Application of CHPO and its encoding gene in regulating low temperature recovery of rice

Abstract

This invention discloses the application of CHPO and its encoding gene in regulating the low-temperature recovery ability of rice. Specifically, it discloses the application of the protein CHPO (SEQ ID NO:2) and its encoding gene in regulating the low-temperature recovery ability or low-temperature tolerance of plants. This invention constructs... CHPO Gene overexpression vectors and CRISPR / Cas9 knockout vectors were used to successfully create transgenic homozygous rice. Experimental results showed that the protein CHPO and its encoding gene play a role in regulating plant cold recovery or cold tolerance, and this can be achieved through overexpression. CHPO Genes can significantly improve the resilience and cold tolerance of rice under low-temperature stress. This invention provides a valuable gene resource for low-temperature tolerance breeding of rice. CHPO The application of genes has opened up new fields and has broad application prospects and important significance for breeding new types of low-temperature resistant rice and promoting the commercialization of rice breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of CHPO and its encoding gene in regulating the low-temperature resilience of rice. Background Technology

[0002] Rice ( Oryza sativa As one of the world's major food crops, rice provides a primary food source for humanity, and its yield and quality are crucial to agricultural production. During its growth and development, rice is subject to various abiotic stresses, such as low temperature, high temperature, drought, and salt stress, leading to reduced yields and seriously impacting food security. Originating in freshwater swamp environments, rice is a crop highly sensitive to low temperature stress. Cold damage severely limits rice productivity and is one of the main adverse factors affecting rice yield. Due to climate change, over 15 million hectares of rice-growing areas have been affected by cold, and low temperatures pose a significant challenge to rice cultivation. Although some research progress has been made on cold-resistant genes in rice, the number of cloned and functionally identified cold-resistant genes remains limited because cold-resistant tolerance is a complex quantitative trait regulated by multiple genes. In addition to causing seedling death, low temperature stress can also inhibit seedling growth and development for extended periods, such as tillering, a crucial yield-determining trait. However, most existing studies have focused on survival rates to reveal the regulatory mechanisms of rice's low-temperature tolerance, and there is currently no research on the regulatory mechanisms of rice seedling low-temperature resilience (tillering growth and development after low-temperature stress).

[0003] Therefore, revealing the molecular mechanisms by which rice adapts to low-temperature environments, discovering and utilizing rice's low-temperature tolerance genes, improving rice's low-temperature resilience and tolerance, and continuously cultivating new rice varieties with strong low-temperature resilience and tolerance are of great theoretical and practical significance for ensuring food security and sustainable development. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate the low-temperature tolerance or low-temperature recovery ability of plants. The technical problem to be solved is not limited to the technical subject matter described herein; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0005] To address the aforementioned technical problems, the present invention first provides an application of proteins, wherein the application may be any of the following:

[0006] A1) Application in regulating plant low-temperature resilience;

[0007] A2) Application in regulating the low-temperature tolerance of plants;

[0008] A3) Application in cultivating cold-resistant plants;

[0009] A4) application in molecular breeding of low temperature tolerance in plants or improvement of low temperature tolerance in germplasm resources;

[0010] The protein name can be CHPO, which can be any of the following:

[0011] B1) a protein with an amino acid sequence of SEQ ID NO: 2;

[0012] B2) a protein with an amino acid sequence shown in SEQ ID NO: 2, which has 80% or more identity with the protein shown in B1) and has the same function, obtained by substitution, deletion and / or addition of amino acid residues;

[0013] B3) a fusion protein with the same function obtained by connecting a tag at the N-terminus and / or C-terminus of B1) or B2).

[0014] In the above application, the protein can be derived from rice (Oryza sativa L.), Oryza sativa ).

[0015] The substitution in B2) can be a conservative substitution.

[0016] The connection in B3) can be direct connection by a peptide bond or connection by a linker.

[0017] In order to facilitate the separation, purification, detection and / or localization of the protein in B1), a tag protein can be connected at the amino terminus or carboxyl terminus thereof. The tag includes but is not limited to: GST (glutathione S-transferase) tag protein, Trx (thioredoxin) tag protein, NusA tag protein, His tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA (influenza hemagglutinin) tag protein, Myc tag protein, LacZ tag protein, CBD (cellulose binding domain) tag protein, bacteriophage T7 protein kinase (T7PK) tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein. The use of a tag does not change the function of the target protein, and those skilled in the art know how to select a suitable tag protein according to the desired purpose.

[0018] The application can be achieved by up-regulating or down-regulating the content and / or activity of the protein CHPO.

[0019] Further, the application can include improving the low temperature recovery or low temperature tolerance of plants by up-regulating the content and / or activity of the protein CHPO (e.g. overexpressing the coding gene of the protein CHPO).

[0020] The present application also provides the use of the biological material related to the protein CHPO, which can be any of the following:

[0021] C1) use in regulating the low temperature recovery of plants;

[0022] C2) use in regulating the low temperature tolerance of plants;

[0023] C3) use in breeding low temperature tolerant plants;

[0024] C4) use in low temperature tolerant molecular breeding of plants or improvement of low temperature tolerant germplasm;

[0025] The biological material can be any of the following:

[0026] D1) a nucleic acid molecule encoding the protein CHPO;

[0027] D2) an expression cassette containing the nucleic acid molecule of D1);

[0028] D3) a recombinant vector containing the nucleic acid molecule of D1), or a recombinant vector containing the expression cassette of D2);

[0029] D4) a recombinant microorganism containing the nucleic acid molecule of D1), or a recombinant microorganism containing the expression cassette of D2), or a recombinant microorganism containing the recombinant vector of D3);

[0030] D5) a recombinant host cell containing the nucleic acid molecule of D1), or a recombinant host cell containing the expression cassette of D2), or a recombinant host cell containing the recombinant vector of D3);

[0031] D6) a transgenic plant tissue containing the nucleic acid molecule of D1), or a transgenic plant tissue containing the expression cassette of D2);

[0032] D7) a transgenic plant organ containing the nucleic acid molecule of D1), or a transgenic plant organ containing the expression cassette of D2).

[0033] In the above uses, the nucleic acid molecule of D1) can be a DNA molecule whose coding sequence or nucleotide sequence is SEQ ID NO: 1.

[0034] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0035] The nucleotide sequence shown in SEQ ID NO: 1 can be CHPO the coding sequence (CDS) of a gene, which encodes the protein CHPO whose amino acid sequence is shown in SEQ ID NO: 2.

[0036] D1) The nucleic acid molecule can also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID NO: 1.

[0037] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding the protein CHPO using known methods, such as site-directed mutagenesis (including oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis, etc.) or directed evolution (including error-prone PCR, DNA shuffling, and in vitro random priming recombination, etc.). Those artificially modified nucleotide sequences having 75% or more identity with the nucleotide sequence encoding the protein CHPO (such as SEQ ID NO: 1) are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application, as long as they encode the protein CHPO and have the same function as the protein CHPO.

[0038] In the above-mentioned biological material, the recombinant vector can be a cloning vector or an expression vector.

[0039] Further, the recombinant vector can be a recombinant expression vector obtained by cloning the gene encoding the protein CHPO (such as a gene shown in SEQ ID NO: 1) CHPO into an expression vector (such as a prokaryotic expression vector, a eukaryotic expression vector, or a viral expression vector).

