaf rust fungus Pt23a. A: Phenotypes of RFEL1 overexpressing plants and wild-type Fielder plants 14 days after inoculation with leaf rust fungus Pt23a; B: Leaf rust biomass in leaves of positive RFEL1 overexpressing plants was significantly lower than that in wild-type Fielder plants. Detailed Implementation
[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0037] Example 1
[0038] Obtaining the gene sequence of E3 ubiquitin ligase RFEL1
[0039] Transcriptome sequencing analysis yielded an E3 ubiquitin ligase gene, TuG1812G0100001368 (named RFEL1). Gene-specific primers were designed based on the CDS sequence of TuG1812G0100001368 from the Urartu wheat database. The full-length RFEL1 sequence was obtained by amplifying cDNA samples from leaves of Urartu wheat material PI428322. The specific procedure was as follows: Under room temperature conditions, Urartu wheat material PI428322 (from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture, Henan Agricultural University) was planted in seedling pots. After 10 days of growth, leaves were harvested, RNA was extracted using Trizol reagent, and reverse transcribed using First-strand cDNA Synthesis Mix. Then, using FP:5'-ATGGATGACAGTTGCGCG-3' (SEQ ID NO.1) and RF:5'-CTATTTCTTTCCATTGCTGGAAAAG-3' (SEQ ID NO.2) as primers, and PI428322 leaf cDNA as a template, PCR amplification was performed using KOD-FX high-fidelity enzyme (amplification program: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 20 s, 58℃ annealing for 15 s, 68℃ extension for 3 min, 35 cycles; 68℃ extension for 10 min). The reaction system was 50 μL, and its components were 2 μL cDNA, 1.5 μL 10 μM primer FP, 1.5 μL 10 μM primer RF, 10 μL 2 mM dNTPs, 1 μL KOD-FX Taq (Toyobo), 25 μL 2×KOD-FX PCR Buffer, and 9 μL... The full-length CDS sequence of RFEL1 was obtained by ddH2O, as shown in SEQ ID NO.3, and the amino acid sequence it encodes is shown in SEQ ID NO.4.
[0040] SEQ ID NO.3:
[0041]
[0042] SEQ ID NO.4:
[0043] MDDSCAVCADALEWVAYGPCGHREVCSTCVVRLRFVLEDSLCCICKTDCPSVFVTKAMGDYTKVISDFSVLPTEANEGNVGEYWYHEDTKAYFDDADHYKMIRAMCRLSCSVCDKAEDQVGQAAQAKRRSRFKSIDQLKGHLFHQHRLYMCNLCLEGRKVFICEQKLYTRAQLAQHTKTGDSEVDGSEIERSGFAGHPVCEFCKYPLYGDNELYTHMSREHYSCHICQRQHPGQYDYFRNYDDLEMHFRKDHFLCEDDACLAKKFVVFQSDAEIKRHNAMEHGGRMSRAQRNAALQIPTSFIYQRNEQDQRRGRGRGRNAHHDRPDRDFSLPVRDGSATADHGLGSRVDSVAGPFQSLSVSSSSGRTETGRSLGNGRLLEQLSFPPLQDQDIPDARMDAVPYETSFPPVSEQQSRYALALNQSSRGSARLGDESLFPPLPGSSNKGSASTQQGLQSLAKNTLASRLQQRSKGTVKVLYSAQSQTAENPEIVPHVSTSTQTWPTPEQGLHLSGSSQLWIVTQSTRENGLMPSASSGSAWNSRASNKMKHSISTPNFVSGGSSAQASSTAYGNKKQLPPQSSQPLPVVEDVRQANKSLVERMRVALGMDEDRFSAFKEIASEYRQGVIDTSEYLSYVEQFGISHLVPEMAKLLPDPLKQMELADAYYTNMRFRSLQENGGCGTITVKENKRRNKGKGKTPDAETAPAKDASESLADSFMDTVRKLQLNNKAQEGEAAVLSKDGYRSSKEKIPLSAGGSSCGTNMGLDGDPVAISKASGTSRYVGKGGGSTGSSSSNNKQSKKTSKFLRARLGDNSLATLDFSHPDVSPERPVRETQVLQTGLPVRSVWKNGAAQKLFSSNGKK。
[0044] Functional verification of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to stripe rust
[0045] The function of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to stripe rust was verified by BSMV-VIGS and transgenic overexpression.
