Method for preparing antibacterial peptide

Abstract

The embodiment of the invention discloses a method for preparing antibacterial peptide. The method comprises the following steps: mixing a seed solution containing transformed pichia pastoris with a basic culture medium to obtain a first mixture, and carrying out first-stage fermentation treatment; after the first-stage fermentation starts to reach a first preset condition, adding a fed-batch culture medium into the first mixture to obtain a second mixture; performing second-stage fermentation on the second mixture after the first-stage fermentation starts to reach a second preset condition; when the second-stage fermentation starts to a third preset condition, the fermentation is stopped, and the fermented second mixture is centrifuged to obtain the antibacterial peptide; wherein the temperature of the second-stage fermentation is 4-7 DEG C lower than that of the first-stage fermentation. In the embodiment of the invention, the antibacterial peptide is directly expressed through pichia pastoris, and a co-expression mode is adopted, so that the yield and the quality of the antibacterial peptide are effectively improved.

Description

Technical Field

[0001] The invention relates to the field of biological genetic engineering, and in particular to a method for preparing antimicrobial peptides. Background Art

[0002] Antimicrobial peptides are an emerging class of antibiotics that have strong bactericidal ability, low dosage, and no drug resistance. The current solution mainly uses E. coli to express antimicrobial peptides, which requires bacterial cell crushing and purification, and excision of fusion proteins to obtain antimicrobial peptides, which increases the complexity of the production process. In the E. coli expression system, due to the limited protein expression level and easy loss during the purification process, the final antimicrobial peptide yield is not high. Summary of the invention

[0003] In view of at least some of the problems and shortcomings in the prior art, the embodiments of the present invention disclose a method for preparing antimicrobial peptides, which effectively improves production efficiency and product quality.

[0004] A method for preparing an antimicrobial peptide provided by an embodiment of the present invention comprises: S2, mixing a seed solution containing transformed Pichia pastoris and a basal culture medium to obtain a first mixture for a first-stage fermentation treatment, wherein the transformed Pichia pastoris contains an antimicrobial peptide expression vector, the antimicrobial peptide expression vector contains a GAP promoter, the basal culture medium comprises a carbon source and a nitrogen source, the carbon source of the basal culture medium is 35 g / L-60 g / L of a polyol, and the nitrogen source of the basal culture medium is 2 g / L-6 g / L of a soluble ammonium salt.

[0005] S3. After the first stage fermentation starts and reaches the first preset condition, feed medium is added to the first mixture to obtain a second mixture.

[0006] S4. After the first stage fermentation starts and reaches a second preset condition, the second mixture is subjected to a second stage fermentation.

[0007] S5, the second stage fermentation starts and ends when the fermentation reaches the third preset condition, and the fermentation is completed by centrifuging the second mixture to obtain the antimicrobial peptide.

[0008] The temperature of the second stage fermentation is 4°C-7°C lower than that of the first stage fermentation.

[0009] In an embodiment of the present invention, the fermentation temperature in the first stage is 29.5°C to 30.5°C; the fermentation temperature in the second stage is 23.5°C to 24.5°C.

[0010] In an embodiment of the present invention, the carbon source of the basal culture medium is glycerol, and the nitrogen source of the basal culture medium is diammonium phosphate, ammonium sulfate or ammonium chloride; preferably, the nitrogen source is diammonium phosphate; the feed medium comprises a carbon source and a nitrogen source, the carbon source of the feed medium is 800g / L-1100g / L glycerol, and the nitrogen source of the feed medium is 10%-15% ammonia water.

[0011] In the embodiment of the present invention, the inoculation amount of the transformed Pichia pastoris is 0.5%; the OD 600 It is 9.0~11.0.

[0012] In an embodiment of the present invention, the first preset condition is that the basal medium is cultured for 16 hours or when the dissolved oxygen content in the basal medium drops rapidly for the first time, and the feed medium is added to the first mixture; the second preset condition is that the basal medium is cultured for 22 hours or when the glycerol content in the second mixture is less than 5 g / L; the third preset condition is that the basal medium is cultured for 96 hours or when the basal medium is cultured to OD 600 When the value no longer changes.

