Method for preparing fluorescent protein labeled bacillus megatherium by utilizing protoplast transformation and application of fluorescent protein labeled bacillus megatherium
The EGFP tag was transformed to Bacillus mega by protoplast transformation, which solved the problem of fluorescent labeling instability, achieved efficient and simple fluorescent labeling methods, and promoted the application of Bacillus mega in environmental repair and biotechnology.
Patent Information
- Application Number
- CN202411988520.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-04-08
AI Technical Summary
The prior art transforms fluorescent protein genes to Bacillus mega, with low conversion efficiency, resulting in unstable fluorescent labeling, limiting the in-depth study and application of Bacillus mega behavior in complex environments.
Protoplast transformation method was used to ligate the enhanced green fluorescent protein (EGFP) tag to the expression vector, and protoplasts were formed by lysozyme treatment, and genetic transformation was achieved under the mediation of PEG, improving transformation efficiency and stability.
An efficient and simple fluorescent labeling method is realized, ensuring stable integration and long-term expression of fluorescent protein genes, providing a reliable tool to track the behavior of Bacillus megali, and promoting its application in environmental repair and biotechnology.
Smart Images
Figure CN119776399A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial genetic engineering, and particularly relates to a method for preparing fluorescent protein-labeled Bacillus megaterium by using protoplast transformation and application thereof. Background Art
[0002] Salix interga is not only of great value in the construction of landscapes, but also widely used in the ecological restoration of abandoned mines and mine parks due to its strong resistance and absorption capacity to a variety of heavy metals. It creates landscapes and plays an ecological restoration role at the same time. However, like other fast-growing woody plants, the heavy metals absorbed by Salix interga are mainly enriched in the roots, and the concentration of heavy metals in the roots can reach 10 to 30 times that of the aboveground parts. The low transport coefficient weakens its restoration efficiency and seriously hinders the large-scale promotion and application of Salix interga. Bacillus megaterium is an important industrial microorganism widely used in biodegradation, biotransformation and bioremediation. It has been confirmed that inoculation with Bacillus megaterium B6 can significantly promote the efficiency of Salix interga in transporting Pb. However, due to the lack of effective labeling and tracking methods, the colonization dynamics and mechanism of action of Bacillus megaterium B6 are not clear, which also limits the in-depth study and application of its behavior in complex environments.
[0003] At present, the methods for labeling microorganisms mainly include radioisotope labeling, antibiotic resistance labeling, and fluorescent protein gene labeling. Radioisotope labeling has high sensitivity and can track the distribution and migration of microorganisms in the environment. However, radioactive elements have a half-life, require special treatment, have safety hazards, and the labeling process is complicated and costly. Antibiotic resistance markers are easy to screen and identify, and are suitable for the construction and screening of genetically engineered bacteria. Long-term use of antibiotic resistance markers may cause microorganisms to develop resistance to antibiotics, affecting ecological balance and human health. Fluorescent protein gene labeling is intuitive, and the distribution and number of microorganisms can be directly observed under a fluorescence microscope. It is easy to track and quantitatively analyze, and has been widely used in microbial colonization research in recent years.
[0004] The methods for transferring the recombinant vector to Bacillus megaterium mainly include chemical transformation, electroporation and protoplast transformation. The chemical transformation method has relatively few steps, usually including preparing competent cells, adding recombinant vectors and DNA ligase, heat shock or ice bath, etc., and the operation is relatively simple. However, affected by various factors such as cell state, plasmid concentration, reagent quality, etc., the transformation efficiency of the chemical transformation method is low, and large molecular weight plasmids or certain special types of plasmids may be difficult to successfully transfer into Bacillus megaterium through chemical transformation. The electroporation method forms tiny holes in the cell membrane by applying a short electric field pulse, allowing the recombinant vector to enter the cell, thereby obtaining a higher transformation efficiency. However, the electroporation method requires the use of special equipment such as an electroporator, which is expensive, and requires precise control of parameters such as electric field strength and pulse time, and the operation is relatively complicated. In addition, the electroporation process may cause certain damage to the cells, affecting the growth and expression of the transformed cells. Existing transformation methods may cause DNA damage or host cell death, causing fluorescent protein-labeled microorganisms to be unstable under specific environmental conditions. Design a stably replicated expression vector to ensure the long-term expression of the marker gene in the host cell. The expression of fluorescent markers in Bacillus megaterium is often unstable, making it difficult to track and study. Existing methods often face the problem of low transformation efficiency when transforming fluorescent protein genes into Bacillus megaterium. Summary of the invention
[0005] To solve the above technical problems, the present invention proposes a method for preparing fluorescent protein-labeled Bacillus megaterium by protoplast transformation and its application, provides an efficient and simple fluorescent labeling method, and opens up a new path for the research and application of Bacillus megaterium, which has important scientific and practical application value.