[0046] The function of the RFEL1 gene was verified by the VIGS assay. First, a 140bp sequence (SEQ ID NO.7) was reverse-engineered into the RNA γ chain of barley mosaic virus using primers RFEL1-VIGS (SEQ ID NO.5 and SEQ ID NO.6) to form the recombinant plasmid BSMV:RFEL1. Then, the RFEL1 fragment was introduced into wheat leaves using barley mosaic virus. At the one-leaf-one-heart stage of wheat, the recombinant viral vector BSMV:RFEL1 and the control viral vector BSMV:GFP were respectively rubbed into the second leaf of 15 PI428322 plants.
[0047] SEQ ID NO.5:
[0048] GATTCTTCTTCCGTTGCTAGCGACTTTCTTGTAGTGTATGTGACAA;
[0049] SEQ ID NO.6:
[0050] TTTTTTTTTTTTTAGCTAGCAAGATTACACATGTATAACCTATGC;
[0051] SEQ ID NO.7:
[0052] GACTTTCTTGTAGTGTATGTGACAAAGCTGAGGACCAGGTTGGTCAGGCAGCACAA GCAAAGCGCCGAAGCAGGTTCAAGAGCATTGATCAGCTAAAGGGACATTTGTTCCATCA GCATAGGTTATACATGTGTAATCTT.
[0053] On the 14th day after friction inoculation with the virus, RNA was extracted from the 4th piece to detect the silencing efficiency of the RFEL1 gene. Plants that were successfully silenced were inoculated with stripe rust fungus CYR34 (from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture, Henan Agricultural University). Disease resistance phenotypes were observed 14 days after inoculation, and fungal biomass was measured. The specific method for measuring fungal biomass was as follows: DNA was extracted from infected leaves 14 days after inoculation and amplified by qRT-PCR (primers: TaEF1a FP: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' (SEQ ID NO. 8), RP1: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO. 9); PsEF1 FP: 5'-TTCGCCGTCCGTGATATGAGACAA-3' (SEQ ID NO. 10), RP2: 5'-ATGCGTATCATGGTGGTGGAGTGA-3' (SEQ ID NO. 11). The amplification program was: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 20 s, for 40 cycles. The reaction volume was 10 μL, consisting of 1 μL genomic DNA and 10 μM primers TaEF1a. FP, RP1, PsEF1, FP and RP2 (0.2 μL each), 5 μL Taq SYBR·@Green qPCR premix (Lambolid) and 3.6 μL ddH2O were added. Stripe rust biomass was determined by the relative value of stripe rust elongation factor (PsEF1) and wheat elongation factor (TaEF1a). The results showed that transient silencing of the RFEL1 gene in PI428322 reduced the resistance of PI428322 to PstCYR34. Figure 1 ).
[0054] This invention further describes the transfer of the RFEL1 gene into Fielder wheat (from the Crop Genomics and Molecular Breeding Center Laboratory, College of Agriculture, Henan Agricultural University). First, primers were designed based on the full-length CDS sequence of RFEL1. Using cDNA from PI428322 as a template, the full-length CDS sequence of RFEL1 (SEQ ID NO. 3) was amplified by PCR and ligated into the pCAMBIA1305 vector with a GFP tag, promoted by the UBI promoter. Then, using the RFEL1-GFP fusion vector as a template, specific primers, upstream primer SEQ ID NO. 12 and downstream primer SEQ ID NO. 13, were designed and constructed into the overexpression vector pLH5.
[0055] SEQ ID NO.12:
[0056] TTTCAAAGGCGTCTGGCACT;
[0057] SEQ ID NO.13:
[0058] TGTAGCCAATGAGTTGTCACC.
[0059] The pLH5 overexpression vector containing the RFEL1-GFP fusion protein was introduced into common wheat Fielder via Agrobacterium-mediated transformation to obtain stable transgenic plants. The presence of the RFEL1 gene in the transgenic plants was verified by qRT-PCR (reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 20 s, 40 cycles. The reaction volume was 10 μL, consisting of 1 μL cDNA, 0.2 μL 10 μM upstream primer, 0.2 μL 10 μM downstream primer, 5 μL Taq SYBR·@Green qPCR premix (Lambolid), and 3.6 μL ddH2O). Two stable T2 generation positive transgenic lines and the control Fielder were grown in a greenhouse under a 16-hour light-8-hour dark environment at 22°C for 10 days. They were then inoculated with stripe rust fungus CYR34. After 14 days, disease resistance phenotypes and stripe rust biomass were observed. The results showed that the RFEL1 transgenic plants enhanced Fielder's resistance to stripe rust fungus CYR34. Figure 2 ).
