Recombinant bacillus subtilis, construction method thereof and application of recombinant bacillus subtilis in production of tyrosol and salidroside

Abstract

The invention relates to the technical field of bioengineering, in particular to recombinant bacillus subtilis, a construction method thereof and application of the recombinant bacillus subtilis in production of tyrosol and salidroside.The construction method comprises the following steps that S1, parsley and / or rose leaves and bacillus subtilis whole genomes are extracted; s2, respectively designing a primer group by taking parsley tyrosine decarboxylase, rose phenylacetaldehyde synthase and bacillus subtilis YjiA as target genes, and carrying out PCR (Polymerase Chain Reaction) amplification on target gene segments; s3, connecting the target gene segment with an expression vector to construct a recombinant vector; and S4, transforming the recombinant vector into bacillus subtilis, and screening a transformant by using the resistance gene to obtain a recombinant bacillus subtilis strain. The bacillus subtilis engineering bacterium for heterologous synthesis of the tyrosol and the salidroside is successfully constructed, a new thought is provided for industrial fermentation production of the tyrosol and the salidroside, and a foundation is laid for environment-friendly production of the tyrosol and the salidroside.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a recombinant Bacillus subtilis, a construction method thereof, and an application thereof in producing tyrosol and salidroside. Background Art

[0002] Tyrosol is a phenylethanol derivative and one of the main active ingredients of olive oil. In addition, tyrosol is also the direct precursor of salidroside. Tyrosol has antioxidant and anti-inflammatory biological activities. It can be used as a precursor of the natural product oleocanthal and the raw material of cardiovascular drugs metoprolol and betaxolol, and has potential value in the research and development of antifungal drugs.

[0003] Salidroside is the product of glucosylation of the C8 hydroxyl group of tyrosol and is one of the main active ingredients of Rhodiola plants. It has pharmacological effects such as anti-fatigue, anti-hypoxia, anti-aging, anti-inflammatory, and protection of cardiovascular system and central nervous system activity. Salidroside has been used in food and health products, whitening and sunscreen and other skin care products and pharmaceutical industries. It has a very broad application prospect and has attracted much attention in recent years. However, the supply of salidroside from natural plants can hardly meet the growing commercial demand.

[0004] The chemical synthesis method has high raw material costs and is not environmentally friendly, which makes the microbial synthesis method a hot topic in the research of green production of tyrosol and salidroside. However, the endotoxins produced by the Escherichia coli expression strain can be toxic to the human body, and the fermentation cycle of the yeast expression strain is long. Bacillus subtilis is widely used in the food and medicine fields as a beneficial bacteria, and has the functions and effects of improving consumption function, enhancing immunity, and promoting intestinal microbial balance. However, the biosynthetic technology of producing tyrosol and salidroside using Bacillus subtilis has not been retrieved yet. Summary of the invention

[0005] In view of this, the purpose of the present invention is to propose a recombinant Bacillus subtilis and a construction method thereof and an application in producing tyrosol and salidroside, thereby providing a new method for the production of tyrosol and salidroside.

[0006] Based on the above purpose, the present invention provides a method for constructing a recombinant Bacillus subtilis, comprising the following steps:

[0007] S1, extracting the whole genome of parsley and / or rose leaves, and extracting the whole genome of Bacillus subtilis;

[0008] S2, designing a first primer set with parsley tyrosine decarboxylase and Bacillus subtilis YjiA as target genes, and / or designing a second primer set with rose phenylacetaldehyde synthase and Bacillus subtilis YjiA as target genes, and using the whole genomes of parsley and rose leaves and the whole genome of Bacillus subtilis as templates to amplify the target gene fragments by PCR respectively;

[0009] S3, connecting the target gene fragment with an expression vector to construct a recombinant vector for expressing tyrosine decarboxylase and YjiA and / or phenylacetaldehyde synthase and YjiA activity;

[0010] S4. The recombinant vector is used to transform Bacillus subtilis, and the transformants are selected using the resistance gene to obtain a recombinant Bacillus subtilis strain.

[0011] In the process of forming the recombinant vector, restriction endonuclease cleavage sites and protective base sequences are added on both sides of the fusion fragment.

[0012] The base sequence of the rose phenylacetaldehyde synthase gene is shown in SEQ ID No: 1.

[0013] The parsley tyrosine decarboxylase gene has a base sequence as shown in SEQ ID No: 2.

[0014] The YjiA gene has a base sequence shown in SEQ ID No:3.

[0015] Optionally, the first primer set includes the nucleotide sequences shown in SEQ ID Nos: 4-7; and the second primer set includes the nucleotide sequences shown in SEQ ID Nos: 8-11.

