Method for realizing efficient synthesis of human lactoferrin through multi-copy integration and application

Abstract

The invention discloses a method for realizing efficient synthesis of human lactoferrin through multi-copy integration and application, and relates to the technical field of genetic engineering and bioengineering. The invention provides a method for synthesizing human lactoferrin, which comprises the following steps of: performing fermentation culture on a recombinant aspergillus niger strain, and separating and purifying to obtain the human lactoferrin, the construction method of the recombinant aspergillus niger strain comprises the step of integrating the hLF gene into a gene locus of a host strain genome to construct the recombinant aspergillus niger strain. A recombinant aspergillus niger strain capable of recombining and expressing human lactoferrin is constructed, protein expression is promoted through a strong inducible promoter, endogenous high secretory protein is fused, and a lactoferrin expression cassette is integrated by optimizing a multi-copy integration method, so that high-level synthesis of human lactoferrin is realized; and a foundation is laid for industrial production of lactoferrin or high-density fermentation of other food functional proteins by using aspergillus niger.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and bioengineering, and in particular to a method and application of realizing efficient synthesis of human lactoferrin through multi-copy integration. Background Art

[0002] Lactoferrin is an iron-binding glycoprotein and an important edible nutritional protein with a molecular weight of about 80kDa. It is widely present in the milk, serum, tears, semen and mucosal secretions of mammals. Lactoferrin has broad-spectrum antibacterial, antiviral, immunomodulatory and other physiological functions, and is used in various fields such as infant formula, nutritional supplements, and cosmetics. In breast milk, lactoferrin is a major whey protein, accounting for 10%-30% of the total whey protein content. Human colostrum is rich in lactoferrin, with an average concentration of 5-6mg / mL. The concentrations of lactoferrin in bovine colostrum and milk are approximately 1 and 0.2mg / mL, respectively, which are lower than the concentrations of lactoferrin in human breast milk and colostrum.

[0003] The most significant biological property of lactoferrin is its high affinity for iron, which can increase the bioavailability of iron in intestinal cells, stabilize reduced iron ions, and reduce irritation to the intestine and stomach. Lactoferrin is involved in many physiological functions, including regulating iron absorption and immune response. It also has antioxidant activity, antibacterial and antiviral biological activities, and has anticancer and anti-inflammatory properties. The antibacterial activity of lactoferrin has been widely demonstrated in Gram-positive and Gram-negative bacteria, especially in common drug-resistant bacteria. More importantly, lactoferrin is a component of the human innate nonspecific immune system and constitutes the initial immune defense system. Studies have found that the positive charge of lactoferrin enables it to bind to negatively charged molecules on the surface of various cells of the immune system. This combination can trigger signaling pathways and lead to cellular responses such as activation, differentiation, and proliferation. In addition to inducing systemic immunity, lactoferrin can also promote skin immunity and inhibit allergic reactions.

[0004] The most widely used way to obtain lactoferrin is to separate and extract it from animal milk, but there are problems such as high extraction and purification costs and environmental unfriendliness. Due to the complex extraction process and low separation and extraction yield, the price of lactoferrin on the market remains high. The production of lactoferrin through genetic engineering technology has become a research hotspot and development trend for industrial production of lactoferrin and avoiding its side effects. The optimization of recombinant expression of lactoferrin and the amplification of fermentation processes using microbial hosts are in line with the goal of green biomanufacturing. Compared with traditional animal and plant extraction methods, the production cost and time of biosynthesis will be greatly shortened, which is expected to make the industrial production of lactoferrin more efficient, in line with the direction of modern industry's pursuit of sustainable development and green production, and help reduce the burden of the production process on the environment and resources.

[0005] Aspergillus niger has advantages over other microbial species in protein secretion and is generally regarded as a safe (GRAS) strain. First, they have the natural secretion ability of a variety of proteins, efficient folding and post-translational modification capabilities, as well as the characteristics of cheap culture and easy induction. This innate excellent protein secretion ability makes Aspergillus niger an ideal chassis for the production of recombinant proteins. Researchers have done a lot of work to develop an efficient expression system for Aspergillus niger to produce homologous and heterologous proteins. In addition, industrial fermentation systems have established a good foundation for several species. However, when heterologous proteins are expressed in filamentous fungi, their production capacity is far from that of endogenous proteins. This is because the expression of heterologous proteins puts a lot of pressure on the cell secretion system, which can easily cause changes in the protein folding and modification of the filamentous fungi themselves. At the same time, endogenous proteases will also cut heterologous proteins, resulting in the degradation of exogenous proteins and reducing protein production.