[0006] To achieve the above object, the present invention provides a method for preparing fluorescent protein-labeled Bacillus megaterium by protoplast transformation, comprising the following steps:
[0007] (1) Connecting the EGFP tag to the expression vector to obtain a recombinant expression plasmid;
[0008] (2) centrifuging the Bacillus megaterium bacterial solution, resuspending the precipitate to obtain a resuspended bacterial solution; mixing the resuspended bacterial solution with lysozyme, culturing, and washing 2 to 3 times to obtain Bacillus megaterium protoplasts;
[0009] (3) The recombinant expression plasmid obtained in step (1) is transformed into the Bacillus megaterium protoplasts obtained in step (2), and single colonies with green fluorescence are selected by tetracycline resistance screening and fluorescence microscopy observation, and sequencing is performed to verify that the EGFP tag has been inserted, thereby obtaining fluorescent protein-labeled Bacillus megaterium.
[0010] Preferably, the step (1) of connecting the EGFP tag to the expression vector specifically comprises: using T4 DNA ligase to transfer the EGFP tag into the expression vector to obtain a recombinant expression plasmid, wherein the EGFP tag is located between the BamHI and NgoMIV-SphI restriction enzyme sites of the expression vector.
[0011] Preferably, the expression vector in step (1) is a pHIS1525 vector.
[0012] Preferably, the OD of the Bacillus megaterium solution in step (2) is 600 value ≥ 1.0; the centrifugal temperature in step (2) is 0-4°C, the centrifugal speed is 3500-4500 rpm, and the centrifugal time is 10-20 min; the resuspension in step (2) adopts SMMP culture medium.
[0013] Preferably, the Bacillus megaterium bacterial solution in step (2) is Bacillus megaterium B6 bacterial solution.
[0014] Preferably, the amount of lysozyme used in step (2) is such that after the resuspended bacterial solution is mixed with the lysozyme, the final concentration of the lysozyme is 0.1 mg / mL.
[0015] Preferably, the culture temperature in step (2) is 37° C., the culture speed is 90 to 110 rpm, and the culture time is 20 to 40 min.
[0016] Preferably, the washing in step (2) uses SMMP medium.
[0017] Preferably, in step (3), the volume ratio of the recombinant expression plasmid to the Bacillus megaterium protoplasts is 1:50.
[0018] The present invention also provides the method for preparing fluorescent protein-labeled Bacillus megaterium and application of the fluorescent protein-labeled Bacillus megaterium prepared by the method in observing the behavior activities of Bacillus megaterium.
[0019] Compared with the prior art, the present invention has the following advantages and technical effects:
[0020] The present invention adopts enhanced green fluorescent protein (EGFP), which is a mutant of GFP and has advantages in fluorescence intensity, stability, easy expression and wide application. The xylose inducible promoter of the expression vector pHIS1525 is adopted, and its working principle is that after adding xylose, the xylose repressor encoded by the xylR gene on the plasmid is released from PxylA, thereby initiating transcription to transfer the EGFP tag to the pHIS1525 vector, and obtaining a recombinant expression vector with a 6xHis tag for expressing a fusion protein with a His tag, which is convenient for subsequent protein purification and detection.
[0021] Protoplast transformation technology uses enzymes such as lysozyme to remove cell walls and form spherical protoplasts. Under the mediation of PEG, exogenous DNA can coagulate with protoplasts to achieve genetic transformation. The present invention adopts protoplast transformation method to reduce damage to DNA and improve transformation efficiency and stability. EGFP with more advantages in terms of fluorescence intensity, stability, easy expression and wide application is selected to construct an expression vector. The pHIS1525 vector plasmid carrying a xylose promoter is selected to be more easily expressed in Bacillus megaterium. At the same time, the protoplast transformation process is optimized to improve transformation efficiency, promote the repeatability of experimental operations, and ensure the stable integration of fluorescent protein genes.