[0013] In an embodiment of the present invention, step S3 specifically includes: continuously adding the feed medium into the first mixture to obtain the second mixture until the fermentation is terminated.

[0014] In an embodiment of the present invention, the addition rate of glycerol in the feed medium is increased in a time gradient manner, and the glycerol in the feed medium is initially added at a rate of 5 g / L / h and is increased at a rate of 10% every 24 hours.

[0015] In an embodiment of the present invention, the rate of adding aqueous ammonia to the feed medium is determined according to the pH of the second mixture, and the pH of the second mixture is maintained at 4.5-5.5 by adding aqueous ammonia.

[0016] In an embodiment of the present invention, the basic culture medium includes the following components: 14.9 g / L magnesium sulfate heptahydrate, 4 g / L ammonium dihydrogen phosphate, 5 g / L potassium dihydrogen phosphate, 18.2 g / L potassium sulfate, 50 g / L glycerol, 0.5 g / L potassium hydroxide, 0.95 g / L calcium sulfate, trace elements and 0.2 g / L biotin.

[0017] In an embodiment of the present invention, the ratio of diammonium phosphate is 4 g / L.

[0018] In an embodiment of the present invention, the trace elements include: 6.0 g / L copper sulfate pentahydrate, 3.0 g / L manganese sulfate, 20.0 g / L zinc sulfate heptahydrate, 65.0 g / L ferrous sulfate heptahydrate, 0.2 g / L sodium molybdate dihydrate, 0.02 g / L boric acid, 0.5 g / L cobalt chloride dihydrate, 0.08 g / L potassium iodide and 5.0 ml / L sulfuric acid.

[0019] It can be seen from the above that the above technical features of the present invention can have one or more of the following beneficial effects:

[0020] In the process of studying the expression of ST-1 antimicrobial peptide by Pichia pastoris culture, the present invention unexpectedly found that the expression amount of antimicrobial peptide can be significantly improved through a specific culture process. In addition, by using Pichia pastoris to directly express antimicrobial peptides, the antimicrobial peptides can be directly secreted into the fermentation liquid during the fermentation process. After the fermentation is completed, a high-purity antimicrobial peptide solution can be obtained by centrifugation, without the need for complex bacterial cell crushing and purification steps, simplifying the production process and improving production efficiency. By dividing the fermentation process into different temperature stages for regulation, more energy and substances are prompted to flow to the synthesis of antimicrobial peptides. The antimicrobial peptides expressed by Pichia pastoris can maintain good activity and stability during the fermentation process, reducing the problem of product quality degradation caused by the complexity of the production process. By adopting a co-expression mode, Pichia pastoris directly expresses antimicrobial peptides without methanol induction, avoiding the influence of toxic methanol on fermentation, and reducing the probability of production safety accidents. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0022] Figure 1 A schematic flow chart of a method for preparing antimicrobial peptides provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the specific embodiments of the present invention and the corresponding drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0024] It should be noted that the terms "first", "second", etc. in the specification and claims of the present invention and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence. It should be understood that the terms used in this way can be interchangeable where appropriate, so that the embodiments of the present invention described herein can be implemented in an order other than those illustrated or described herein. In addition, the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions, for example, a process, method, system, product or device that includes a series of steps or units is not necessarily limited to those steps or units that are clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0025] It should also be noted that the division of multiple embodiments in the present invention is only for the convenience of description and should not constitute a special limitation. The features in various embodiments can be combined and referenced to each other without contradiction.

[0026] Embodiment 1

[0027] Reference Figure 1 As shown, a method for preparing an antimicrobial peptide provided by an embodiment of the present invention comprises:

[0028] S1. Inoculate the transformed Pichia pastoris into a seed liquid culture medium for culturing to prepare a seed liquid. The inoculation amount of the seed liquid is 0.5% of the seed liquid culture medium. The seed liquid culture medium is 2 L and cultured for 24 hours.