[0006] The present invention intends to develop a method for realizing efficient synthesis of human lactoferrin by multi-copy integration, in order to realize efficient microbial expression of human lactoferrin. Summary of the invention

[0007] The purpose of the present invention is to provide a method and application of multi-copy integration to achieve efficient synthesis of human lactoferrin, so as to solve the problems existing in the above-mentioned prior art. The present invention constructs a recombinant Aspergillus niger strain capable of recombinantly expressing human lactoferrin, starts protein expression through a strong inducible promoter, fuses endogenous highly secreted proteins, and optimizes the multi-copy integration method to integrate the lactoferrin expression frame, thereby achieving high-level synthesis of human lactoferrin.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a method for constructing a recombinant Aspergillus niger strain expressing lactoferrin, comprising the steps of integrating the hLF gene into a gene site of a host strain genome to construct the recombinant Aspergillus niger strain;

[0010] The nucleotide sequence of the hLF gene is shown in SEQ ID NO.1;

[0011] The gene locus is at least one of a glaA locus, an amyA locus, an ammA locus, a pepA locus and a pepB locus;

[0012] The host strain is Aspergillus niger AG11-PK.

[0013] Furthermore, the 5' end of the hLF gene is connected to the glaA fragment and then integrated into the gene site of the host strain genome;

[0014] The nucleotide sequence of the glaA fragment is shown in SEQ ID NO.4.

[0015] Furthermore, the method for integrating the hLF gene into the gene locus of the host strain genome comprises the following steps:

[0016] The 5' end of the hLF gene was connected to the glaA fragment, and then connected to the pAN7-1 vector to obtain the recombinant plasmid pAN7-1-hLF;

[0017] Using the genome of the Aspergillus niger AG11-PK as a template, amplifying the upstream and downstream homology arms of the gene locus respectively;

[0018] The recombinant plasmid pAN7-1-hLF is amplified by PCR to obtain an open reading frame fragment FhLF with a promoter and a terminator;

[0019] Recombining the upstream homology arm, the FhLF, the downstream homology arm and the pAN7-1 vector by the Gibson assembly method to obtain a recombinant vector;

[0020] The recombinant vector is linearized and then transferred into the host strain.

[0021] Furthermore, the construction method also includes the step of knocking out the pepA gene and the pepB gene of the host strain.

[0022] Furthermore, the construction method also includes the step of knocking out the glaA gene, the amyA gene, the ammA gene and the albA gene of the host strain.

[0023] Furthermore, the CRISPR gene editing system is used for gene knockout; the C segment of the Cas9 protein of the CRISPR gene editing system is fused to Brex27; the nucleotide sequence of the gene encoding Brex27 is shown in SEQ ID NO.7.

[0024] The present invention also provides a recombinant Aspergillus niger strain expressing lactoferrin constructed according to the above construction method.

[0025] The present invention also provides application of the recombinant Aspergillus niger strain in preparing lactoferrin.

[0026] The present invention also provides a method for preparing lactoferrin, comprising the steps of fermenting and culturing the above-mentioned recombinant Aspergillus niger strain, and then separating and purifying to obtain the lactoferrin.

[0027] The present invention also provides lactoferrin prepared according to the above preparation method.

[0028] The present invention discloses the following technical effects:

[0029] The present invention constructs a recombinant Aspergillus niger strain capable of recombinantly expressing human lactoferrin, starts protein expression through a strong inducible promoter, fuses endogenous highly secreted proteins, and optimizes the multi-copy integration method to integrate the lactoferrin expression frame, thereby achieving extracellular high-level synthesis of human lactoferrin. On this basis, process optimization is carried out on a 5L tank, high-density fermentation of Aspergillus niger is achieved, and human lactoferrin can be efficiently synthesized, so that the cell dry weight of fermentation 144h reaches 87.76±2.34g, and the lactoferrin output reaches 335.78±2.71mg / L. The present invention lays a foundation for the industrial production of lactoferrin or other food functional proteins fermented with Aspergillus niger at high density. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 This is the fermentation curve of the engineered Aspergillus niger hLF26 producing human lactoferrin in a 5L tank. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] The culture medium formula involved in the following examples is as follows:

[0038] LB medium (1 L): 5 g yeast extract, 10 g tryptone and 10 g sodium chloride.

