A method for constructing a mouse model for rapid degradation of MSTN protein
Through CRISPR/Cas9 technology and microinjection, the FKBP1A and mCherry sequences were knocked into the mouse Mstn gene, and the MSTN-FKPB-mCherry model was constructed, which solved the rapid and reversible problems of MSTN protein regulation in mice, achieved stable expression and efficient degradation, and simplified the operation cycle.
Patent Information
- Application Number
- CN202510056799.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-14
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-01-14
AI Technical Summary
The prior art is difficult to rapidly and reversibly regulate the function of myostatin (MSTN) proteins in mice, limiting the research and drug development of MSTN signaling.
Using CRISPR/Cas9 technology and microinjection technology, the human FKBP1A gene sequence and the red fluorescent protein mCherry sequence were knocked into the mouse Mstn gene to construct the MSTN-FKPB-mCherry fusion protein expression model, and the dTAG system was used to achieve rapid and reversible degradation of MSTN protein.
A mouse model that stably and efficiently expresses MSTN-FKPB-mCherry fusion protein was established, and the rapid and reversible degradation of MSTN protein was achieved through dTAG administration, simplifying the operating cycle, overcoming inhibitor resistance, and providing a faster regulation method.
Smart Images

Figure CN119776444B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology and relates to a method for constructing a mouse MSTN-FKPB-mCherry knock-in model based on CRISPR / Cas9-mediated gene editing technology, and specifically relates to a method for constructing transgenic mice with knock-in of the human FKBP1A gene sequence. Background Art
[0002] Over the past few decades, molecular regulation technologies have continued to advance and have become an important means of studying gene function in different biological contexts. Generally speaking, these technologies can be classified according to their targets: DNA, RNA or protein. However, because proteins play key roles in many biological processes, interventions targeting only DNA and RNA have some shortcomings. These factors may affect experimental design and hinder the accurate understanding of protein function in situations where rapid and reversible interventions are required. Therefore, technologies that can directly target and regulate protein levels have become particularly attractive, which may provide faster time resolution than DNA / RNA targeting technologies. The latest degradation tag (dTAG) protein degradation system provides the possibility of targeting any protein in the cell in a rapid, inducible and reversible manner.
[0003] The dTAG system is an innovative target identification method that uses specialized bifunctional small molecules to manipulate the cellular protein degradation machinery, targeting specific proteins for degradation. Developed by Dr. Behnam Nabet and his team at the Dana-Farber Cancer Institute, this system not only has broad application prospects but also represents an effective strategy for targeted protein degradation (TPD). The dTAG system leverages the cell's endogenous proteasome degradation pathway by fusing the target protein with an FKBP tag and then inducing its degradation using a specific small molecule degrader, dTAG. Two approaches have been proposed for constructing targeted protein degradation: genome-specific knock-in of the FKBP tag using the CRISPR-Cas9 system or exogenous expression of the FKBP tag fused to the target using a lentiviral system, resulting in the expression of the target protein as a chimera with a mutant FKBP tag. Addition of the dTAG ligand forms a ternary complex between the FKBP-tagged target protein and the E3 ligase, triggering polyubiquitination of the target protein, leading to its degradation by the proteasome. This allows for rapid and selective processing of tagged proteins. To validate the dTAG system's potential for regulating protein levels in living mice, researchers injected the human leukemia cell line MV4-11, carrying a luciferase reporter gene (luc-FKBP12F36V) fused to an FKBP tag, into the mouse bone marrow. Following dTAG treatment, the reporter gene activity in the mice decreased significantly within four hours and rebounded within 28 hours. This finding confirms the dTAG system's ability to rapidly and reversibly assess target protein function in living mice.
[0004] Myostatin (MSTN) is a secreted signaling molecule originally discovered during a screening for novel members of the TGF-β superfamily. MSTN is primarily expressed in skeletal muscle and acts as a negative regulator of muscle growth and development. MSTN deficiency has been shown to lead to muscle hypertrophy, increased myofiber number and size, in multiple species (including cattle, sheep, dog, rabbit, rat, pig, goat, human, and mouse) without causing severe adverse consequences. Furthermore, in animal models of cancer progression, inhibition of MSTN signaling or mutations in the Mstn gene has been shown to offset loss of muscle mass and strength and prolong survival without affecting tumor growth. Consequently, extensive efforts have been made to develop effective strategies to block MSTN expression and increase muscle mass in animals. Significant effort has been invested in developing drugs that modulate MSTN signaling for clinical application. However, MSTN inhibitors tested in clinical trials to date are limited to protein-based agents, such as neutralizing antibodies, peptibodies, monomers, or decoy receptors. The Mstn gene in the mouse genome is located on chromosome 1, with a total length of 6.44 kb and 3 exons. The start codon ATG is located in exon 1, and the stop codon TGA is located in exon 3.