[0029] Table 1 Seed liquid culture medium preparation table

[0030]

[0031] S2, the seed solution containing the transformed Pichia pastoris (OD 600 =10±1)2L and 20L of basic culture medium are mixed to obtain a first mixture, which is added to a fermenter for a first stage fermentation treatment. The first stage fermentation temperature is controlled at 30°C, and the dissolved oxygen content is linked to the rotation speed. The dissolved oxygen is maintained at 40% by adjusting the rotation speed. The rotation speed adjustment range is 50rpm to 700rpm, and the pH is set to 5.0. The transformed Pichia yeast contains an antimicrobial peptide expression vector, and the antimicrobial peptide expression vector contains a GAP promoter. The GAP promoter sequence is:

[0032] ttttgtagaaatgtcttggtgtcctcgtccaatcaggtagccatctctgaaatatctggctccgttgcaactccgaacgacctgctggcaacgtaaaattctccggggtaaaacttaaatgtggagtaatggaaccagaa acgtctcttcccttctctctccttccaccgcccgttaccgtccctaggaaattttactctgctggagagcttcttctacggcccccttgcagcaatgctcttcccagcattacgttgcgggtaaaacggaggtcgtg(SEQ ID NO:1).

[0033] The antimicrobial peptide coding sequence:

[0034] aaauuuuuucguaaaauuaaaaaucuguugaaaaaacgugcaaaagaauuuuuuaaaaaacccguguuauugguugucuauucuu (SEQ ID NO: 2).

[0035] Prepare basal medium as shown in Table 2;

[0036] Table 2 Basic culture medium preparation table

[0037]

[0038] The trace elements in the basal culture medium include the following components: 6.0 g / L copper sulfate pentahydrate, 3.0 g / L manganese sulfate, 20.0 g / L zinc sulfate heptahydrate, 65.0 g / L ferrous sulfate heptahydrate, 0.2 g / L sodium molybdate dihydrate, 0.02 g / L boric acid, 0.5 g / L cobalt chloride dihydrate, 0.08 g / L potassium iodide and 5.0 ml / L sulfuric acid.

[0039] S3. 17 hours after the start of the first stage fermentation, feed medium is added to the first mixture to obtain a second mixture. The feed medium is configured according to Table 3.

[0040] Table 3 Preparation of feed medium

[0041]

[0042] Feed medium component 1 and component 2 are separately added to the feed bottle. When adding feed medium, the initial addition rate of glycerol is 5 g / L / h, and it is increased by 10% every 24 hours. The trace elements in the feed medium are the same as those in the basal medium, and will not be described in detail here.

[0043] S4, 24 hours after the start of the first stage fermentation, subjecting the second mixture to a second stage fermentation, wherein the second stage fermentation temperature is set at 26°C;

[0044] S5. The second stage fermentation starts and the fermentation is terminated after 96 hours. The fermented second mixture is centrifuged to obtain the antimicrobial peptides.

[0045] The test results at the end of the three batches of fermentation in this example are shown in Table 4, where OD 600 The content of antimicrobial peptides was measured by high performance liquid chromatography.

[0046] Table 4 Test results at the end of three batches of fermentation

[0047]

[0048]

[0049] As shown in Table 4, the OD of the three batches 600 The values ​​did not change much, ranging from 448 to 462, and the differences between batch 1, batch 2, and batch 3 were 14, 11, and 3, respectively. The antimicrobial peptide content of the three batches did not change much, ranging from 4.3 to 4.6 g / L, and the differences between batch 1, batch 2, and batch 3 were 0.3 g / L, 0.1 g / L, and 0.2 g / L, respectively. As can be seen from the above, the OD values ​​at the end of the three batches of fermentation were 600 The values ​​and antimicrobial peptide content vary little, indicating that under this fermentation process, the microbial growth density and antimicrobial peptide yield obtained in each fermentation are relatively stable, and similar results can be obtained each time the fermentation operation is performed according to the same process. This shows that the fermentation process in the present invention has reliability and good repeatability, and can stably produce products with a certain concentration of antimicrobial peptides.