[0039] Seed culture medium (1 L): 30 g corn steep liquor, 20 g soybean powder, 20 g corn starch and 5 g glucose, pH 6.0.

[0040] Fermentation medium (1 L): 50 g glucose, 7.5 g sodium nitrate, 3 g potassium dihydrogen phosphate, 1.7 g sodium dihydrogen phosphate, 1 g magnesium sulfate heptahydrate, 0.5 g EDTA, 0.3 g ferrous sulfate heptahydrate, 0.076 g anhydrous calcium chloride, 0.04 g zinc sulfate heptahydrate, 0.04 g manganese sulfate monohydrate, 0.016 g copper sulfate pentahydrate, 0.016 g cobalt chloride hexahydrate and 1 mL defoamer, pH 6.0.

[0041] Feed medium (1 L): 400 g glucose, 7.5 g sodium nitrate, 3 g potassium dihydrogen phosphate, 1.7 g sodium dihydrogen phosphate, 1 g magnesium sulfate heptahydrate, 0.5 g ethylenediaminetetraacetic acid (EDTA), 0.3 g ferrous sulfate heptahydrate, 0.076 g anhydrous calcium chloride, 0.04 g zinc sulfate heptahydrate, 0.04 g manganese sulfate monohydrate, 0.016 g copper sulfate pentahydrate, 0.016 g cobalt chloride hexahydrate and 1 mL defoamer, pH 6.0.

[0042] The detection method of lactoferrin is as follows: take samples of different fermentation time, centrifuge at 12,000×g and 4°C for 15 min, and take the supernatant for dilution detection. The lactoferrin content is determined by human lactoferrin transfer protein (LTF / LF) ELISA kit (Sangon Biotechnology (Shanghai) Co., Ltd.), and the specific steps are shown in the instructions for use.

[0043] The host strain used in the present invention is Aspergillus niger AG11-PK, which has been disclosed in the document "Heterologous expression of a highly thermostable L-asparaginase from Thermococcus zilligii in Aspergillus niger for efficient reduction of acrylamide in French fries". The present invention promises to release it to the public 20 years from the filing date of the present invention.

[0044] Example 1 Construction of a recombinant Aspergillus niger strain expressing lactoferrin

[0045] The highly expressed site glaA in Aspergillus niger AG11-PK was selected as the integration site for integrating the lactoferrin coding gene. The synthesized hLF sequence (nucleotide sequence as shown in SEQ ID NO.1) was used as a template, and the hLF fragment was obtained by PCR amplification with primer pair F1 / F2; the vector pAN7-1 (disclosed in the paper "Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli") was used as a template, and the primer pair FP1 / FP2 was used for PCR amplification, and the product was purified. The fragment hLF and the vector pAN7-1 were assembled by the Gibson assembly method to obtain a recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli JM109, the plasmid was extracted and sequenced to verify the correctness of the sequence, and the correct recombinant plasmid pAN7-1-hLF was obtained.

[0046] Primers F3 / R3 and F4 / R4 were designed, and the upstream and downstream homologous arms UPglaA and DWglaA of the glaA site were amplified using the genome of Aspergillus niger AG11-PK as a template. The recombinant plasmid pAN7-1-hLF was PCR amplified with primers F5 / R5 to obtain the open reading frame fragment FhLF with a promoter and terminator. The fragments UPglaA, DWglaA, FhLF and the pAN7-1 vector backbone were recombined by the Gibson assembly method to obtain the correct recombinant vector pAN7-1-UPglaA-FhLF-DWglaA; pAN7-1-UPglaA-FhLF-DWglaA was PCR amplified with primers F3 / R4, and the PCR product was purified to obtain a linearized fragment. The obtained pAN7-1-UPglaA-FhLF-DWglaA linearized fragment was transferred into Aspergillus niger AG11-PK to obtain the recombinant strain hLF01.