[0016] Preferably, the expression vector is PHY-P43.

[0017] Optionally, the transformation method described in S4 is electroporation transformation or Sipizizen transformation method.

[0018] The present invention also provides a recombinant Bacillus subtilis, which is obtained by adopting the construction method of the recombinant Bacillus subtilis.

[0019] The present invention also provides the use of the recombinant Bacillus subtilis in the fermentation production of tyrosol and salidroside.

[0020] The method for producing tyrosol and salidroside by fermentation is to first culture the recombinant Bacillus subtilis on a slant, then culture the seeds, and finally culture the seeds to obtain tyrosol and salidroside. The specific method is: transfer the screened transformants to a slant culture medium for detection; pick colonies from the slant culture medium and culture them on a seed culture medium; inoculate Bacillus subtilis and the modified bacteria into the fermentation culture medium respectively, detect the growth of each strain, culture in the culture medium for 72 hours, centrifuge the fermentation broth, and determine the content of tyrosol and salidroside in the fermentation broth.

[0021] The temperature of the slant culture was 37°C.

[0022] In the fermentation culture, the seed liquid after seed culture is inoculated into the fermentation medium at an inoculation rate of 2-3%.

[0023] Beneficial effects of the present invention:

[0024] The invention introduces a highly efficient way to produce tyrosol into the original or modified Bacillus subtilis, introduces the tyrosine decarboxylase gene from parsley, the phenylacetaldehyde synthase gene from rose and the YjiA gene from Bacillus subtilis, and successfully constructs a Bacillus subtilis engineering bacterium for heterologous synthesis of tyrosol and salidroside; compared with Escherichia coli, Bacillus subtilis has the advantages of good safety and strong anti-bacterial ability; compared with yeast, it has the advantages of short growth cycle, etc.

[0025] The invention provides a new idea for the industrial fermentation production of tyrosol and salidroside, lays a foundation for the environmentally friendly production of tyrosol and salidroside, and has great practical application value and broad application prospects in the fields of food, cosmetics and biopharmaceuticals. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only for the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 : are bacterial images of the original strain and the recombinant strain fermentation broth after centrifugation; wherein a is a bacterial image of the original strain fermentation broth after centrifugation, b is a bacterial image of the recombinant strain 1 fermentation broth after centrifugation, and c is a bacterial image of the recombinant strain 2 fermentation broth after centrifugation;

[0028] Figure 2 are the fermentation broths of the original strain and the recombinant strain; wherein a is the fermentation broth of the recombinant strain 1, b is the fermentation broth of the recombinant strain 2, and c is the fermentation broth of the original strain;

[0029] Figure 3HPLC graphs of tyrosol and salidroside standards and fermentation broths; wherein, Figure A is the HPLC result of fermentation broth 1, Figure B is the HPLC result of fermentation broth 2, and Figure C is the HPLC result of salidroside and tyrosol standards;

[0030] Figure 4 This is the electrophoresis of PCR of bacterial solution of recombinant strain 1. M is 5000 bp DNA marker, and lane 2 is PAAS-YjiA fragment;

[0031] Figure 5 This is the PCR electrophoresis diagram of the bacterial solution for constructing the recombinant strain 2. M is a 5000 bp DNA marker and lane 1 is the TryDC2-YjiA fragment. DETAILED DESCRIPTION

[0032] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments.

[0033] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the present invention should be understood by people with ordinary skills in the field to which the present invention belongs. The words "first", "second" and similar words used in the present invention do not indicate any order, quantity or importance, but are only used to distinguish different components. The words "include" or "comprise" and similar words mean that the elements or objects appearing before the word include the elements or objects listed after the word and their equivalents, without excluding other elements or objects.

[0034] Example 1

[0035] Construction of recombinant strain 1

[0036] Using Bacillus subtilis 168 as the original strain, follow the steps below:

[0037] The whole genome of rose leaves was extracted using the Easy Extraction plant genomic DNA rapid extraction kit; the whole genome of Bacillus subtilis was extracted using the Tiangen bacterial whole genome extraction kit and stored in a -4°C refrigerator.