[0050] Experimental Example 1

[0051] The Pichia pastoris expressing the antimicrobial peptide was cultured under substantially the same culture conditions as in Example 1, and the content of diammonium dihydrogen phosphate in the basal culture medium and / or the fermentation temperature of the second stage in Example 1 was adjusted to obtain a new fermentation scheme, which is shown in Table 5 below.

[0052] Table 5 Fermentation conditions

[0053] serial number Ammonium dihydrogen phosphate Second stage fermentation temperature Solution 1 1g / L 24℃ Solution 2 4g / L 28℃ Solution 3 4g / L 24℃

[0054] During the fermentation process, samples were taken at specific times to measure OD. 600 The results are shown in Table 6 below.

[0055] Table 6 OD value test results of fermentation process and antimicrobial peptide content of fermentation products

[0056]

[0057] From the above fermentation results, the concentration of antimicrobial peptides in the fermentation product obtained by fermentation under the fermentation conditions in Scheme 3 is significantly higher than that in Scheme 1 and Scheme 2, among which Scheme 3 is 44.8% higher than Scheme 1, and Scheme 3 is 37.9% higher than Scheme 2.

[0058] Comparative Example 1

[0059] BSM medium was used as the basic medium for fermentation to prepare antimicrobial peptides. The components of BSM medium are shown in Table 7. Other culture conditions in Comparative Example 1 were basically the same as those in Example 1.

[0060] Table 7 BSM medium composition

[0061] Element content <![CDATA[85%H3PO4]]> 26.7ml / L <![CDATA[CaSO4·2H2O]]> 0.93g / L <![CDATA[K2SO4]]> 18.2g / L <![CDATA[MgSO4·2H2O]]> 14.9g / L KOH 4.13g / L glycerin 40g / L PMT1 4.0ml / L

[0062] The components of PMT1 are shown in Table 8 below:

[0063] Table 8 PMT1 composition

[0064] Element content <![CDATA[CuSO4·5H2O]]> 6.0g / L KI 0.088g / L <![CDATA[MnSO4·H2O]]> 3.0g / L <![CDATA[Na2MoO4·2H2O]]> 0.2g / L <![CDATA[H3BO3]]> 0.02g / L <![CDATA[CoCl2·6H2O]]> 0.5g / L <![CDATA[ZnCl2]]> 20.0g / L <![CDATA[FeSO4·7H2O]]> 65.0g / L Biotin 0.2g / L <![CDATA[Concentrated H2SO4]]> 5.0ml

[0065] According to the results of three batches of fermentation, the content of antimicrobial peptides in the fermentation product obtained by fermentation using BSM medium was only 4.1 g / L, which was 7.5% lower than that in Example 1 and 29.3% lower than that in Solution 3.

[0066] Comparative Example 2

[0067] Methanol-trophic Pichia pastoris with AOX1 promoter was cultured to prepare antimicrobial peptides. The culture conditions were basically similar to those in Example 1. A 1% methanol solution was added as an inducer after 24 hours of culture, and a 1% methanol solution was added every 24 hours. After 96 hours of fermentation, a fermentation broth sample was taken for detection. The detection results showed that the yield of the antimicrobial peptide product was 4.2 g / L, which was 5.2% lower than that in Example 1.

[0068] According to the above experimental data, the antimicrobial peptide content obtained by fermentation based on the culture scheme of the present invention is higher, and the culture medium does not need to use phosphoric acid, which avoids the damage to the fermentation equipment caused by the high corrosiveness of phosphoric acid, reduces the cost of equipment maintenance and replacement, and extends the service life of the equipment. At the same time, it also avoids the potential safety hazards caused by the use of corrosive liquids, and the raw material cost is lower than that of traditional yeast BSM culture medium, which helps to reduce the overall production cost.

[0069] Compared with the methanol-induced production of antimicrobial peptides, this scheme does not require the addition of toxic methanol solution to the fermentation broth, which is beneficial to improving product quality and is more conducive to safe production and environmental protection.