[0022] In view of the unclear colonization dynamics of Bacillus megaterium B6 in Salix babylonica and its mechanism of promoting lead transport, we successfully constructed a fluorescent protein gene-labeled Bacillus megaterium, laying the foundation for in-depth research and application of its behavior in complex environments.
[0023] The present invention not only provides an efficient and simple fluorescent labeling method, but also opens up a new path for the research and application of Bacillus megaterium B6, and has important scientific and practical application value.
[0024] (1) Through fluorescent protein labeling, Bacillus megaterium can be observed intuitively under a fluorescence microscope. This intuitiveness greatly simplifies experimental operations and enables researchers to monitor the behavior and distribution of bacteria in real time.
[0025] (2) Fluorescent labeling allows the behavior of Bacillus megaterium to be tracked in real time under various environmental conditions, including in natural environments such as soil, water, or plant rhizosphere. This is crucial for understanding the ecological functions and environmental adaptability of bacteria.
[0026] (3) The present invention provides a tool that enables researchers to study the behavior of Bacillus megaterium in the environment, including its survival, reproduction and metabolic activities under different environmental pressures.
[0027] (4) By tracking fluorescently labeled bacteria, the role of Bacillus megaterium in the ecosystem can be analyzed, such as its function in biodegradation, bioremediation, and nitrogen cycling.
[0028] (5) The method of the present invention is helpful to evaluate the application potential of Bacillus megaterium in the fields of agriculture, environmental management and biotechnology.
[0029] (6) By observing the growth of fluorescently labeled bacteria, the culture conditions can be optimized and the production efficiency and application effect of Bacillus megaterium can be improved. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0031] Figure 1 The schematic diagram of the structure of the recombinant plasmid pHIS1525-EGFP is shown in Figure 1, where A is the structure diagram and B is the composition diagram;
[0032] Figure 2 The morphology and fluorescence expression of Bacillus megaterium strain B6, where A is the plate count strain, B is the fluorescence expression of the plate count strain, C is B6-EGFP, and D is the fluorescence expression of B6-EGFP. The scale bar is 20 μm.
[0033] Figure 3 This is the electrophoresis diagram for PCR verification of the fluorescent EGFP-labeled engineered bacteria of Bacillus megaterium.
[0034] Figure 4 The colonization characteristics of the strain in various parts of Salix pumila under laser confocal microscopy, where A is the root, B is the branch, and C is the leaf;
[0035] Figure 5 The figure shows the dynamic changes in the number of colonization of strain B6-EGFP in various parts of Salix pumila, where A is the leaf, B is the branch, C is the root, and D is the rhizosphere soil. DETAILED DESCRIPTION
[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0037] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0038] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0039] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.
[0040] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0041] Example 1
[0042] Fluorescent protein labeling of Bacillus megaterium B6
[0043] 1. Construction of recombinant expression vector
[0044] The EGFP tag was transferred into the pHIS1525 vector using T4 DNA ligase to obtain the recombinant expression plasmid pHIS1525-EGFP ( Figure 1 Middle A and Figure 1 (As shown in B). The full-length fragment of the fluorescent marker gene EGFP is located between the two restriction enzyme sites of BamHI and NgoMIV-SphI of the vector pHIS1525.
[0045] 2. Preparation of Protoplasts of Bacillus megaterium B6
[0046] Pick a single colony from the recently activated Bacillus megaterium B6 plate and transfer it to a 50 mL centrifuge tube containing 10 mL LB medium. Incubate the culture at 37°C with shaking at 200 rpm / min for 9 h. Avoid culturing for too long, which may cause the strain to enter the stable phase.
[0047] Take 0.5 mL of the cultured bacterial solution and add it to a 250 mL Erlenmeyer flask containing 50 mL of LB medium. Incubate at 37 °C and 200 rpm / min for 3.5 h until the OD value of the bacterial solution reaches 0. 600 When the value reaches 1.0, Bacillus megaterium B6 bacterial solution is obtained;
[0048] The Bacillus megaterium B6 bacterial solution was centrifuged at 4000 rpm and 4°C for 15 min, the supernatant was discarded, and the precipitate was resuspended with 5 mL of freshly prepared SMMP medium, and the resuspended bacterial solution was then added with lysozyme that had been sterilized by filtration in advance to make the final concentration of lysozyme 0.1 mg / mL, and then cultured at 37°C and 100 rpm for 30 min to obtain Bacillus megaterium B6 protoplasts;
[0049] Observe the protoplasts of Bacillus megaterium B6 under a biological microscope to ensure that most of the bacteria have entered the protoplast morphology and are round;
[0050] After the microscopic examination is correct, wash the protoplasts twice with freshly prepared SMMP medium. Be careful to avoid shaking during the washing process; resuspend in 5 mL of freshly prepared SMMP medium after washing, and be careful to avoid shaking, and then use it directly for transformation; if you want to preserve it, you must examine it under a microscope before each use to confirm that the bacteria are still in the protoplast form.