[0047] In order to increase the yield of lactoferrin, the endogenous highly secreted protein saccharifying enzyme of Aspergillus niger was fused to the N segment of lactoferrin to promote the expression and secretion of lactoferrin. The glaA fragments of different amino acid lengths (i.e., glaA125, glaA264 and glaA498, whose nucleotide sequences are shown in SEQ ID NO.2-4, respectively) were amplified from the genome of Aspergillus niger AG11-PK using primers F6 / R6-8; the recombinant vector pAN7-1-UPglaA-FhLF-DWglaA was used as a template, PCR amplification was performed using primers FP3 / FP4, and the product was purified. The fragments glaA125, glaA264 and glaA498 were recombined with the vector pAN7-1-UPglaA-FhLF-DWglaA by the Gibson assembly method to obtain the correct recombinant vectors pAN7-1-UPglaA-125glaA-FhLF-DWglaA, pAN7-1-UPglaA-264glaA-FhLF-DWglaA and pAN7-1-UPglaA-498glaA-FhLF-DWglaA.

[0048] Using primers F3 / R4, pAN7-1-UPglaA-125glaA-FhLF-DWglaA, pAN7-1-UPglaA-264glaA-FhLF-DWglaA and pAN7-1-UPglaA-498glaA-FhLF-DWglaA were PCR amplified, and the PCR products were purified to obtain linearized fragments. The obtained linearized fragments were respectively transferred into Aspergillus niger AG11-PK to obtain strains hLF125, hLF264 and hLF498. The engineered strain was cultured in a seed culture medium for 16 hours to obtain a seed solution, which was then inoculated into a fermentation medium and fermented at 30°C and 220rpm for 96 hours. The engineered bacteria were verified to produce lactoferrin by an ELISA specific detection kit, among which the lactoferrin yield in the hLF498 fermentation broth was the highest, with a content of 2.38±0.07mg / L.

[0049] Primer sequences are shown in Table 1.

[0050] Table 1 Primers used to construct truncated human lactoferrin hLF expression vector

[0051]

[0052]

[0053] Example 2 Construction of a high-level lactoferrin-synthesizing strain

[0054] Based on the engineered bacterium hLF498 constructed in Example 1, the expression of lactoferrin was further improved by knocking out the endogenous protease genes pepA (nucleotide sequence shown in SEQ ID NO.5) and pepB (nucleotide sequence shown in SEQ ID NO.6).

[0055] Primers F9 / R9 and F10 / R10 were designed, and the genome of Aspergillus niger AG11-PK was used as a template to amplify the upstream and downstream homology arms UPpepA and DWpepA of the pepA site. Furthermore, primers F9 / R10 were designed, and UPpepA and DWpepA were used as templates to amplify the fusion fragment UDpepA of the upstream and downstream homology arms.

[0056] Primers F11 / R11 and F12 / R12 were designed, and the genome of Aspergillus niger AG11-PK was used as a template to amplify the upstream and downstream homology arms UPpepB and DWpepB of the pepB site. Furthermore, primers F11 / R12 were designed, and UPpepB and DWpepB were used as templates to amplify the fusion fragment UDpepB of the upstream and downstream homology arms.

[0057] By designing primers F13 / R13 and using the genome of Aspergillus niger AG11-PK as a template, the Aspergillus niger U3 promoter was amplified.

[0058] An online tool (http: / / crispor.tefor.net / ) was used to predict the protospacers of the pepA and pepB genes for the location of gene editing sites, and their nucleotide sequences are shown in Table 3.

[0059] The sgRNA scaffold was amplified by designing primers F14 / R14 and using plasmid pLCs1 as a template. Plasmid pLCs1 has been published in the literature “Visualized Multigene Editing System for Aspergillus niger”.

[0060] The vector pFC332 was used as a template and double-digested with BglI I and Pac I, and the resulting linearized fragment was recovered for later use.

[0061] The U3 promoter, Protospacers, sgRNA scaffold and linearized vector pFC332 were assembled by Gibson assembly to obtain recombinant plasmids. The recombinant plasmids were transformed into Escherichia coli JM109, the plasmids were extracted and sequenced to verify the correctness of the sequence, and the correct recombinant plasmids pCas-pepA-sgRNA and pCas-pepB-sgRNA were obtained.

[0062] Finally, the construction of pepA and pepB gene knockout strains was completed. Using hLF498 as the host bacteria, pCas-pepA-sgRNA and UDpepA and pCas-pepB-sgRNA and UDpepB were co-transformed in sequence to complete the seamless knockout of pepA and pepB genes and obtain strain hLF14.

[0063] The present invention prepares an Aspergillus niger protease-deficient strain through a CRISPR knockout system, which can optimize the expression and secretion process of heterologous proteins (especially heterologous proteins that are sensitive to endogenous proteases of Aspergillus niger).