[0040] The existing plant expression vector can be used to construct a recombinant expression vector containing CHPORecombinant expression vectors of genes. The plant expression vectors include, but are not limited to, binary expression vectors (such as pBI series vectors (e.g., pBI121), pBIN series vectors (e.g., pBin19), pCAMBIA series vectors (e.g., pCAMBIA1300 vector), pPZP series vectors, pGreen series vectors, pBIBAC series vectors, pSKI015 vector, pSKI074 vector, pRI101-AN vector, etc.) and co-integrated vectors (which can be constructed by inserting a segment homologous to a Ti plasmid or a segment thereof into an intermediate vector by homologous recombination or cloning). The plant expression vectors contain elements required for expression of foreign genes such as promoters, multiple cloning sites, terminators, ribosome binding sites, etc. The plant expression vectors can also contain the 3' untranslated region of the foreign gene, i.e., a DNA segment containing a polyadenylation signal and any other DNA segment involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenosine to the 3' end of the mRNA precursor, such as the 3' untranslated region of the Agrobacterium tumefaciens Ti plasmid gene (e.g., the nopaline synthase (Nos) gene), the plant gene (e.g., the soybean storage protein gene), etc. When introducing the gene encoding the protein CHPO of the present application using the Agrobacterium method, it is preferable to use an expression vector suitable for the Agrobacterium method, such as a binary vector or a modified vector thereof. Examples of these plant expression vectors include pBI121, pBIN19, pSMAB704, pCAMBIA series vectors, pGreen series vectors, etc.

[0041] Use CHPO When constructing a recombinant plant expression vector using the gene, any one of the enhancer promoters or constitutive promoters can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CaMV) 35S promoter, the maize ubiquitin promoter (Ubi), the rice actin promoter (Actin), the Emu promoter, the maize Adhl gene promoter, the rice rbcS gene promoter, the tomato rbcS gene promoter, the potato pin II gene promoter, which can be used alone or in combination with other plant promoters; in addition, when constructing a plant expression vector using the gene of the present application, enhancers, including translation enhancers or transcription enhancers, can also be used, and these enhancer regions can be the ATG initiation codon or the adjacent region initiation codon, etc., but need to be the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the initiation codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene.

[0042] For the convenience of identification and screening of the transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes including but not limited to genes encoding enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, GFP gene, etc.), antibiotic resistance genes (kanamycin resistance gene kanr, neomycin resistance gene neo, hygromycin resistance gene hyg, chloramphenicol resistance gene cat, streptomycin resistance gene str, bleomycin resistance gene ble, etc.) or herbicide resistance genes (bar gene, glyphosate resistance marker gene epsps, monosodium methanesulfonate resistance marker gene als, etc.). For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened.

[0043] The present application also provides a method for breeding a low-temperature-resistant plant, which comprises increasing the content and / or activity of the protein CHPO in a target plant, so as to obtain a low-temperature-resistant plant with higher low-temperature resistance than the target plant.

[0044] In the above method, the increase of the content and / or activity of the protein CHPO in the target plant can be achieved by increasing the expression amount of the gene encoding the protein CHPO in the target plant.

[0045] The increase of the expression amount of the gene encoding the protein CHPO in the target plant can be achieved by at least one of the following methods:

[0046] (1) increasing the copy number of the gene encoding the protein CHPO;

[0047] (2) placing the gene encoding the protein CHPO under the drive of a strong promoter for expression;

[0048] (3) increasing the regulatory elements of the gene encoding the protein CHPO to overexpress the gene, wherein the regulatory elements include enhancer elements, elements for improving mRNA stability, elements for enhancing translation efficiency and / or elements for enhancing protein secretion;

[0049] (4) increasing the ribosome binding site of the gene encoding the protein CHPO;

[0050] (5) codon optimization of the gene encoding the protein CHPO;

[0051] (6) up-regulating the expression of the gene (the gene encoding the protein CHPO) by changing epigenetic modifications such as DNA methylation or histone acetylation.

[0052] The strong promoter includes, but is not limited to, T7 promoter, CaMV promoter, SV40 promoter, SFFV promoter, ubq promoter, ubi promoter, RBCS promoter, Actin promoter, Emu promoter, CYP450 promoter, Adhl promoter and pin II promoter.

[0053] The enhancer includes, but is not limited to, CMV enhancer, SV40 enhancer and RSV enhancer.

[0054] In the method, the expression amount of the protein CHPO coding gene in the target plant can be realized by introducing the protein CHPO coding gene into the target plant.

[0055] In the method, the nucleotide sequence of the protein coding gene can be SEQ ID NO: 1.

[0056] Further, the method for breeding low-temperature-resistant plants can comprise the following steps:

[0057] (1) constructing a recombinant vector comprising a protein CHPO coding gene;

[0058] (2) introducing the recombinant vector constructed in step (1) into a target plant;

[0059] (3) obtaining a low-temperature-resistant plant through screening and identification.

[0060] Further, the nucleotide sequence of the protein CHPO coding gene can be SEQ ID NO: 1.

[0061] Further, in the method, after the step (3), there can be a step (4) of crossing the obtained low-temperature-resistant plant with a plant to be improved to obtain a progeny transgenic plant, and the progeny transgenic plant is basically consistent with the transgenic plant (i.e. the transgenic plant as a parent) in low-temperature resistance.

[0062] Further, the introduction method includes, but is not limited to, Agrobacterium-mediated method, plant virus vector-mediated transformation method, gene gun method (also known as microprojectile bombardment method or biolistic method), chemical stimulation method, electroporation method, liposome-mediated method, microinjection method, laser microbeam method, pollen tube channel method, ultrasonic method, air gun method and vortex method, etc.

[0063] Further, the introduction method can be Agrobacterium-mediated method.

[0064] Further, the Agrobacterium-mediated method can comprise the following steps: introducing (such as by using Ca ion-induced transformation method, polyethylene glycol-mediated transformation method, metal cation-mediated transformation method, electroporation transformation method, phage transduction method, etc.) the recombined vector constructed in step (1) into Agrobacterium, obtaining recombined Agrobacterium, and infecting callus or explant of the target plant with the recombined Agrobacterium; and culturing the obtained positive callus or explant to obtain regenerated plants.

[0065] The explant includes, but is not limited to, seed, root, leaf, petiole, cotyledon, cotyledon petiole, hypocotyl, stem segment, stem tip meristem, epidermal parenchyma cell, tuber, stolon segment, embryonic suspension cell and protoplast, etc.

[0066] The screening and identification method is known to those skilled in the art, for example, the transformed transgenic plants (including transgenic progeny material) can be identified by PCR detection, Southern hybridization, immunoblotting, Northern hybridization, enzyme-linked immunosorbent assay (ELISA), functional identification (testing the presence of selection marker gene and target gene), and / or in situ hybridization, etc.

[0067] The present application also provides a method for improving the low temperature tolerance or low temperature recovery ability of a target plant, which comprises increasing the content and / or activity of the protein CHPO in the target plant (such as overexpressing CHPO gene ） .

[0068] Further, the increase of the content and / or activity of the protein CHPO in the target plant can be achieved by increasing the expression amount of the gene encoding the protein CHPO in the target plant.