[0051] The nucleotide sequence of 16sRNA obtained from Bacillus megaterium B6 is: GGTGAGCAGCCAGTTTTTAGATGAACTGGCAGACATTGTGGAAGAAGAAAAGATAGATGCTATTCTCATGGCGGGAGATGCCTTTGATACGGTTAACCCTCCAGCAGCGGCAGAGCAGCTTTTTTACGAAAGTATGTCTAGGTTGAGCAACAATGGAAGACGTCCGATTATTGTTATTGCAGGTAATCATGATAACCCAGATCGGCTGTCGGCGCGGTATTTTACAAA (SEQ ID NO.1).
[0052] 3. Transform the recombinant expression plasmid pHIS1525-EGFP into Bacillus megaterium B6 protoplasts
[0053] Add 10 μL of pHIS1525-EGFP to 20 μL of freshly prepared SMMP medium, incubate in a 37°C water bath for 20 min, add 500 μL of Bacillus megaterium B6 protoplasts, and transfer the mixture to a 50 mL sterile centrifuge tube pre-filled with 1.5 mL of PEG6000-P. Carefully rotate the centrifuge tube to mix the mixture, avoid shaking, and leave at room temperature for 2 min;
[0054] Add 5 mL of freshly prepared SMMP medium, swirl carefully to mix, centrifuge at 3000 rpm for 10 min at room temperature, and immediately remove the supernatant; then add 500 μL of SMMP medium and mix carefully by pipetting, transfer to a 1.5 mL sterile EP tube, and culture at 37°C and 80 rpm for 90 min;
[0055] Add all the cultured bacterial solution to 2.5 mL of CR5-top-agar medium preheated and dissolved in a water bath, with the overall temperature not exceeding 43°C; carefully invert to mix, then take 100 μL of the mixture and spread it on a tetracycline-resistant LB plate (10 μg / mL), and culture at 37°C until single colonies appear. Select single colonies that emit green fluorescence under a fluorescence microscope and transfer them to a fresh tetracycline-resistant LB plate;
[0056] The selected single clones were cultured continuously in non-selective medium to test the stability of fluorescent protein expression (such as Figure 2 Middle A and Figure 2 After each generation of culture, the fluorescence intensity was detected using a fluorescence microscope (e.g. Figure 2 Medium B and Figure 2 D) to ensure stable expression; DNA was extracted and the insertion of the fluorescent protein gene was confirmed by PCR gel electrophoresis. The primer sequences for PCR detection are shown in Table 1 below.
[0057] Table 1 Primer sequences
[0058] Primers Serial Number Sequence (5'-3') Upstream primer SEQ ID NO.2 tcgagtagcctgcattcttatt Downstream primer SEQ ID NO.3 gtcttgtagttgccgtcgt
[0059] like Figure 3 As shown, the gel electrophoresis image shows a verification band, confirming that the fluorescent protein is labeled with Bacillus megaterium B6 (strain B6-EGFP).
[0060] Experimental Example 1
[0061] Observation of the colonization position of strain B6-EGFP prepared in Example 1 on the roots, branches and leaves of Salix pumila
[0062] Select cuttings of willow of uniform size, strong growth, about 20 cm. After disinfection, hydroponically place them in a sealed water tank filled with 20L of a quarter Hoagland nutrient solution, supply oxygen with an oxygen pump throughout the process, and change the nutrient solution once a week. After 30 days of hydroponics, the cuttings take root and grow steadily, and then soak the roots in 1×10 7 CFU·mL -1 of B6-EGFP bacterial suspension for 48h. Samples were taken from the roots, branches and leaves of Salix babylonica treated with CK and inoculated bacteria on the 4th, 6th, 8th and 10th days after inoculation, and mixed samples were taken from 3 plants in each treatment, with 1 plant as 1 replicate, and a total of 3 replicates were set up. Use a sharp double-sided blade to make longitudinal and transverse sections of the root system; use a double-sided blade to make freehand flat sections on the young branches (cross section); make sections at 12%-24%, 24%-36%, 36%-48% and 48%-60% from the leaf base, and then press the slices. Place the slices of roots, branches and leaves in ddH 2O in a culture dish, select slices of appropriate thickness and place them on a slide, add a few drops of distilled water and seal the slide. A laser confocal microscope (LCM900, Zeiss) was used to observe the colonization position of strain B6-EGFP, with the fluorescence channel being EGFP, the excitation wavelength being 488 nm, and the detection wavelength being 500-600 nm.