[0064] In this embodiment, the engineered bacteria hLF14 with pepA and pepB genes knocked out was cultured in a seed culture medium for 16 hours to obtain a seed solution, which was then inoculated into a fermentation medium and fermented at 30°C and 220 rpm for 96 hours. The lactoferrin production detected by the engineered bacteria was increased to 3.63±0.05 mg / L as verified by an ELISA specific detection kit.

[0065] Primer sequences are shown in Table 2.

[0066] Table 2 Primers used to construct pepA and pepB gene knockout strains

[0067]

[0068] Table 3 Protospacers used to construct pepA and pepB gene knockout vectors

[0069]

[0070] SEQ ID NO.5:

[0071]

[0072] SEQ ID NO.6:

[0073] ATGAAGTTCTCTACCATCCTTACCGGCTCCCTCTTCGCCACTGCCGCTCTGGCTGCTCCTCTCACTGAGAAGCGCCGTGCTCGCAAGGAGGCCCGCGCCGCTGGCAAGCGCCACAGCAACCCTCCCTACATCCCTGGTTCCGACAAGGAGATCCTCAAGCTGAACGGCACCTCCAACGAGGATTACAGCTCCAACTGGGCTGGTGCCGTCCTGATCGGCGACGGCTACACCAAGGTCACTGGCGAGTTCACTGTCCCCAGTGTCTCTGCTGGATCTAGCAGCTCCAGTGGCTACGGCGGTGGCTACGGCTACTACAAGAACAAGAGACAATCCGAGGAGTACTGCGCCTCCGCTTGGGTTGGTATCGACGGTGACACCTGCGAGACCGCTATTCTCCAGACTGGTGTCGACTTCTGCTACGAGGATGGCCAGACTTCCTACGATGCCTGGTACGAGTGGTACCCCGACTACGCCTACGACTTCAACGACATCACCATCTCCGAGGGTGACACCATCAAGGTCACTGTCGAGGCCACCAGCAAGAGCAGCGGTAGCGCCACCGTTGAGAACCTGACCACTGGCCAGTCCGTCACCCACACCTTCAGCGGCAACGTCGAGGGTGACCTTTGCGAGACCAACGCCGAGTGGATCGTCGAGGACTTCGAGTCTGGTGACTCTCTTGTGGCTTTCGCTGACTTCGGCTCCGTTACCTTCACCAATGCTGAGGCTACCAGCGACGGTTCCACTGTCGGCCCCTCTGACGCTACCGTTATGGACATTGAGCAGGATGGCACCGTCCTCACCGAGACCTCCGTCTCTGGCGACAGCGTCACTGTCACCTACGTTTAA。

[0074] Construction of a multi-copy integration tool in Aspergillus niger in Example 3

[0075] The low-level expression of the heterologous lactoferrin expression cassette limits the synthetic yield of lactoferrin. In order to improve the synthetic efficiency of lactoferrin, the lactoferrin expression cassette was further integrated into the amyA, ammA, pepA and pepB sites on the genome based on the engineered bacterium hLF14 by constructing a CRISPR multi-gene editing system. However, the efficiency of multi-gene editing in Aspergillus niger is extremely low, and it is necessary to construct an efficient multi-copy integration tool to achieve multi-copy integration of lactoferrin. Among them, the promoter of sgRNA, the connection mode between the multi-gRNA array and the homologous recombination efficiency of the host bacteria are crucial to the integration efficiency. Knockout of the polyketide synthase gene (albA) can make Aspergillus niger spores appear white. When a multi-gRNA expression cassette is used to simultaneously edit the albA gene and the target integration site, the probability of achieving multi-site simultaneous integration in the colonies where the spore color changes will increase, and screening for white spores will greatly reduce the workload of positive strain screening.

[0076] In this example, the inventors designed a tRNA-gRNA array containing albA gene gRNA to improve the selection efficiency of multi-gene editing positive transformants in AG11-PK on the primary transformation plate. Secondly, the promoter in the visual gene editing starting gRNA expression frame was optimized and combined with the modification of Cas9 protein to improve the host homologous recombination efficiency, and a visual tRNA-gRNA array was designed for multiple target gene editing.

[0077] In this example, the six main genes of Aspergillus niger, glaA, amyA, ammA, pepA, pepB and albA, were selected as target genes for verification.