[0070] Reference Figure 1 As shown, the present invention provides a method for preparing antimicrobial peptides, the fermentation process comprising:

[0071] S2. Mixing the seed solution containing the transformed Pichia pastoris and the basal culture medium to obtain a first mixture for a first stage fermentation treatment, wherein the transformed Pichia pastoris contains an antimicrobial peptide expression vector, the antimicrobial peptide expression vector contains a GAP promoter, the basal culture medium includes a carbon source and a nitrogen source, the carbon source of the basal culture medium is glycerol, and the concentration of glycerol in the culture medium may be 35 g / L, 40 g / L, 45 g / L, 50 g / L, 55 g / L, 60 g / L or any value between 35 g / L and 60 g / L, the nitrogen source of the basal culture medium is ammonium dihydrogen phosphate, and the concentration of ammonium dihydrogen phosphate in the basal culture medium may be 2 g / L, 3 g / L, 4 g / L, 5 g / L, 6 g / L or any value between 2 g / L and 6 g / L;

[0072] S3. After the first stage fermentation starts and reaches the first preset condition, a feed medium is added to the first mixture to obtain a second mixture, wherein the feed medium includes a carbon source and a nitrogen source, the carbon source of the feed medium is glycerol, and the concentration of glycerol in the feed medium is 800 g / L, 900 g / L, 1000 g / L, 1100 g / L or any value between 800 g / L and 1100 g / L, the nitrogen source of the feed medium is ammonia water, and the concentration of ammonia water in the feed medium is 10%, 11%, 12%, 13%, 14%, 15% or any value between 10% and 15%;

[0073] S4, after the first stage fermentation starts and reaches the second preset condition, allowing the second mixture to undergo a second stage fermentation;

[0074] S5, the second stage fermentation starts and ends after the third preset condition, and the fermentation is terminated, and the fermented second mixture is centrifuged to obtain the antimicrobial peptide;

[0075] The temperature of the second stage fermentation is lower than that of the first stage fermentation. For example, the temperature of the second stage fermentation is 4°C, 5°C, 6°C, 7°C or any value between 4-7°C lower than that of the first stage fermentation.

[0076] In step S2, the trace elements are separately prepared and filtered and sterilized to avoid the reaction of the trace elements with other components in the basal medium at high temperature. Before step S2, the seed liquid is poured into a sterilized empty bottle in a biosafety cabinet. Operating in a biosafety cabinet and using sterilized empty bottles to treat the seed liquid can avoid contamination by foreign bacteria to the greatest extent and ensure the purity of the fermentation process. Before inoculation, the dissolved oxygen content parameter of the fermentation tank is set, for example, 40%. Adequate dissolved oxygen can ensure the smooth respiration and metabolic pathways of yeast cells, promote rapid growth of bacteria and efficient synthesis of antimicrobial peptides, and avoid reduced fermentation efficiency and blocked product synthesis due to hypoxia. Set the fermentation tank temperature and pH parameters, such as temperature 30.0℃, pH 5.0; the appropriate temperature maintains the activity of enzymes in yeast cells, and the stable pH ensures the normal progress of biochemical reactions inside and outside the cells, reduces the negative impact of environmental factor fluctuations on the fermentation results, and improves the stability and repeatability of fermentation.

[0077] Before step S2, after the parameters are stable, the dissolved oxygen 100% calibration can be performed to ensure the accuracy of dissolved oxygen detection and provide a reliable basis for dissolved oxygen control in the subsequent fermentation process. The seed liquid is then added to the tank through the pipeline for inoculation, and the inoculation amount is based on the total volume of the basal culture medium, for example, 10% of the total volume; the bacterial concentration at the initial stage of fermentation can be within a suitable range, which is conducive to the subsequent growth and stable expression of antimicrobial peptides, and reduces fermentation abnormalities caused by inaccurate inoculation amount. Then enter the fermentation batch number and start timing fermentation, which is convenient for tracking and data recording of the entire fermentation process. When problems occur, the cause can be quickly traced and analyzed, and the refined management and quality control of the fermentation process can be realized, and the production efficiency and product quality stability can be improved.