[0069] Further, the increase of the expression amount of the gene encoding the protein CHPO in the target plant can be achieved by introducing the gene encoding the protein CHPO into the target plant.

[0070] Further, the nucleotide sequence of the gene encoding the protein can be SEQ ID NO: 1.

[0071] The present application also provides a method for breeding low temperature tolerance, which comprises the following steps: crossing the low temperature tolerance plant obtained by any of the methods for breeding low temperature tolerance plant described herein with a plant to be improved, to obtain a transgenic plant of the next generation; and the transgenic plant of the next generation is substantially consistent with the phenotype of the low temperature tolerance plant. The substantially consistent phenotype can be that the low temperature tolerance is enhanced compared with the plant to be improved.

[0072] Herein, the plant can be any of the following:

[0073] E1) monocotyledonous plant or dicotyledonous plant;

[0074] E2) Gramineae plants;

[0075] E3) Oryza plants;

[0076] E4) Oryza sativa.

[0077] The protein CHPO described herein, or the biological material is also within the protection scope of the present application.

[0078] The regulation described herein can be up-regulation or down-regulation.

[0079] The low temperature recovery or low temperature tolerance described herein can be reflected in the growth, survival rate and / or tillering rate of the plants under low temperature stress conditions.

[0080] In the present application, the low temperature tolerant plants are understood to include not only the first generation transgenic plants obtained by introducing or knocking out the protein CHPO encoding gene in the target plants, but also the transgenic plants of the offspring. The transgenic plants include seeds, callus, whole plants and cells.

[0081] The present application successfully creates CHPO gene overexpression and knockout homozygous rice by constructing CHPO gene overexpression and knockout vectors and CRISPR / Cas9 knockout vectors. The experimental results show that the low temperature recovery of rice under low temperature stress conditions can be significantly improved by overexpressing CHPO gene, while the low temperature recovery of rice under low temperature stress conditions can be significantly reduced by knocking out CHPO gene. It is shown that the protein CHPO and its encoding gene have the function of regulating the low temperature recovery or low temperature tolerance of plants.

[0082] The present application first discloses the application of the protein CHPO and its encoding gene in regulating the low temperature recovery or low temperature tolerance of plants. The low temperature recovery or low temperature tolerance of plants can be improved by up-regulating the content and / or activity of the protein CHPO (for example, overexpressing CHPO gene). The low temperature recovery or low temperature tolerance of plants can be reduced by down-regulating the content and / or activity of the protein CHPO (for example, silencing or knocking out CHPO gene). The present application provides a good gene resource for low temperature tolerance breeding of rice, and opens up a new field for the application of CHPO gene. It has a wide application prospect and important significance for breeding new low temperature tolerant rice and promoting the commercial breeding process of rice.

[0083] Term definition

[0084] In the present application, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by a person skilled in the art. Meanwhile, in order to better understand the present application, the definitions and explanations of the relevant terms are provided below.

[0085] The term "expression cassette" generally refers to a nucleic acid construct comprising nucleic acid elements sufficient to express a gene of interest. A typical expression cassette comprises a promoter, a MCS (multiple cloning site), and a terminator. The expression cassette can also include a gene of interest, a marker gene (such as a TK gene, a DHFR gene, a CAT gene, and a NEO gene), a ribosome recognition and binding site (SD), a transcription factor binding site (TFBS), an enhancer, a silencer, a repressor, an intron, a poly(A) addition signal sequence, and / or an mRNA splicing signal sequence, etc. The elements in the expression cassette can be directly connected or indirectly connected through a linker.

[0086] The term "vector" generally refers to a vector capable of carrying foreign DNA or a gene of interest into a host cell for amplification and / or expression. The vector can be a cloning vector or an expression vector. The vector can be introduced into a host cell by transformation, transduction, or transfection, so that the genetic material elements carried by the vector are amplified and / or expressed in the host cell. A person skilled in the art can select a suitable vector according to the purpose of genetic engineering and the properties of the recipient cell. The vector includes but is not limited to: a plasmid, a phage (such as lambda phage or M13 phage), a cosmid (i.e., a cos plasmid), a phagemid, a shuttle vector (such as a yeast expression vector), a Ti plasmid, an artificial chromosome (such as a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a P1 artificial chromosome (PAC), or a Ti plasmid artificial chromosome (TAC)), a viral vector (such as a baculovirus vector, a retrovirus (including a lentivirus), an adenovirus, an adeno-associated virus, a poxvirus, a papillomavirus, a papovavirus (such as SV40), a herpesvirus (such as a herpes simplex virus)). A vector can contain multiple elements for controlling expression, including but not limited to a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selection element, and a reporter gene. In addition, the vector can also contain a replication initiation site.

[0087] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsia, mycoplasma, chlamydia, spirochetes, algae, etc. For example, the bacteria can be from the genus Escherichia (E. coli), Enterobacter (E. cloacae), Agrobacterium (A. tumefaciens), Flavobacterium (F. heparinum), etc. Escherichia sp. Erwinia sp. Agrobacterium sp. Flavobacterium sp. ​​​), Alcaligenes ( Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ) and Bacillus spp. ( Bacillus sp. (e.g., Bacillus subtilis). The viruses may include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus). The fungi may be derived from yeasts (e.g., Bacillus subtilis). Saccharomyces sp. (such as Saccharomyces cerevisiae, Saccharomyces methylbenzene, Pichia pastoris), Fusarium genus ( Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ) and Cephalosporin ( Cephalosporium sp. The actinomycetes may originate from the genus Streptomyces (…). Streptomyces sp. (e.g., Streptomyces). The algae may originate from the phylum Cyanophyta (e.g., cyanobacteria), genus Fucus (e.g., *Fucus*). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus *Stellaria* ( Asteromonas sp. ) and the genus *Golden Color Algae* ( Boekelovia sp. )wait.

[0088] The term "host cell," also known as recipient cell, generally refers to any type of cell that can be used to introduce a vector, such as plant and animal cells. The term "host cell" can be understood to refer not only to the specific recipient cell but also to its offspring, which, due to natural, accidental, or intentional mutations and / or alterations, need not be completely identical to the original parent cell but are still included within the scope of the host cell. Suitable host cells are those known in the art, wherein: the plant cell may be Arabidopsis thaliana (…). Arabidopsis thaliana ),tobacco( Nicotiana tabacum ),corn( Zea mays ), rice ( Oryza sativa ),wheat( Triticum aestivum) cells, but are not limited to; the animal cells can be mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), Chinese hamster ovary subline cells (CHO-K1 cells), African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), baby hamster kidney cells (BHK cells), mouse mammary tumor cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells, or NK cells, etc.), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., Xenopus (African clawed frog (Xenopus laevis) Xenopus laevis ) cells or giant salamander (Andrias (Andrias japonicus) Andrias davidianus ) cells), fish cells (e.g., grass carp, common carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells, Sf-9 cells, or Hi-5), etc., but are not limited to.

[0089] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by in vitro ligation of a vector with an exogenous gene of interest, which can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the exogenous gene of interest into a recipient cell and provide the exogenous gene of interest with the ability to replicate, integrate, amplify, and / or express in the recipient cell.