[0063] like Figure 4 Middle A, Figure 4 Medium B and Figure 4 As shown in C, the colonization characteristics of strain B6-EGFP in various parts of Salix pylori under a laser confocal microscope.
[0064] Experimental Example 2
[0065] The colonization dynamics of strain B6-EGFP prepared in Example 1 in the roots, branches and leaves of Salix pumila
[0066] A pot experiment (flower pot h = 30cm, d = 30cm) was conducted, and four experimental treatments were set up, namely CK: control group, no inoculation of strain B6-EGFP; TP: only the root system of Salix chinensis was inoculated with strain B6-EGFP, and the soil was not inoculated; TS: only the soil was inoculated with strain B6-EGFP, and the root system of Salix chinensis was not inoculated; TA: the root system and soil of Salix chinensis were inoculated with strain B6-EGFP at the same time. Hydroponic rooted Salix chinensis seedlings with consistent growth were selected for experimental treatment. The roots of the TA and TP treatment groups were immersed in 1×10 7 CFU·mL -1 The CK and TS groups were inoculated with inactivated B6-EGFP bacterial suspension for 48 h. The seedlings of the inoculated / uninoculated strains were then moved into pots filled with 25 kg of soil. The B6-EGFP bacterial suspension was applied to each pot of soil in the TS and TA treatment groups at a final concentration of 1 × 10 7 CFU·g -1 , CK and TP treatment groups were treated with the same concentration of inactivated B6-EGFP bacterial suspension. Each treatment had 15 replicates, each pot was 1 replicate, and a total of 60 pots. The potting materials were randomly placed in the canopy and rearranged regularly. The same management measures were taken for all treatments during the experiment.
[0067] Collect 0.2g of Salix pomegranate root, branch and leaf samples at 3, 7, 10, 14, 20, 25, 30 and 40 days after transplanting, and follow the steps below. Step 1: Disinfect the sample surface: ① Soak in 75% alcohol for 1 min; ② Soak in 1% sodium hypochlorite for 5 min; ③ Wash with sterile water 3 times. To ensure that the surface of the plant sample is disinfected cleanly, take the sterile water from the last wash and coat the plate. Step 2: Grind the sample: Grind with a sterile mortar and sterile water on a clean bench, and dilute to 10 -1 , 10 -2The third step is to coat the plate: take 50 μL of grinding solution of each concentration and coat the tetracycline-resistant plate, and culture at 37°C for 36 hours. The fourth step is to count and observe: count B6-EGFP under an inverted fluorescence microscope (T12-U) based on the characteristics of the colonies and the fluorescence characteristics.
[0068] The number of strain B6-EGFP colonized in various tissues of Salix pumila showed a trend of first increasing and then decreasing. After decreasing to a certain extent in the root system of Salix pumila, it tended to stabilize (e.g. Figure 5 Middle A, Figure 5 Medium B and Figure 5 Middle C). The number of colonization of strain B6-EGFP in different parts of Salix pumila showed roots>leaves>branches. Among the different inoculation methods, the number of colonization in the TA treatment group was the highest throughout the process.
[0069] On the 3rd day of inoculation, strain B6-EGFP was detected in the roots of TP and TA groups. On the 7th day of inoculation, strain B6-EGFP was detected in the branches and leaves of TP and TA groups and in the roots of TS group. On the 10th day of inoculation, strain B6-EGFP was detected in the branches and leaves of TS group. This indicates that it takes a certain amount of time for strain B6-EGFP to transfer from the root system to the aboveground parts.