[0060] To verify the function of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to multiple physiological races of stripe rust, T2 generation positive transgenic lines and the control Fielder were planted in a greenhouse under a 16-hour light-8-hour dark cycle at 22°C for 10 days. They were then inoculated with stripe rust CYR17, CYR32, and CYR33. The disease resistance phenotype was observed 14 days later. The results showed that the RFEL1 transgenic plants enhanced the resistance of Fielder to stripe rust CYR17, CYR32, and CYR33. Figure 3 ).
[0061] Example 3: The role of the E3 ubiquitin ligase RFEL1 gene in broad-spectrum disease resistance in wheat.
[0062] To verify the role of the E3 ubiquitin ligase RFEL1 gene in broad-spectrum disease resistance in wheat, RFEL1 transgenic plants were inoculated with powdery mildew E09 (from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture, Henan Agricultural University) and leaf rust Pt23a (from the Zheng Wenming Laboratory of the College of Life Sciences, Henan Agricultural University) to identify disease resistance phenotypes.
[0063] To verify the role of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to powdery mildew, two stable T2 generation positive transgenic lines and the control Fielder were grown in a greenhouse under a 16-hour light-8-hour dark cycle at 22°C for 10 days. They were inoculated with powdery mildew fungus E09. Samples were taken 48 hours after inoculation. Mycelial growth and development were observed using Coomassie Brilliant Blue, cell death was observed using Trypan Blue, and hydrogen peroxide accumulation was observed using DAB. The results showed that compared to wild-type Fielder, the RFEL1 transgenic plants exhibited slower mycelial growth, more extensive cell death, and greater hydrogen peroxide accumulation. Phenotypic observation was performed 7 days after inoculation, indicating that the RFEL1 transgenic plants showed fewer spores on the leaf surface and were more resistant to the disease. Figure 4 ).
[0064] To verify the role of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to powdery mildew, two stable T2 generation positive transgenic lines and the control Fielder were grown in a greenhouse under a 16-hour light-8-hour dark cycle at 22°C for 10 days. They were then inoculated with leaf rust fungus Pt23a, and leaf rust biomass and phenotypic observations were performed 14 days later. The results showed that, compared with wild-type Fielder, RFEL1 transgenic plants exhibited stronger resistance to leaf rust fungus Pt23a. Figure 5 ).
[0065] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of the wheat E3 ubiquitin ligase gene RFEL1, characterized in that, Including any of the following applications described in A1-A3: A1. Improve wheat's resistance to stripe rust; A2. Improve wheat's resistance to powdery mildew; A3. Improve wheat's resistance to leaf rust; The nucleotide sequence of the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.
3.
2. Application of wheat E3 ubiquitin ligase gene RFEL1-related biomaterials, characterized in that, Including any of the following applications described in A1-A3: A1. Improve wheat's resistance to stripe rust; A2. Improve wheat's resistance to powdery mildew; A3. Improve wheat's resistance to leaf rust; The nucleotide sequence of the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.3; The relevant biomaterials include any one of the following B1-B4: B1, the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1; B2, an expression cassette containing the wheat E3 ubiquitin ligase gene RFEL1; B3, a recombinant vector containing the wheat E3 ubiquitin ligase gene RFEL1; B4. Recombinant microorganisms containing the wheat E3 ubiquitin ligase gene RFEL1.
3. The application according to claim 2, characterized in that, The amino acid sequence of the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.
4.
4. The application of a functional product that upregulates the expression level of the wheat E3 ubiquitin ligase gene RFEL1 in improving resistance to wheat stripe rust, wheat powdery mildew, and wheat leaf rust, characterized in that... The functional product includes an RFEL1 gene overexpression vector; The nucleotide sequence of the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.
3.
5. A method for improving wheat resistance to stripe rust, powdery mildew, and leaf rust, characterized in that, Includes the following steps: S1. Construct an overexpression vector with wheat E3 ubiquitin ligase gene RFEL1 as the target gene. S2. The constructed overexpression vector was transformed into wheat; S3. Positive transgenic wheat was obtained through screening; The nucleotide sequence of the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.3.