[0090] The term "recombinant microorganism" generally refers to a recombinant microorganism obtained by manipulating and modifying the genes of a microorganism of interest, so that the functions of the recombinant microorganism are changed. For example, an exogenous gene of interest or a recombinant vector is introduced into the microorganism of interest, or the endogenous genes of the microorganism of interest are directly genetically edited.

[0091] The term "recombinant host cell" generally refers to a recombinant host cell obtained by manipulating and modifying the genes of a host cell, so that the functions of the recombinant host cell are changed. For example, an exogenous gene of interest or a recombinant vector is introduced into the host cell, or the endogenous genes of the host cell are directly genetically edited.

[0092] The term "linking" generally refers to the association of two or more molecules. The linking can be covalent or non-covalent. The linking described herein can be directly linked by a peptide bond, or linked by a linker (linker).

[0093] The term "identity" generally refers to the extent to which two (nucleotide or amino acid) sequences have the same residues at a given position in an alignment, and is usually expressed as a percentage. Identity as described herein can refer to identity of an amino acid sequence or a nucleotide sequence. Two copies having exactly the same sequence have 100% identity. One skilled in the art knows that identity of an amino acid sequence or a nucleotide sequence can be determined using identity search sites on the internet, such as the BLAST page of the NCBI home page website. For example, the value of identity (%) can be obtained by searching in Advanced BLAST 2.1 using blastp as the program, setting Expect value to 10, setting all Filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and then calculating identity of an amino acid sequence. In addition, it can be determined using sequence analysis software (such as CLC Main Workbench and MegAlign™), for example, computer program BLAST, especially BLASTP or TBLASTN, using default parameters. 75% or more identity as described herein can be 75%, 80%, 85%, 90% or 95% or more. In the present context, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more.

[0094] The term "conservative substitution" generally refers to the replacement of an amino acid residue by another amino acid residue having a similar physicochemical property. For example, conservative substitutions can be made between hydrophobic side chain amino acid residues (e.g., Met, Ala, Val, Leu, and He), between neutral hydrophilic side chain residues (e.g., Cys, Ser, Thr, Asn, and Gin), between acidic side chain residues (e.g., Asp, Glu), between basic side chain amino acids (e.g., His, Lys, and Arg), or between aromatic side chain residues (e.g., Trp, Tyr, and Phe). Conservative substitutions generally known in the art not to produce a significant change in the conformational structure of a protein, and do not substantially alter the biological activity of the protein. Conservative substitutions in a protein sequence that are expected to have little or no effect on the structure or function of the protein can be readily designed by one of ordinary skill in the art.

[0095] The term "overexpression" generally refers to increasing or up-regulating the level and / or activity of a target protein or gene. Overexpression can be achieved by regulation at the genetic level (e.g., replication of the gene, transcription, translation, post-transcriptional modification, and / or post-translational modification) or by promoting or increasing the amount, activity, and / or function of a target protein at the protein level. The means of overexpression is not particularly limited, and numerous ways of achieving overexpression are well known to those skilled in the art. For example, a nucleic acid molecule to be overexpressed or a nucleic acid molecule encoding a protein to be overexpressed can be placed under the control of a strong promoter; the copy number of one or more genes encoding the proteins described in the present application can be increased; or the strength of a ribosome binding site or Kozak sequence, the stability of mRNA, codon usage, suppression elements, etc. can be increased.

[0096] The term "promoter" generally refers to a site specifically recognized and bound by RNA polymerase, located upstream of the transcription initiation site of a structural gene, having a strict orientation and initiating transcription. Because the strength of a promoter determines the efficiency of transcription, different types of promoters can be used to regulate the expression of key genes in genetic engineering. It is known to those skilled in the art that a constitutive strong promoter can be used to overexpress a target gene. To further enhance the expression of a target gene, multiple promoters can also be used in series.

[0097] The term "enhancer" generally refers to a DNA sequence that enhances the transcriptional activity of a gene, located upstream or downstream of a structural gene, or located in an intron.

[0098] The term "regulatory element" generally refers to a DNA molecule having gene regulatory activity. Regulatory elements that function in plants include promoters, leader sequences, enhancers, introns, and 3' UTRs, etc.

[0099] The term "operably linked" generally refers to the physical and / or functional linkage of a DNA segment to another DNA segment, which linkage allows the segment to function in its intended manner. DNA encoding a gene product can be operably linked to a regulatory element, which can directly or indirectly modulate transcription of the DNA. For example, when an enhancer is operably linked to DNA encoding a gene product, transcription of the DNA can be enhanced, and the enhancer can be located upstream of, downstream of, or embedded in the coding region of the DNA.

[0100] The term "codon optimization" generally refers to a technique for increasing the level of protein expression in an organism by increasing the efficiency of translation of a target gene. Codon optimization generally involves redesigning a gene to increase translation efficiency, and thus increase protein expression levels, by avoiding rare codons, using preferred codons, simplifying the secondary structure of mRNA, optimizing repetitive sequences, eliminating restriction enzyme sites, adjusting GC content, etc.

[0101] The term "introducing" generally refers to the transfer of an exogenous gene into a recipient cell, such as a eukaryotic recipient cell or a prokaryotic recipient cell. The method of introduction is not particularly limited, and any known transformation method can be used as long as it can transfer the gene of interest (e.g., the DNA molecule of the present application) into the recipient cell. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be the integration of the exogenous gene into the host chromosome or the expression of the exogenous gene from a plasmid outside the chromosome. The method of introduction can include any one of the following: (1) introducing the gene of interest or a recombinant vector containing the gene of interest into the host bacteria by chemical transformation (e.g., Ca ion-induced transformation, polyethylene glycol-mediated transformation, or metal cation-mediated transformation) or physical transformation (e.g., electroporation transformation); (2) introducing the gene of interest into the host bacteria by phage transduction; (3) introducing the gene of interest into plant recipient cells by physical or chemical methods, such as biolistic particle delivery (also known as microprojectile bombardment or biolistic method), chemical stimulation, electroporation, liposome-mediated method, microinjection, laser microbeam method, pollen tube pathway method, ultrasonic method, air gun method, and vortex method; and (4) introducing the gene of interest into plant recipient cells using a vector as a medium, such as Agrobacterium Ti plasmid vector (including Ti plasmid-derived vectors such as co-integration vector system and binary vector system) mediated method (Agrobacterium-mediated method), and plant virus vector mediated transformation.

[0102] The term "explant" generally refers to a part of a plant body used as a culture material in plant tissue culture, which can regenerate into a whole plant under suitable conditions after proper treatment. In actual operation, a person skilled in the art selects a suitable explant for transformation according to different plants.

[0103] The term "callus" generally refers to a tissue newly formed on the wound surface after a local part of a plant body is stimulated by trauma. It is composed of living parenchyma cells, which can originate from living cells of various tissues in any organ of the plant body. In plant tissue culture, it can refer to a mass of parenchyma cells with vigorous division capacity that grows disorderly and is formed from an explant. The callus can be induced to form a whole plant on a suitable culture medium. BRIEF DESCRIPTION OF DRAWINGS

[0104] Figure 1 For CHPO PCR amplification results of CDS sequences of genes.

[0105] Figure 2 Physical map of the overexpression vector pUN1301- CHPO

[0106] Figure 3 Real-time PCR identification of overexpression transgenic rice.