[0078] First, for the assembly of 6 groups of gRNA, pairs of primers with complementary sequences were designed, and the corresponding primers are listed in Table 4. Specifically, using pU3_fwd and pU3_rev as primers and the Aspergillus niger AG11 genome as a template, the Aspergillus niger PU3 promoter was amplified; using tRNA_fwd and tRNA_rev as primers and the Aspergillus niger AG11 genome as a template, 6 corresponding tRNAs were amplified; using gRNA_fwd and gRNA_rev as primers and the plasmid pLCs1 as a template, 6 sites of sgRNA scaffolds were amplified; using Tu3_fwd and Tu3_rev as primers and the Aspergillus niger AG11 genome as a template, the Aspergillus niger TU3 terminator was amplified; using pFC332_fwd and pFC332_rev as primers and the pFC332 vector as a template, the linearized pFC332 fragment was amplified. Among them, the PCR primers were designed to form double-stranded DNA with BsmBI restriction sites at both ends, and then assembled with the pFC332 vector through Golden gate to obtain the sgRNA array expression vector pFC332-sgRNAs containing glaA, amyA, ammA, pepA, pepB and albA. The specific operation of Golden gate is disclosed in the paper "Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes" for reference.

[0079] Furthermore, the genome of the AG11-PK strain was used as a template to clone six gene homology arms, and the knockout frames of the six genes were obtained by fusion PCR, and assembled into the vector pAN7-1 to obtain plasmid pAN7-1-UD6. Plasmid pAN7-1-UD6 and pFC332-sgRNAs were transformed into AG11-PK, and the target length was verified by colony PCR. Then, the genomic target sequence was amplified and sequenced for verification. The editing efficiency of the above process was only 5%. Furthermore, by modifying the Cas9 protein, the Brex27 sequence (nucleotide sequence as shown in SEQ ID NO.7) was fused to its C segment to recruit homologous recombination proteins, and the efficiency of simultaneous editing of the above six genes was increased to 30%.

[0080] Furthermore, after the required editing is completed, the following method can be used to eliminate the plasmid: the verified positive strain is transferred to the seed culture medium and shaken for 24 hours, streaked onto a PDA plate without antibiotics, and the plate transfer is repeated 3 times. After a single colony is grown, the plasmid-eliminated strain is obtained by colony PCR screening.

[0081] SEQ ID NO.7:

[0082] GCCCTCGACTTCCTGTCCCGCCTCCCTCTGCCTCCCCCCGTCTCCCCCATCTGCACC TTCGTCTCCCCCGCCGCTCAGAAGGCCTTTCAGCCCCCCCGCTCCTGCGGC.

[0083] Table 4 Primers used to construct pFC332-sgRNAs vector

[0084]

[0085] Example 4 Multi-copy integration of high-level synthetic lactoferrin

[0086] Firstly, primers F15 / R15 and F16 / R16 were designed, and the genome of Aspergillus niger AG11-PK was used as a template to amplify the upstream and downstream homologous arms UPamyA and DWamyA of the amyA locus.

[0087] Primers F17 / R17 and F18 / R18 were designed, and the genome of Aspergillus niger AG11-PK was used as a template to amplify the upstream and downstream homologous arms UPammA and DWammA of the ammA site.

[0088] Primers F19 / R19 and F20 / R20 were designed, and the genome of Aspergillus niger AG11-PK was used as a template to amplify the upstream and downstream homologous arms UPpepA and DWpepA of the pepA site.

[0089] Primers F21 / R21 and F22 / R22 were designed, and the genome of Aspergillus niger AG11-PK was used as a template to amplify the upstream and downstream homology arms UPpepB and DWpepB of the pepB site.

[0090] By designing primers F23 / R23 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF1 for integration at the ammA site was amplified.

[0091] By designing primers F24 / R24 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF2 for integration at the amyA site was amplified.

[0092] By designing primers F25 / R25 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF3 for pepA site integration was amplified.

[0093] By designing primers F26 / R26 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF4 for pepB site integration was amplified.