[0038] 2. The first primer set was designed using the phenylacetaldehyde synthase gene of rose (shown in SEQ ID No: 1) and the YjiC gene of Bacillus subtilis (shown in SEQ ID No: 3) as the target gene. The first primer set was designed as follows:

[0039] Primer-F 5'-CGGGGTACCATGGGTAGCTTCCCATTCC 3' (SEQ ID No: 4)

[0040] Primer-R 5'-CCCCCTCAATACGTGCTGAGGATGG 3' (SEQ ID No: 5)

[0041] Primer-F 5'-GGAGGGGTGGCAGCACAGACTG 3' (SEQ ID No: 6)

[0042] Primer-R 5'-CGG GAATTC TTATAATGTAATGTGTTTTTCGTTGGC 3' (SEQ ID No: 7)

[0043] Using rose leaf and Bacillus subtilis whole genome DNA as templates, PCR amplification was performed using Taq DNA polymerase, and the target fragments were approximately 1527 bp and 279 bp, respectively. The obtained target fragments were then fused using Taq DNA polymerase.

[0044] E. coli was inoculated into liquid LB medium containing 50 μg / μL ampicillin and cultured overnight (12-16 h) in a 37°C constant temperature incubator. Plasmid PHY-P43 was extracted using a plasmid extraction kit and stored in a -20°C refrigerator.

[0045] The expression vector PHY-P43 was digested with KpnI and EcoRI, and then ligated with the fusion fragment with primers containing KpnI and EcoRI restriction sites under the action of T4 DNA ligase to form the recombinant vector PHY-PAAS-YjiA.

[0046] 5. The obtained recombinant vector PHY-PAAS-YjiA was transformed into Bacillus subtilis using the Sipizizen transformation method, and the transformants were screened using 25 μg / μL tetracycline resistance. After successful verification by bacterial liquid PCR, the recombinant strain 1 producing tyrosol and salidroside was obtained.

[0047] Example 2

[0048] Construction of recombinant strain 2

[0049] Using Bacillus subtilis as the original strain, follow the steps below:

[0050] The whole genome of parsley leaves was extracted using the Easy Extraction plant genomic DNA rapid extraction kit, and the whole genome of Bacillus subtilis was extracted using the Tiangen bacterial whole genome extraction kit and stored in a -4°C refrigerator.

[0051] 2. The second primer set was designed with the tyrosine decarboxylase gene of parsley (shown in SEQ ID No: 2) and the YjiA gene of Bacillus subtilis (shown in SEQ ID No: 3) as the target gene. The second primer set was designed as follows:

[0052] Primer-F 5'-CGGGGTACCAAAATGGGGTCAATAGATAATCTGAC 3' (SEQ ID No: 8)

[0053] Primer-R 5'-CTGCCACCCCTCCCACACAATTAAAAAATCGATATATATAACAAT 3'(SEQ IDNo: 9)

[0054] Primer-F 5'-GGAGGGGTGGCAGCACAGACTG 3' (SEQ ID No: 10)

[0055] Primer-R 5'-CGG GAATTC TTATAATGTAATGTGTTTTTCGTTGGCG 3'(SEQ ID No: 11)

[0056] Using parsley leaves and Bacillus subtilis whole genome DNA as templates, PCR amplification was performed using Taq DNA polymerase, and the target fragments were approximately 1671 bp and 279 bp. The obtained target fragments were then fused using Taq DNA polymerase.

[0057] 3. Inoculate E. coli into liquid LB medium containing 50 μg / μL ampicillin and culture in a 37°C constant temperature incubator overnight (12-16 hours). Use a plasmid extraction kit to extract plasmid PHY-P43 and store it in a -20°C refrigerator.

[0058] 4. The expression vector PHY-P43 was digested with KpnI and EcoRI, and then ligated with the fusion fragment containing KpnI and EcoRI restriction sites using primers under the action of T4 DNA ligase to form the recombinant vector PHY-TryDC2-YjiA.

[0059] 5. The obtained recombinant vector PHY-TryDC2-YjiA was transformed into Bacillus subtilis using the Sipizizen transformation method, and the transformants were screened using 25 μg / μL tetracycline resistance. After successful verification by bacterial liquid PCR, the recombinant strain 2 was obtained.

[0060] Fermentation of recombinant strain 1 for synthesis of tyrosol and salidroside

[0061] Pick a single colony of recombinant bacteria 1 from the slant medium and culture it in 50mL LB seed medium, and culture it at 37℃, 220r / min constant temperature shaking for 12h. The seed liquid of the original strain and recombinant bacteria 1 were inoculated into the fermentation medium at an inoculation rate of 2%-3%. The components of the shake flask fermentation medium are: glucose 25g / L, NaCl 10g / L, peptone 10g / L, yeast extract 5g / L, trace elements 2mL / L, tetracycline 25μg / μL, pH 7.0-7.2, 500mL triangular bottle liquid volume is 50mL, the incubator speed is 200r / min, and culture is 37℃ for 72h. Obtain fermentation broth 0 and 1 of the original strain and recombinant bacteria 1.