[0107] ​Figure 4 Phenotype observation and statistics of overexpression transgenic rice. Among them: Figure 4 A is CHPO Phenotype observation of overexpression lines before and after low temperature treatment; Figure 4 B is CHPO Tiller phenotype observation of overexpression lines after low temperature treatment; Figure 4 C is CHPO Survival rate statistics of overexpression lines after low temperature treatment; Figure 4 D is CHPO Tiller rate statistics of surviving individuals of overexpression lines after low temperature treatment.

[0108] Figure 5 For CHPO Physical map of CRISPR mutant vector construction.

[0109] Figure 6 For chpo Mutant sequencing identification results.

[0110] Figure 7 For chpo Mutant phenotype observation and statistics. Among them: Figure 7 A is CHPO Phenotype observation of mutants before and after low temperature treatment; Figure 7 B is CHPO Tiller phenotype observation of mutants after low temperature treatment; Figure 7 C is CHPO Survival rate statistics of mutants after low temperature treatment; Figure 7 D is CHPO Tiller rate statistics of surviving individuals of mutants after low temperature treatment. DETAILED DESCRIPTION

[0111] The application will be further described in detail below in conjunction with specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0112] The experimental methods in the following examples are all routine methods, unless otherwise specified, according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0113] The following examples use R language to process data, and the experimental results are expressed as mean ± standard deviation. The t-test method is used, P<0.05 (*) indicates a statistically significant difference, P<0.01 (**) indicates a statistically significant difference, and P<0.001 (*** ) indicates a very significant difference. In the following examples, quantitative experiments are set up with three biological replicates unless otherwise specified, and the results are averaged.

[0114] Example 1, Obtaining the coding gene of CHPO CHPO

[0115] Total RNA was extracted from KY131 (Oryza sativa L. cv, Kongyu 131, KY131) seedlings at the three-leaf stage, and the CDS of the CHPO gene was obtained using reverse transcription and PCR technology. The specific experimental steps are as follows: CHPO

[0116] Plant total RNA extraction: 0.1 g of KY131 three-leaf stage seedlings were used as materials, which were ground into freeze-dried powder in liquid nitrogen, and a safe RNA extraction kit (MAGEN, MD023) was used to extract total RNA. The specific steps are as follows: add 600 µL Buffer RLC to the powder, vortex immediately, centrifuge at 14000xg for 5 minutes, and take the supernatant. Install the purification column B10 into a 2 mL collection tube, transfer the lysate or supernatant into the column, centrifuge at 14000xg for 2 minutes, and discard the DNA binding material in the purification column B10. Add 0.7 times the volume of Buffer SW2 to the filtrate, and mix gently 3-5 times with a pipette. Install a new B10 column into the collection tube, transfer half the volume of the mixture to the column, centrifuge at 12000xg for 1 minute, discard the filtrate, and re-install the column into the collection tube. Repeat the above operation. Then add 700 µL Buffer RW1 to the column, centrifuge at 12000xg for 1 minute, discard the filtrate, and re-install the column into the collection tube. Add 700 µL Buffer SW2, centrifuge at 12000xg for 30-60 seconds. Discard the effluent again, and centrifuge at 12000xg for 2 minutes. Transfer the column to a 1.5 mL centrifuge tube, add 50 µL RNase-free water to the center of the column membrane, and incubate at room temperature for 2 minutes. Centrifuge at 12000xg for 1 minute, discard the column, and store the RNA at -80°C, or directly use it for RT-PCR reverse transcription.

[0117] ​​Reverse transcription (RT-PCR): The extracted total RNA was used as a template to perform reverse transcription with a reverse transcription kit (Yeasen, 11123ES60). The reaction system included 5x gDNA digestion buffer 2 μL, gDNA digestion enzyme 1 μL, total RNA 2 μg, and RNase-free water to a total volume of 10 μL, incubated at 42°C for 2 minutes. Then 2x Hifair® II SuperMix plus 10 μL was added, and incubated according to the following program: 25°C for 5 minutes, 50°C for 60 minutes, and 85°C for 5 minutes.

[0118] PCR amplification and cloning: The PCR reaction was performed according to the following system: 0.2 μL PrimerSTAR HS DNA polymerase (5 U / μL), 10 μL 2x GC buffer, 2.0 μL dNTPs, 0.5 μL 5' end primer (10 μM), 0.5 μL 3' end primer (10 μM), 1 μL DMSO, and a final volume of 20 μL. The primer sequences were as follows: the 5' end primer was 5'- ATGACCTCCCAGGCGGCGAC -3' (the underlined part was a BamH1 site), and the 3' end primer was 5'- TCATTGGTGCATCTTGGCCG -3' (the underlined part was a Kpn1 site). The PCR program was as follows: pre-denaturation at 98°C for 30 seconds, followed by 35 cycles of denaturation at 98°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute and 30 seconds, and finally extension at 72°C for 10 minutes. GTCGACTCTAGAGGATCC ATGACCTCCCAGGCGGCGAC -3' (the underlined part was a BamH1 site), and the 3' end primer was 5'- TCATTGGTGCATCTTGGCCG -3' (the underlined part was a Kpn1 site). The PCR program was as follows: pre-denaturation at 98°C for 30 seconds, followed by 35 cycles of denaturation at 98°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute and 30 seconds, and finally extension at 72°C for 10 minutes. AAATTCGAGCTCGGTAC C TCATTGGTGCATCTTGGCCG -3' (the underlined part was a Kpn1 site). The PCR program was as follows: pre-denaturation at 98°C for 30 seconds, followed by 35 cycles of denaturation at 98°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute and 30 seconds, and finally extension at 72°C for 10 minutes.

[0119] The amplification product was separated by 0.8% agarose gel electrophoresis, Figure 1 showing a specific band with a molecular weight of about 9.21 kb. This fragment was recovered using an AxyPrep DNA gel recovery kit to obtain 20 μL of product. Sequencing analysis showed that the nucleotide sequence of the PCR product was CHPO the gene sequence.

[0120] CHPO The coding sequence (CDS) of the gene is shown as SEQ ID NO: 1; CHPO The gene encodes a CHPO protein, and the amino acid sequence of the CHPO protein is shown as SEQ ID NO: 2.

[0121] Example 2, Construction of the Overexpression Vector pUN1301- CHPO Example 3, Construction of the Overexpression Vector pUN1301-

[0122] 1. Obtaining of the pUN1301 Vector

[0123] 1) About 0.2 g of corn seedlings (variety: Zhongzuo-Zhongdan 8, provided by Beijing Zhongnong Technology Development Co., Ltd.) were weighed and ground into powder in liquid nitrogen. 800 μΐ of freshly prepared extraction buffer (0.1 M Tris-HCl pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% SDS and 1% β-mercaptoethanol) was added, and the sample was thoroughly mixed to completely suspend. Then, it was heated in a 65°C water bath for 30 minutes, and mixed every 5 minutes. 250 μΐ of pre-cooled 5 M potassium acetate solution was added, and mixed quickly and placed in an ice bath for 5 minutes. Then, an equal volume of phenol / chloroform was added for one extraction, and centrifuged at 12000 rpm for 5 minutes. The supernatant was collected, and 0.6 times the volume of isopropanol was added for DNA precipitation. After standing at room temperature for 40 minutes, it was centrifuged at 12000 rpm at 4°C for 15 minutes, and the supernatant was discarded. The precipitate was washed with 70% and 100% ethanol, respectively, and dried, and then dissolved in 20 μΐ of ddH2O containing 100 μg / mL RNase to obtain corn genomic DNA.