[0094] Since AG11-PK-PK is a pyrG-deficient strain, the pyrG expression cassette can be integrated into the albA site to increase the positive screening rate. At the same time, a 200bp sequence of the downstream homology arm of albA is added to the 5' end of the pyrG expression cassette to loop out the pyrG expression cassette, which can realize the reuse of the pyrG tag. Primers F27 / R27 and F28 / R28 were designed, and the upstream and downstream homology arms UPalbA and DWalbA of the albA site were amplified using the genome of Aspergillus niger AG11-PK as a template. By designing primers F29 / R29 and using plasmid pYTU as a template, the pyrG expression cassette PpyrG-pyrG-TpyrG for integration at the albA site was amplified.

[0095] Using vector pAN7-1 as template, PCR amplification was performed with primer pair F30 / F30, and the product was purified.

[0096] PglaA-498glaA-FhLF1, UPammA, DWammA and vector pAN7-1 were assembled by the Gibson assembly method to obtain the recombinant plasmid pAN7-1-UPammA-FhLF-DWammA.

[0097] PglaA-498glaA-FhLF2, UPamyA, DWamyA and vector pAN7-1 were assembled by the Gibson assembly method to obtain the recombinant plasmid pAN7-1-UPamyA-FhLF-DWamyA.

[0098] PglaA-498glaA-FhLF3, UPpepA, DWpepA and vector pAN7-1 were assembled by the Gibson assembly method to obtain the recombinant plasmid pAN7-1-UPpepA-FhLF-DWpepA.

[0099] PglaA-498glaA-FhLF4, UPpepB, DWpepB and vector pAN7-1 were assembled by the Gibson assembly method to obtain the recombinant plasmid pAN7-1-UPpepB-FhLF-DWpepB.

[0100] PpyrG-pyrG-TpyrG, UPalbA, DWalbA and vector pAN7-1 were assembled by the Gibson assembly method to obtain the recombinant plasmid pAN7-1-UPalbA-FhLF-DWalbA.

[0101] The recombinant plasmids were transformed into Escherichia coli JM109, the plasmids were extracted and sequenced to verify the correctness of the sequences, and the correct recombinant plasmids pAN7-1-UPamyA-FhLF-DWamyA, pAN7-1-UPammA-FhLF-DWammA, pAN7-1-UPpepA-FhLF-DWpepA, pAN7-1-UPpepB-FhLF-DWpepB and pAN7-1-UPalbA-reDWalbA-pyrG-DWalbA were obtained respectively.

[0102] Further, a multi-site synchronous integration plasmid pFC332-sgRNAs was constructed, and the in situ adjacent motifs (Protospacers) of amyA, ammA, glaA and albA genes were predicted using an online tool (http: / / crispor.tefor.net / ), and the Protospacers of pepA and pepB in Example 2 were added for positioning of the lactoferrin integration site. By designing primers F31 / R31, the sgRNA scaffold was amplified using plasmid pLCs1 as a template, and different sgRNAs were connected by tRNA. Using vector pFC332 as a template, Bgl II and Pac I double enzyme digestion was performed, and the resulting fragments were recovered for standby use. The U3 promoter, 6 Protospacers, 6 sgRNA scaffolds and linearized vector pFC332 were assembled by the Golden gate method to obtain a recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli JM109, the plasmid was extracted and sequenced to verify the correctness of the sequence, and the correct recombinant plasmid pFC332-sgRNAs was obtained. pFC332-sgRNAs and pAN7-1-UPglaA-FhLF-DWglaA, pAN7-1-UPamyA-FhLF-DWamyA, pAN7-1-UPammA-FhLF-DWammA, pAN7-1-UPpepA-FhLF-DWpepA, pAN7-1-UPpepB-FhLF-DWpepB, and pAN7-1-UPalbA-reDWalbA-pyrG-DWalbA were linearized and introduced into the engineered bacteria hLF14, and the multi-copy strain hLF26 was obtained through genome verification.

[0103] The engineered strain hLF26 was cultured in a seed culture medium for 16 hours to obtain a seed solution, which was then inoculated into a fermentation medium at a 5% inoculum and fermented at 30° C. and 220 rpm for 96 hours. It was found that the engineered strain hLF26 could produce 12.1±0.04 mg / L lactoferrin.

[0104] The primer sequences are shown in Table 5.

[0105] Table 5 Primers used to construct lactoferrin multi-copy integration vector

[0106]

[0107]

[0108] Table 6 Protospacers used to construct multi-gene site integration

[0109]

[0110] Example 55 Production of lactoferrin by horizontal fermentation in a 5L tank fermenter

[0111] The engineered Aspergillus niger hLF26 constructed in Example 3 was spread and cultured on a PDA solid culture medium plate and placed in a constant temperature incubator at 30°C for 5 days to obtain an activated engineered strain. The spores of the activated strain were rinsed and inoculated into 50mL / 250mL seed culture medium for primary seed culture, and cultured in a shake flask at 220rpm, 30°C for 16h with a natural pH to obtain a primary seed solution.