[0062] Fermentation of recombinant strain 2 for synthesis of tyrosol and salidroside

[0063] Pick a single colony of the recombinant strain 2 from the slant culture medium and culture it in 50mL LB seed culture medium, and culture it at 37℃, 220r / min constant temperature shaking for 12h. The seed solution of the original strain and the recombinant bacteria 2 was inoculated into a 250mL conical flask containing 50mL fermentation medium at an inoculation rate of 2%-3%. The components of the shake flask fermentation medium are: glucose 25g / L, NaCl 10g / L, peptone 10g / L, yeast extract 5g / L, trace elements 2mL / L, tetracycline 25μg / μL, pH 7.0-7.2, 250mL triangular bottle liquid volume is 50mL, the incubator speed is 200r / min, and the culture is 30℃ for 72h. Obtain the fermentation broth 0 and 2 of the original strain and recombinant bacteria 2.

[0064] Detection method of tyrosol and salidroside:

[0065] The tyrosol and salidroside in the supernatant of the fermentation broth were detected using an HPLC-UV system (Shimadzu). After the fermentation was completed, the fermentation broth and the bacteria were separated by centrifugation. 2 mL of the fermentation supernatant was centrifuged at 12000 rpm for 10 min. The supernatant was filtered with a 0.22 μm organic membrane and then detected with a C18 column (250×4.6 mm, 5 μm). The injection volume was 10 μL, the detection wavelength was 280 nm, the column temperature was 30 ° C, and the flow rate was 0.5 mL / min. Mobile phase A was 0.1% trifluoroacetic acid and B was 100% methanol. The liquid phase elution program used gradient elution, as shown in Table 1:

[0066] Table 1: Liquid phase elution program

[0067]

[0068] The yields of tyrosol and salidroside in the fermentation broth were detected by HPLC, and it was found that neither tyrosol nor salidroside was detected in the original strain fermentation broth 0. The tyrosol yield in fermentation broth 1 was 23.07±0.42 mg / L, and the salidroside yield was 36.91±0.29 mg / L. The tyrosol yield in fermentation broth 2 was 11.18±0.23 mg / L, and the salidroside yield was 47.64±0.34 mg / L.

[0069] Those skilled in the art should understand that the discussion of any of the above embodiments is only exemplary and is not intended to imply that the scope of the present invention is limited to these examples; under the concept of the present invention, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes in different aspects of the present invention as described above, which are not provided in detail for the sake of simplicity. Any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for constructing a recombinant Bacillus subtilis, characterized in that: The steps include: S1, extract the whole genome of parsley and / or rose leaves, and extract the whole genome of Bacillus subtilis; S2, designing a first primer set with parsley tyrosine decarboxylase and Bacillus subtilis YjiA as target genes, and / or designing a second primer set with rose phenylacetaldehyde synthase and Bacillus subtilis YjiA as target genes, and using the whole genomes of parsley and rose leaves and the whole genome of Bacillus subtilis as templates to amplify the target gene fragments by PCR respectively; S3, connecting the target gene fragment with an expression vector to construct a recombinant vector for expressing tyrosine decarboxylase and YjiA and / or phenylacetaldehyde synthase and YjiA activity; S4. The recombinant vector is used to transform Bacillus subtilis, and the transformants are selected using the resistance gene to obtain a recombinant Bacillus subtilis strain.

2. The method for constructing a recombinant Bacillus subtilis according to claim 1, characterized in that: The first primer set includes the nucleotide sequences shown in SEQ ID Nos: 4-7; the second primer set includes the nucleotide sequences shown in SEQ ID Nos: 8-11.

3. The method for constructing a recombinant Bacillus subtilis according to claim 1, characterized in that: The expression vector is PHY-P43.

4. The method for constructing a recombinant Bacillus subtilis according to claim 1, characterized in that: The transformation method described in S4 is electroporation transformation or Sipizizen transformation method.

5. A recombinant Bacillus subtilis, characterized in that: The recombinant Bacillus subtilis is obtained by the construction method of any one of claims 1 to 4.

6. Use of the recombinant Bacillus subtilis according to claim 5 in the fermentation production of tyrosol and salidroside.

7. The use according to claim 6, characterized in that: The method for producing tyrosol and salidroside by fermentation is to firstly carry out slant culture on the recombinant Bacillus subtilis, then carry out seed culture, and finally carry out fermentation culture to obtain tyrosol and salidroside.

8. The use according to claim 7, characterized in that: The temperature of the slant culture was 37°C.

9. The use according to claim 7, characterized in that: In the fermentation culture, the seed liquid after seed culture is inoculated into the fermentation medium at an inoculation rate of 2-3%.

Images