[0078] After the basal culture medium, feed medium, seed liquid culture medium and seed liquid are prepared, the basal culture medium is loaded into the fermenter, and the FSIP program of the tank is turned on for sterilization. After the sterilization is completed, compressed air is passed and the tank pressure control program is turned on. Turn on the tank control program to set the temperature and stirring. The tank is connected to the sterilized ammonia feed bottle and glycerol feed culture, and wait for fermentation.

[0079] It is understandable that the basal medium provides the necessary nutrition and environmental basis for fermentation. Antimicrobial peptides are a class of polypeptides with antimicrobial activity, which are usually synthesized by gene encoding in organisms and are an important component of the natural immune system of organisms. Antimicrobial peptides usually have unique molecular structures and physicochemical properties, and can inhibit the growth and reproduction of microorganisms such as bacteria and fungi through various mechanisms. For example, they have inhibitory effects on various microorganisms such as Gram-positive bacteria, Gram-negative bacteria and fungi. They are usually used in the medical field, agricultural field, food industry and biopharmaceutical field.

[0080] In step S3, it should be noted that the feed medium added here is a glycerol feed medium. As the fermentation proceeds, Pichia pastoris continuously consumes nutrients in the culture medium. After a certain period of fermentation, the carbon source in the basal culture medium may no longer meet the needs of continuous bacterial growth and antimicrobial peptide synthesis. Glycerol as a carbon source can provide sufficient energy and synthetic raw materials for the bacteria, maintain the vigorous metabolism of the bacteria, ensure the continuous and efficient fermentation process, and promote the massive expression of antimicrobial peptides.

[0081] In the first stage of fermentation, higher temperatures are conducive to the rapid growth and reproduction of bacteria, promoting cell division and biomass accumulation. In the second stage of fermentation, the bacteria have reached a certain number, and lowering the temperature can reduce unnecessary energy consumption, allowing more energy and precursors to be used for the synthesis of antimicrobial peptides, thereby improving the yield and quality of antimicrobial peptides.

[0082] In step S5, specifically, samples are taken at regular intervals during the fermentation process to detect OD 600 And antimicrobial peptide content. The present invention uses Pichia pastoris to directly express antimicrobial peptides, and the antimicrobial peptides can be secreted into the fermentation liquid during the fermentation process. After the fermentation is completed, a high-purity antimicrobial peptide solution can be obtained by centrifugation only, thereby avoiding the use of Escherichia coli to express antimicrobial peptides, which requires complex steps such as bacterial cell crushing, purification, and excision of fusion proteins, thereby simplifying the downstream processing process and effectively improving production efficiency. In some embodiments of the present invention, the fermentation temperature in the first stage is 28°C to 32°C; the fermentation temperature in the second stage is 22°C to 26°C. Exemplarily, the fermentation temperature in the first stage can be selected to be 30°C, and the fermentation temperature in the second stage is 24°C.

[0083] Table 9 Second stage temperature change experiment

[0084] serial number Second stage temperature Antimicrobial peptide content g / L Experiment 1 30℃ 2.3 Experiment 2 28℃ 3.5 Experiment 3 22℃ 4.2

[0085] As shown in Table 9, the fermentation conditions were basically the same as those in Example 1, and the second stage fermentation temperature was adjusted for fermentation. According to experimental verification, when the second stage fermentation temperature was 4-7°C lower than the first stage, the antimicrobial peptide content could be significantly improved. For example, the antimicrobial peptide content results of Experiment 3 in Table 9 were significantly higher than those of Experiments 1 and 2.

[0086] In the early stage of fermentation, Pichia pastoris needs to grow and reproduce quickly to increase the number of bacteria. A relatively high temperature, such as 30°C, can provide a suitable growth environment for the bacteria, which is conducive to maintaining the activity of various enzymes in the cells at a high level, promoting the metabolism of the bacteria, accelerating cell division and the accumulation of biomass. Lower temperatures will promote the transcription and translation of antimicrobial peptide genes, making the synthesis of antimicrobial peptides more efficient, and can also reduce the production of impurities in the fermentation broth, which is conducive to later purification.