[0112] The first-level seed liquid was inoculated into a 1 L shake flask with a fermentation medium capacity of 200 mL at a 5% inoculation rate, and the second-level seed culture was carried out at 30° C. and 220 rpm for 24 h to obtain the second-level seed liquid with a natural pH.

[0113] The secondary seed liquid was inoculated with 10% inoculum into a 5L fermentor tank with a fermentation medium liquid volume of 2.5L, with an initial ventilation volume of 3L / min, an initial stirring of 375rpm, a culture temperature of 30°C, and a pH of 5.5 controlled by 50% ammonia water to start cultivation. When the initial dissolved oxygen dropped to 20%, the dissolved oxygen was maintained at 20% by controlling stirring (400-900rpm) and air flow (3-10L / min). When the glucose dropped to 5g / L-10g / L, the fed-batch fermentation medium was added, and the glucose concentration in the fermentation broth was controlled to 1g / L-5g / L, and lactoferrin was detected by regular sampling.

[0114] like Figure 1As shown, from 1 to 24 hours, the bacterial growth was in the hysteresis phase, and the bacterial growth was slow. From 24 to 120 hours, it was in the logarithmic growth phase, during which the bacterial growth was rapid. From 120 to 168 hours, it was in the stable phase, and the bacterial growth slowed down. Finally, after 168 hours of fermentation, the cell dry weight reached 87.76 ± 2.34 g, and the lactoferrin production reached 335.78 ± 2.71 mg / L.

[0115] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing a recombinant Aspergillus niger strain expressing lactoferrin, characterized in that: The method comprises the steps of integrating the hLF gene into the gene site of the host strain genome to construct the recombinant Aspergillus niger strain; The nucleotide sequence of the hLF gene is shown in SEQ ID NO.1; The gene locus is at least one of a glaA locus, an amyA locus, an ammA locus, a pepA locus and a pepB locus; The host strain is Aspergillus niger AG11-PK.

2. The construction method according to claim 1, characterized in that: The 5' end of the hLF gene is connected to the glaA fragment and then integrated into the gene site of the host strain genome; The nucleotide sequence of the glaA fragment is shown in SEQ ID NO.

4.

3. The construction method according to claim 2, characterized in that: The method for integrating the hLF gene into the gene locus of the host strain genome comprises the following steps: The 5' end of the hLF gene was connected to the glaA fragment, and then connected to the pAN7-1 vector to obtain the recombinant plasmid pAN7-1-hLF; Using the genome of the Aspergillus niger AG11-PK as a template, amplifying the upstream and downstream homology arms of the gene locus respectively; The recombinant plasmid pAN7-1-hLF is amplified by PCR to obtain an open reading frame fragment FhLF with a promoter and a terminator; Recombining the upstream homology arm, the FhLF, the downstream homology arm and the pAN7-1 vector by the Gibson assembly method to obtain a recombinant vector; The recombinant vector is linearized and then transferred into the host strain.

4. The construction method according to claim 2, characterized in that: The construction method also includes the step of knocking out the pepA gene and the pepB gene of the host strain.

5. The construction method according to claim 4, characterized in that: The construction method also includes the step of knocking out the glaA gene, the amyA gene, the ammA gene and the albA gene of the host strain.

6. The construction method according to claim 5, characterized in that: The CRISPR gene editing system is used for gene knockout; the C segment of the Cas9 protein of the CRISPR gene editing system is fused to Brex27; the nucleotide sequence of the gene encoding Brex27 is shown in SEQ ID NO.

7.

7. A recombinant Aspergillus niger strain expressing lactoferrin constructed according to the construction method according to any one of claims 1 to 6.

8. Use of the recombinant Aspergillus niger strain according to claim 7 in the preparation of lactoferrin.

9. A method for preparing lactoferrin, characterized in that: The method comprises the steps of fermenting and culturing the recombinant Aspergillus niger strain according to claim 7, and then separating and purifying the lactoferrin.

10. Lactoferrin prepared according to the preparation method according to claim 9.

Images