[0124] 2) 2 μΐ of the corn genomic DNA solution extracted above was used as a template, and PCR amplification was performed using a 5' primer with a Hind III site (5'-GG AAGCTT CTGCAGTGCAGCGTGACCCGG -3') and a 3' primer with a BamHI site (5'-CG GGATCC AAGTAACACCAAACAACAGGG -3'). The PCR reaction conditions were as follows: 94°C pre-denaturation for 3 minutes; then 35 cycles, each cycle comprising 94°C for 45 seconds, 62°C for 45 seconds and 72°C for 2 minutes; finally, 72°C extension for 10 minutes. After the amplification, 0.8% agarose gel electrophoresis analysis was performed, and the results showed that a target fragment of about 2 kb was obtained, which was consistent with the expectation. The fragment was recovered and sequenced, and the results verified that the sequence was a corn ubiquitin promoter (UbiPro), i.e., a corn ubiqutin promoter, and the nucleotide sequence thereof is shown in SEQ ID NO: 3. The promoter can also be obtained by artificial synthesis.

[0125] 3) The Noster poly A terminator sequence (277 bp) was excised from the plasmid vector pBI121 (provided by Beijing Biodyne Co., Ltd., Catalog No: MP-091) using the restriction enzymes Sac I and EcoR I, and ligated into the vector pUC19 (provided by Beijing Baitaike Biotechnology Co., Ltd., Catalog No: DP7801) between the Sac I and EcoR I sites. The recombinant vector was named pUC19-Noster. Subsequently, pUC19-Noster was double-digested with Hind III and BamH I, and the linearized vector large fragment was recovered by electrophoresis and ligated with the maize ubiquitin promoter (UbiPro) produced by double digestion with Hind III and BamH I in step 2) to obtain the recombinant vector pUN19.

[0126] 4) The recombinant vector pUN19 was partially digested with EcoR I and completely digested with Hind III: first, EcoR I was added at 37°C for partial digestion, and after half an hour of digestion, the enzyme was inactivated by heating at 65°C for 20 minutes, then Hind III was added for complete digestion at 37°C for 3 hours. The fragment containing UbiPro and Noster was excised, with a length of about 2.3 kb. The fragment was cloned into the EcoRI and HindIII sites of the vector pCAMBIA1301 (provided by Biovector Co., LTD, Catalog No Biovec-11) to construct the recombinant vector pUN1301.

[0127] 2, Construction of the overexpression vector pUN1301 CHPO

[0128] The plasmid pUN1301 constructed in step 1 was double-digested with BamHI and KpnI, and the reaction system included: plasmid 2 µL, 10× digestion buffer 2 µL, BamHI 0.5 µL (10 U / µL), KpnI 0.5 µL (10 U / µL), and ddH2O was added to a total reaction volume of 20 µL. The enzyme digestion was performed at 37°C for 1 hour. Subsequently, the enzyme digestion products were separated by agarose gel electrophoresis, and the 4392 bp linearized pUN1301 large fragment was recovered and dissolved in 20 µL ddH2O for use.

[0129] The recombinant vector pUN1301 obtained in Example 1 was digested with BamHI and KpnI, and the reaction system included: plasmid 2 µL, 10× digestion buffer 2 µL, BamHI 0.5 µL (10 U / µL), KpnI 0.5 µL (10 U / µL), and ddH2O was added to a total reaction volume of 20 µL. The enzyme digestion was performed at 37°C for 1 hour. Subsequently, the enzyme digestion products were separated by agarose gel electrophoresis, and the 4392 bp linearized pUN1301 large fragment was recovered and dissolved in 20 µL ddH2O for use. CHPO ​3 µL of gene (SEQ ID NO:1) solution, 1 µL of recovered pUN1301 linearized vector, and 5 µL of recombinase 2×SoSoo Mix Plus (Tsingke Biological Technology, catalog number TSV-S2) were mixed and incubated at 50 °C for 15 minutes for ligation. The ligation product was then transformed into DH5α competent E. coli, and positive clones were screened using kanamycin-containing resistant plates. The recombinant plasmid was extracted from the positive clones and sequenced for verification. The results showed that the recombinant plasmid was... CHPO The expression vector constructed by inserting the gene (SEQ ID NO:1) between the BamHI and KpnI restriction sites of pUN1301 is named pUN1301. -CHPO Sequencing results confirmed that the promoter, gene, and terminator sequences and structures in the plasmid were complete and correct (see [link]). Figure 2 In this expression vector, the maize ubiquitin promoter (UbiPro) is used to drive... CHPO The target gene is expressed efficiently in plants.

[0130] Example 3 CHPO Construction of CRISPR gene vectors

[0131] 1) sgRNA target sequence design

[0132] Will CHPO The full-length CDS sequence of the gene was input into http: / / www.e-crisp.org / E-CRISP / designcrispr.html for sgRNA design. Specific parameter settings are as follows: Species selection is " Orzya sativa In IRGSP-1.0.31, select "Input is FASTA sequence" as the input format, set the application intensity to "medium," and click "Start SgRNA search" to begin the sgRNA sequence search. Filter out sequences containing... CHPO The highly conserved sgRNA sequence in the gene was ultimately identified as the target sequence of the sgRNA: 5´-GGAGGTGCGGAGGCACTACG-3´.

[0133] 2) pCRISPR- CHPO Carrier construction

[0134] Add “TGTG” to the 5' end of the target sequence as a forward primer, and add “AAAC” to the 5' end of the reverse complementary sequence as a reverse primer, resulting in the following primers:

[0135] Forward: 5´-TGTGGGAGGTGCGGAGGCACTACG-3´,

[0136] Reverse: 5'-AAACCGTAGTGCCTCCGCACCTCC-3'.

[0137] An appropriate amount of primers (10 μM) were mixed in equal volume, and the annealing preparation of Oligo dimer was performed using a PCR instrument, with the condition setting as follows: heating at 95℃ for 3 minutes, and then reducing to 20℃ at a rate of 0.2℃ / s. 2 μL of pTCRISPR vector (purchased from Baogai Gene Co., Ltd.) was taken and subjected to enzyme digestion using BasI enzyme, and the enzyme digestion reaction system was as follows: pTCRISPR 2 μl, BasI 1 μl, Buffer 2 μl, H2O 15 μl, and the total volume was 20 μl.

[0138] After enzyme digestion at 37℃ for 2 hours, the enzyme digestion product was separated by agarose gel electrophoresis, and a linearized pTCRISPR large fragment of 15900 bp was recovered and dissolved in 20 μL of ddH2O. Then, 1 μL of linearized pTCRISPR vector was connected with 3 μL of Oligo dimer using T4 ligase, and the connection reaction system was as follows: linearized pTCRISPR 1 μl, Oligo dimer 3 μl, T4 ligase 1 μl, T4 ligase buffer 1 μl, ddH2O 4 μl, and the total volume was 10 μl.