[0070] In the leaves of Salix babylonica, the TP group reached the peak of colonization on the 20th day, which was 7.50×10 3 CFU·g -1 The TS and TA groups reached their peak values on the 25th day, which were 6.50×10 3 and 9.00×10 3 CFU·g -1 In the branches of Salix pylori, the TP and TA groups reached their peak values on the 20th day, which were 3.75×10 3 and 5.67×10 3 CFU·g -1 The TS group reached its peak colonization on the 25th day, with a value of 3.33×10 3 CFU·g -1 In the roots of Salix pylori, the TP and TA groups reached their peak values on the 14th day, which were 1.70×10 4 and 2.10×10 4 CFU·g -1 The TS group reached the peak of colonization on the 20th day, which was 1.58×10 4 CFU·g -1 .
[0071] Experimental Example 3
[0072] Example 1 Colonization dynamics of strain B6-EGFP in rhizosphere soil of Salix pumila
[0073] The experimental setting is the same as that of Experiment 2. Take 0.5 g of rhizosphere soil and put it into a sterilized 50 mL centrifuge tube. Follow the steps below. Step 1: Shake culture: Add 20 mL of sterile deionized water and incubate at 25 °C and 180 r / min. -1 The second step is dilution: take the shaken solution and dilute it to 10 -1 , 10 -2 , 10 -3 The third step is to coat the plate: the same as in Experiment 2. The fourth step is to count and observe: the same as in Experiment 2.
[0074] The number of strain B6-EGFP colonized in the rhizosphere soil of Salix pumila first increased and then decreased, and then stabilized after decreasing to a certain extent (e.g. Figure 5 D). On the 3rd day of inoculation, strain B6-EGFP was detected in the rhizosphere soil of TS and TA groups. On the 7th day of inoculation, strain B6-EGFP was detected in the rhizosphere soil of TP group. Among the different inoculation methods, the peak values of TP, TS and TA groups were 1.17×10 5 , 1.58×10 5 and 2.08×10 5 CFU·g -1 , and the colonization number of the TA treatment group was the highest throughout the process.
[0075] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A method for preparing fluorescent protein-labeled Bacillus megaterium by protoplast transformation, characterized in that: The following steps are involved: (1) Connecting the EGFP tag to the expression vector to obtain a recombinant expression plasmid; (2) centrifuging the Bacillus megaterium bacterial solution, resuspending the precipitate to obtain a resuspended bacterial solution; mixing the resuspended bacterial solution with lysozyme, culturing, and washing 2 to 3 times to obtain Bacillus megaterium protoplasts; (3) The recombinant expression plasmid obtained in step (1) is transformed into the Bacillus megaterium protoplasts obtained in step (2), and single colonies with green fluorescence are selected by tetracycline resistance screening and fluorescence microscopy observation, and sequencing is performed to verify that the EGFP tag has been inserted, thereby obtaining fluorescent protein-labeled Bacillus megaterium.
2. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1, characterized in that: The step (1) of connecting the EGFP tag to the expression vector is specifically as follows: the EGFP tag is transferred into the expression vector using T4 DNA ligase to obtain a recombinant expression plasmid, wherein the EGFP tag is located between the two restriction enzyme sites of BamHI and NgoMIV-SphI of the expression vector.
3. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1 or 2, characterized in that: The expression vector in step (1) is pHIS1525 vector.
4. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1, characterized in that: The OD of the Bacillus megaterium solution in step (2) 600 value ≥ 1.0; the centrifugal temperature in step (2) is 0-4°C, the centrifugal speed is 3500-4500 rpm, and the centrifugal time is 10-20 min; the resuspension in step (2) adopts SMMP culture medium.
5. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1 or 4, characterized in that: The Bacillus megaterium liquid in step (2) is Bacillus megaterium B6 liquid.
6. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1, characterized in that: The amount of lysozyme used in step (2) is such that after the resuspended bacterial solution is mixed with the lysozyme, the final concentration of the lysozyme is 0.1 mg / mL.
7. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1, characterized in that: The culture temperature in step (2) is 37° C., the culture speed is 90 to 110 rpm, and the culture time is 20 to 40 min.
8. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1, characterized in that: The washing in step (2) uses SMMP culture medium.
9. The method for preparing fluorescent protein-labeled Bacillus megaterium according to claim 1, characterized in that: The volume ratio of the recombinant expression plasmid to the Bacillus megaterium protoplasts in step (3) is 1:
50.
10. Use of the fluorescent protein-labeled Bacillus megaterium prepared by the method for preparing fluorescent protein-labeled Bacillus megaterium according to any one of claims 1 to 9 in observing the behavior of Bacillus megaterium.