[0087] Experiments 4 and 5 were conducted using fermentation conditions substantially the same as those in Example 1, with the content of diammonium phosphate in the fermentation medium adjusted. The contents of diammonium phosphate in Experiments 4 and 5 were 8 g / L and 10 g / L, respectively.

[0088] Table 10 OD values ​​at different fermentation times and time points

[0089]

[0090] The data in Table 10 show that when the diammonium phosphate in the basic culture medium is changed, it has a significant effect on the expression of antimicrobial peptides in Pichia pastoris.

[0091] In some embodiments of the present invention, the applicant believes that after the first stage fermentation starts for 16 hours, the feed medium is added to the first mixture; after the first stage fermentation starts for 22 hours, the second mixture is subjected to the second stage fermentation. Specifically, the culture is carried out for a total of 94 hours to 98 hours. From the start of fermentation to 16 hours, the nutrients in the basal medium have been consumed to a certain extent, and the nutrients in the original medium gradually cannot meet its needs. At this time, the feed medium should be added in time to supplement the nutrients. When the fermentation reaches 22 hours, the bacterial growth has reached a certain stage and the biomass has accumulated to a certain extent. At this time, lowering the temperature can change the metabolic flow of the bacterial body and guide more metabolic resources to the synthesis of antimicrobial peptides.

[0092] In some embodiments of the present invention, the addition rate of glycerol in the feed medium is added in a time-gradient manner, and the glycerol in the feed medium is initially added at a rate of 5 g / L / h, and is increased at a rate of 10% every 24 hours. During the fermentation process, the growth and metabolism of Pichia pastoris are dynamic. In the early stage of fermentation, the number of bacteria is relatively small, and the demand for carbon sources is also low; as the fermentation proceeds, the number of bacteria gradually increases, the metabolic activity increases, and the demand for carbon sources continues to rise. The addition method of time-gradient growth shown in the present invention can accurately match the carbon source requirements of bacteria at different growth stages.

[0093] The appropriate glycerol addition rate gradient helps guide the metabolic flow of the bacteria toward the direction of antimicrobial peptide synthesis and promotes the efficient expression of antimicrobial peptide genes. For example, an addition rate that increases by 10% every 24 hours can dynamically adapt to the enhancement of bacterial growth metabolism, continuously provide sufficient energy and carbon skeletons for the bacteria, maintain its metabolic activity, and ensure the smooth progress of the antimicrobial peptide synthesis process.

[0094] In an embodiment of the present invention, the rate of adding ammonia water to the feed medium is determined according to the pH of the second mixture, and the pH of the second mixture is maintained at 4.5-5.5 by adding ammonia water. By dynamically adding ammonia water according to the pH, pH fluctuations caused by bacterial metabolites can be corrected in time, providing a stable growth and metabolic environment for Pichia pastoris, ensuring the efficiency and stability of the fermentation process, and ultimately achieving stable production and high yield of antimicrobial peptides.

[0095] The fermentation process of the present invention effectively overcomes the problem of complicated downstream processing of the traditional E. coli fermentation method, improves production efficiency, and reduces production cost and time cost. Secondly, the co-expression mode is adopted in the fermentation process, which avoids methanol induction to express antimicrobial peptides and reduces safety hazards. At the same time, the production efficiency and quality of antimicrobial peptides are effectively improved.