[0139] The connection product was transformed into DH5α competent E. coli, and positive clones were screened by kanamycin-containing resistance plates. The recombinant plasmid in the positive clone was extracted, and sequencing verification was performed to confirm that the correct CHPO gene CRISPR vector was obtained, which was named as pTCRISPR- CHPO (see Figure 5 ).

[0140] The recombinant vector pTCRISPR- CHPO contains CHPO an editing target point of a gene and a coding gene of Cas9 protein on the vector, and after being introduced into a receptor, a guide RNA (sgRNA) transcribed can target a target sequence near PAM in the genome of the receptor cell, that is, target CHPO a gene, and the Cas9 protein makes a DNA double-strand break at the target point of the gene, and through the DNA damage repair response mechanism of the organism itself, a gene mutation occurs in the cutting region during the repair process, resulting in a frameshift mutation or a translation premature termination of the coding gene, so as to realize the knockout of the CHPO gene. CHPO

[0141] Example 4, obtaining of transgenic rice ​

[0142] The pUN1301 -CHPO and pTCRISPR -CHPO plasmids were transformed into Agrobacterium EHA105 (reference: Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271-282; the strain can be obtained from the Institute of Botany, Chinese Academy of Sciences) by electroporation. Positive clones of overexpression and CRISPR mutant engineering strains were obtained by screening kanamycin and rifampicin-resistant plates, and were named EHA105 / pUN1301 -CHPO and EHA105 / pTCRISPR -CHPO respectively. After obtaining the engineering bacteria EHA105 / pUN1301 -CHPO and EHA105 / pTCRISPR -CHPO , they were used to infect callus of Kongyu 131 (Oryza sativa L. cv Kongyu 131, hereinafter referred to as wild type rice). The callus introduced into EHA105 / pUN1301 CHPO and EHA105 / pTCRISPR -CHPO was washed 5 times with sterile water containing 300 mg / L cefotaxime, and then transferred to N6D2S1 medium for primary screening after being absorbed. After two weeks, the callus was transferred to N6D2S2 medium for secondary screening (2 weeks per generation). The resistant callus that grew vigorously after 3 generations of screening was transferred to differentiation medium (1) and cultured in a differentiation incubator (light cycle 12 hours, 28°C during the day, 25°C at night) for 7 days. Then the callus was transferred to differentiation medium (2) and cultured until the regenerated seedlings grew. The obtained regenerated plants were rooted in rooting and seedling culture medium, and when the seedlings grew to about 10 cm, the container sealing film was opened for hardening for 2-3 days, then transplanted into an artificial climate room for cultivation, and finally 10 overexpression lines and 7 CHPO mutant lines of T0 generation rice plants were obtained. The medium used is shown in Table 1.

[0143]

[0144] Example 5, identification of overexpression CHPO transgenic rice

[0145] 1. GUS histochemical staining

[0146] The 24 T0 generation plants obtained CHPO 2-3 mm root segments of transgenic rice were placed in GUS staining solution and incubated at 37°C for 1 hour. Plants with blue roots after staining were identified as positive transgenic materials. The GUS staining solution (pH 7.0) consisted of: 100 mM Na3PO4 (pH 7.0), 0.1% Triton X-100, 10 mM EDTA, 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide, and 1 mg / mL X-Gluc. The results showed that 11 lines were identified, totaling 19 positive T0 generation plants. CHPO Genetically modified rice.

[0147] Subsequently, the positive T0 generation plants were transferred to a greenhouse for cultivation. Seeds were collected according to the lineage to obtain T1 generation transgenic seeds. Based on these, homozygous T2 generation seeds were obtained through propagation. In subsequent experiments, seeds numbered OE were selected. jap -1、OE jap -2 T2 generation transfer CHPO Rice was used as the material.

[0148] 2. Quantitative PCR identification

[0149] From the number OE Jap -1、OE Jap -2 T2 generation CHPO Total RNA was extracted from transgenic rice seedlings and treated with RNase-free DNase I. Two μg of total RNA was used for first-strand cDNA synthesis via M-MLV reverse transcriptase. After reverse transcription of total RNA to generate cDNA, gene-specific primers were designed using Primer 5.0, with Ubiquitin primers as an internal standard. The primer length was set to 20 bp, Tm value between 55-70℃, GC content between 40-80%, and the expected amplified fragment length to be 100-150 bp. The primers used for quantitative PCR detection are as follows:

[0150] 5' primer F: 5'-GCCGGGCATGAAGCACCACC-3',

[0151] 3' primer R: 5'-GGTAGCCGACGGGCACGACGTAC-3'.

[0152] The reverse transcription product was diluted 30-fold, and 3 μl was used as a template. SYBR GREEN PCR reagent kit (SYBR® Green Realtime PCR Master Mix, Toyobo, Japan) was used to configure the reaction solution, and the system was as follows: SYBR® Green Realtime PCR Master Mix 7.5 μl, Primer F 0.25 μl, Primer R 0.25 μl, cDNA 3.0 μl, H2O 3.25 μl, DMSO 0.75 ul, total volume: 15.0 μl.

[0153] PCR amplification was performed on a real-time quantitative PCR instrument QuantStudio 3 (appliedbio systems, USA), and the program was set as follows: 95°C pre-denaturation for 3 minutes; 95°C for 15 seconds, 72°C for 35 seconds, a total of 45 cycles; then 95°C for 30 seconds, 56°C for 30 seconds, 95°C for 30 seconds. The relative expression amount of the gene was calculated by CT value. The results are shown in Figure 3 , taking Ubiquitin as the internal reference, and comparing wild type rice (ZH11) and OE jap -1 and OE jap -2 T2 generation CHPO Transgenic rice seedlings, CHPO The expression abundance of the gene in the transgenic plants was up-regulated to different degrees, indicating that the target gene ( CHPO ) was successfully expressed at the transcriptional level.

[0154] Example 6、 CHPO Gene CRISPR / Cas9 mutant identification

[0155] 16 CHPO Gene CRISPR / Cas9 Mutant lines of seedlings were taken, and their genomic DNA was extracted. 2 μL of genomic DNA solution was used as a template, and PCR amplification was performed using CHPO Gene CRISPR / Cas9 special sequencing primers, and the amplification primers were as follows:

[0156] CHPO -CRseq-F: 5´-TCTTGTGGATAAGGCTCCCTC-3´,

[0157] CHPO -CRseq-R: 5´-CTCTTGGCATCTGATCTATGTATGT-3´.

[0158] The PCR reaction conditions were set as follows: pre-denaturation at 95℃ for 3 minutes; followed by 35 cycles (95℃ for 45 seconds, 55℃ for 45 seconds, 72℃ for 30 seconds); and finally extension at 72℃ for 2 minutes. After the reaction, the PCR product was detected by 0.8% agarose gel electrophoresis, showing an amplified fragment of approximately 1 kb, consistent with the expected result. The target fragment was recovered and sequenced. Lines showing bimodal sequencing results were selected for propagation to obtain the T1 generation transgenic lines. Based on this, further propagation was carried out, and homozygous T2 generation single plants were screened through one round of identification and sequencing. Finally, two homozygous mutant lines were identified and named... chpo-1 and chpo- 2 These two strains will be used as materials in subsequent experiments (see...). Figure 6 ).