[0096] It can be understood that the aforementioned embodiments are merely exemplary descriptions of the present invention. The technical solutions of the various embodiments can be arbitrarily combined and used in combination, provided that the technical features do not conflict, the structures do not contradict, and the purpose of the present invention is not violated.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing an antimicrobial peptide, characterized in that: The steps include: S2, mixing the seed solution containing the transformed Pichia pastoris and the basal culture medium to obtain a first mixture for a first stage fermentation treatment, wherein the transformed Pichia pastoris contains an antimicrobial peptide expression vector, the antimicrobial peptide expression vector contains a GAP promoter, and the basal culture medium includes a carbon source and a nitrogen source, the carbon source of the basal culture medium is 35 g / L-60 g / L of a polyol, and the nitrogen source of the basal culture medium is 2 g / L-6 g / L of a soluble ammonium salt; S3, after the first stage fermentation starts and reaches the first preset condition, adding feed medium to the first mixture to obtain a second mixture; S4, after the first stage fermentation starts and reaches a second preset condition, subjecting the second mixture to a second stage fermentation; S5, the second stage fermentation starts and ends when the fermentation reaches the third preset condition, and the fermentation is completed by centrifuging the second mixture to obtain the antimicrobial peptide; The temperature of the second stage fermentation is 4°C-7°C lower than that of the first stage fermentation.

2. The method for preparing an antimicrobial peptide according to claim 1, characterized in that: The fermentation temperature in the first stage is 29.5°C to 30.5°C; the fermentation temperature in the second stage is 23.5°C to 24.5°C.

3. The method for preparing antimicrobial peptides according to claim 1, characterized in that: The carbon source of the basal culture medium is glycerol, and the nitrogen source of the basal culture medium is ammonium dihydrogen phosphate; The feed medium comprises a carbon source and a nitrogen source, wherein the carbon source of the feed medium is 800 g / L-1100 g / L glycerol, and the nitrogen source of the feed medium is 10%-15% ammonia water.

4. The method for preparing antimicrobial peptides according to claim 3, characterized in that: The inoculation amount of the transformed Pichia pastoris was 0.5%; the OD 600 It is 9.0~11.

0.

5. The method for preparing antimicrobial peptides according to claim 1, characterized in that: The first preset condition is that the basal medium is cultured for 16 hours or when the dissolved oxygen content in the basal medium drops rapidly for the first time, and the feed medium is added to the first mixture; the second preset condition is that the basal medium is cultured for 22 hours or when the glycerol content in the second mixture is less than 5 g / L; the third preset condition is that the basal medium is cultured for 96 hours or when the basal medium is cultured to OD 600 When the value no longer changes.

6. The method for preparing an antimicrobial peptide according to any one of claims 1 to 5, characterized in that: Step S3 specifically includes: continuously adding the feed medium to the first mixture to obtain the second mixture until the fermentation is terminated.

7. The method for preparing an antimicrobial peptide according to any one of claims 1 to 5, characterized in that: The addition rate of glycerol in the feed medium is in a time-gradient increasing manner. The glycerol in the feed medium is initially added at a rate of 5 g / L / h and is increased at a rate of 10% every 24 hours.

8. The method for preparing an antimicrobial peptide according to any one of claims 1 to 5, characterized in that: The rate of adding aqueous ammonia to the feed medium is determined according to the pH of the second mixture, and the pH of the second mixture is maintained at 4.5-5.5 by adding aqueous ammonia.

9. The method for preparing an antimicrobial peptide according to any one of claims 1 to 5, characterized in that: The basic culture medium includes the following components: 14.9 g / L magnesium sulfate heptahydrate, 4 g / L ammonium dihydrogen phosphate, 5 g / L potassium dihydrogen phosphate, 18.2 g / L potassium sulfate, 50 g / L glycerol, 0.5 g / L potassium hydroxide, 0.95 g / L calcium sulfate, trace elements and 0.2 g / L biotin.

10. The method for preparing antimicrobial peptides according to claim 9, characterized in that: The trace elements include: 6.0 g / L copper sulfate pentahydrate, 3.0 g / L manganese sulfate, 20.0 g / L zinc sulfate heptahydrate, 65.0 g / L ferrous sulfate heptahydrate, 0.2 g / L sodium molybdate dihydrate, 0.02 g / L boric acid, 0.5 g / L cobalt chloride dihydrate, 0.08 g / L potassium iodide and 5.0 ml / L sulfuric acid.

Images