[0159] Example 7: Phenotypic observation of transgenic rice

[0160] 1. CHPO Phenotypic observation of overexpression lines

[0161] Number OE jap -1、OE jap -2 T2 generation transfer CHPO Rice seeds and Zhonghua 11 (ZH11; WT) seeds were soaked in water at 30℃ for 3 days to germinate, then transferred to Kimura B medium in 96-well plates and cultured in an artificial climate chamber until the three-leaf stage (light intensity 10000 µmol / m² / s, photoperiod 14 h / day, temperature 30℃). The three-leaf stage seedlings were then treated in a 4℃ low-temperature water bath before being transferred back to the artificial climate chamber to resume growth. Seedling photographs were taken and survival rates were recorded. Each line had 32 plants per treatment, and the experiment was repeated three times; the results were averaged.

[0162] The results are as follows Figure 4 China A and Figure 4 As shown in Figure B, before low-temperature treatment, wild-type rice (ZH11) and CHPO The overexpression lines showed no significant phenotypic differences; after treatment at 4℃ and recovery of growth, CHPO The overexpression rice showed significantly higher resilience to low temperature stress than the wild type (ZH11). Figure 4 C and Figure 4 The figure in D shows the statistical results of survival rate and tillering rate.

[0163] After treatment at 4℃ for 72 hours and followed by 28 days of recovery growth, OE jap -1 and OE jap -2 T2 generation transfer CHPOThe survival rates of rice were 50.6% and 50.9%, respectively, while the survival rate of ZH11 was 15.2%. After treatment at 4℃ for 60 hours and recovery for 40 days, the survival rate of OE was... jap -1 and OE jap The tillering rates of surviving individuals of type -2 reached 64.5% and 73.5%, respectively, while the tillering rate of ZH11 was 30.2%.

[0164] The results show that CHPO The survival rate and tillering rate of transgenic rice after low-temperature treatment were significantly higher than those of wild type, indicating that... CHPO Genetically modified rice exhibits greater tolerance to low-temperature stress and stronger recovery ability after stress. CHPO Overexpression of the gene can enhance the tolerance and resilience of rice to low temperatures.

[0165] 2. chpo Mutant phenotypic observation

[0166] Number chpo-1 and chpo-2 T2 generation seeds and seeds of Kongyu 131 (KY131; WT) were soaked in water at 30℃ for 3 days. After germination, they were placed in Kimura B medium in 96-well plates and cultured in an artificial climate chamber (light intensity 10000 µmol / m² / s, light intensity 14 hours / day, temperature 30℃) until the three-leaf stage. The three-leaf stage seedlings were then treated in a 4℃ low-temperature water bath, and subsequently transferred back to the artificial climate chamber to resume growth. Photographs were recorded and survival rates were calculated. Thirty-two seedlings were treated for each line, and the experiment was repeated three times. The average results were taken.

[0167] The results are as follows Figure 7 China A and Figure 7 As shown in Figure B, before low-temperature treatment, wild-type rice (KY131) and chpo The mutant lines showed no significant phenotypic differences; however, after treatment at 4℃ and subsequent recovery of growth, chpo The mutant's resilience to low-temperature stress was significantly lower than that of the wild type (KY131). Figure 7 C and Figure 7 Figure D shows the statistical results of survival rate and tillering rate.

[0168] After treatment at 4℃ for 72 hours and recovery of growth for 28 days, chpo-1 and chpo-2 The survival rates were 3.7% and 6.1%, respectively, while the survival rate of KY131 was 32.6%. Under the same treatment and recovery conditions, chpo-1 The survival rate of tillering individuals was 20%, while that of KY131 was 58%.

[0169] The results showed that after low-temperature treatment chpoThe survival rate and tillering rate of the mutant rice were obviously lower than those of the wild type, indicating that the chpo mutant had poor tolerance to low temperature stress and weak recovery ability after stress.

[0170] The composition of the Kimura B culture solution is as follows:

[0171]

[0172] In practical application, 5 ml of A liquid mother liquor, 5 ml of B liquid mother liquor, 1 ml of EDTA-Fe mother liquor, 1 ml of trace element mother liquor and 100-300 mg of sodium silicate are mixed and diluted to 1 L with distilled water, and the pH value of the Kimura B culture solution is adjusted to 5.8 with 1 mol / L HCl, so as to obtain 1 L of Kimura B culture solution.

[0173] The present application has been described in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including the changes made by the conventional techniques known in the art, which deviates from the range disclosed in the present application.

Claims

1. Use of a protein, characterized in that, The application is any one of the following: A1) application in regulating low temperature recovery of rice; A2) application in regulating low temperature tolerance of rice; A3) application in breeding low temperature tolerant rice; A4) application in low temperature tolerant molecular breeding or low temperature tolerant germplasm improvement of rice; The protein is any one of the following: B1) a protein with an amino acid sequence of SEQ ID NO: 2; B2) a fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1).

2. Use of a biological material associated with the protein as claimed in claim 1, characterised in that, The application is any one of the following: C1) application in regulating low temperature recovery of rice; C2) application in regulating low temperature tolerance of rice; C3) application in breeding low temperature tolerant rice; C4) application in low temperature tolerant molecular breeding or low temperature tolerant germplasm improvement of rice; The biological material is any one of the following: D1) a nucleic acid molecule encoding the protein in claim 1; D2) an expression cassette containing the nucleic acid molecule in D1); D3) a recombinant vector containing the nucleic acid molecule in D1), or a recombinant vector containing the expression cassette in D2); D4) a recombinant microorganism containing the nucleic acid molecule in D1), or a recombinant microorganism containing the expression cassette in D2), or a recombinant microorganism containing the recombinant vector in D3); D5) a recombinant host cell containing the nucleic acid molecule in D1), or a recombinant host cell containing the expression cassette in D2), or a recombinant host cell containing the recombinant vector in D3); D6) a transgenic plant tissue containing the nucleic acid molecule in D1), or a transgenic plant tissue containing the expression cassette in D2); D7) a transgenic plant organ containing the nucleic acid molecule in D1), or a transgenic plant organ containing the expression cassette in D2).

3. Use according to claim 2, characterized in that, The nucleic acid molecule in D1) is a DNA molecule with a coding sequence or a nucleotide sequence of SEQ ID NO:

1.

4. A method for breeding a low temperature tolerant rice plant, characterized by, The method comprises increasing the content and / or activity of the protein in claim 1 in the target rice, to obtain low temperature tolerant rice with higher low temperature tolerance than the target rice.

5. The method of claim 4, wherein, The increase in the content and / or activity of the protein in claim 1 in the target rice is achieved by increasing the expression amount of the coding gene of the protein in the target rice.

6. The method of claim 5, wherein, The increase in the expression amount of the coding gene of the protein in the target rice is achieved by introducing the coding gene of the protein in claim 1 into the target rice.

7. The method of claim 6, wherein, The nucleotide sequence of the coding gene of the protein is SEQ ID NO:

1.

8. A method for improving cold tolerance or cold recovery of a rice plant of interest, the method comprising introducing into the plant a nucleic acid molecule encoding a protein having the amino acid sequence of SEQ ID NO:

2. The method comprises increasing the content and / or activity of the protein in claim 1 in the target rice.

Images