[0005] The dTAG system is a rapid, regulated, and reversible degradation system for target proteins and has been widely used in various cell lines and mouse models to study target protein function. The successful construction of MSTN-FKBP-mCherry knock-in mice is crucial for utilizing the dTAG system to study MSTN protein function and discover and validate new targets. Compared to drug inhibitors, dTAG small molecule degraders offer significant advantages, including simpler production processes, more convenient clinical application, and the ability to overcome inhibitor resistance; the degree of protein knockdown can be adjusted by varying the dosage; and they exhibit a more rapid onset of action.
[0006] In summary, the construction of MSTN-FKPB-mCherry fusion protein-expressing mice is particularly critical for the rapid and reversible degradation and clearance of MSTN protein in mice. Summary of the Invention
[0007] The purpose of the present invention is to provide a method for constructing a mouse model that rapidly degrades MSTN protein. This method utilizes CRISPR / Cas9 technology and microinjection technology to obtain a mouse model that can stably and efficiently express the MSTN-FKPB-mCherry fusion protein.
[0008] In order to achieve the above object, the present invention adopts the following technical solutions:
[0009] The present invention provides a method for constructing a mouse model capable of rapidly degrading MSTN protein, comprising the following steps:
[0010] The Donor vector backbone was accessed with a 5' homology arm, 3xEAAAK, a synonymous mutation sequence of the FKBP1A gene, 3xEAAAK, a red fluorescent protein mCherry sequence, and a 3' homology arm arranged in sequence to obtain a Donor recombinant vector; the nucleotide sequence of the synonymous mutation sequence of the FKBP1A gene was shown as SEQ ID NO.4, the nucleotide sequence of 3xEAAAK was shown as SEQ ID NO.3, the nucleotide sequence of the red fluorescent protein mCherry was shown as SEQ ID NO.5, the nucleotide sequence of the 5' homology arm was shown as SEQ ID NO.2, and the nucleotide sequence of the 3' homology arm was shown as SEQ ID NO.6;
[0011] gRNA was designed based on the third exon of the Mstn gene on mouse chromosome 1. The nucleotide sequence of the gRNA is shown in SEQ.ID.NO.1;
[0012] The gRNA, Cas9 protein and the Donor recombinant vector are mixed and co-injected into mouse fertilized eggs to knock the FKBP1A gene synonymous mutation sequence and the red fluorescent protein mCherry sequence into the mouse genome;
[0013] The injected fertilized eggs are cultured in vitro and then transplanted into surrogate mice to continue developing until pups are born, obtaining F0 generation mice.
[0014] The F0 generation mice are hybridized with wild-type mice, or the hybrid offspring are further bred to obtain mice expressing the MSTN-FKPB-mCherry fusion protein, that is, a mouse model that rapidly degrades MSTN protein.
[0015] The TGA stop codon of the mouse Mstn gene is located in exon 3. After the knock-in sequence is introduced, the TGA stop codon will be replaced by "3xEAAAK-mutated human FKBP1A CDS (without ATG start codon)-3xEAAAK-mCherry".
[0016] As a preferred embodiment of the present invention, the Donor recombinant vector is constructed according to the following steps:
[0017] Using the BAC plasmid as a template, amplifying the fragment containing the 5' homology arm and the fragment containing the 3' homology arm from the mouse genome, respectively, to obtain fragment-1 and fragment-3;
[0018] The 3xEAAAK, FKBP1A gene synonymous mutation sequence, 3xEAAAK and the red fluorescent protein mCherry sequence were sequentially connected to synthesize fragment-2;
[0019] The fragment-1, the fragment-2, the fragment-3 and the Donor vector backbone are connected, the obtained connection product is incubated and transformed into competent cells, cultured, and extracted to obtain the Donor recombinant vector. The nucleotide sequence of the Donor recombinant vector is shown in SEQ.ID.NO.20.
[0020] Furthermore, the primer sequences for amplifying the fragment containing the 5' homology arm are shown in SEQ.ID.NO.7 and SEQ.ID.NO.8, and the primer sequences for amplifying the fragment containing the 3' homology arm are shown in SEQ.ID.NO.9 and SEQ.ID.NO.10.
[0021] Furthermore, when the fragment-1, the fragment-2, the fragment-3 and the donor vector backbone were connected, the 20 μL connection system contained: 80.0 ng donor vector backbone, 7.19 ng fragment-1, 21.28 ng fragment-2, 27.54 ng fragment-3, and 10 μL NEBuilder HiFi DNA Assembly MasterMix.
[0022] Furthermore, the amplification system is: 1 uL of template DNA, 1 uL of 10 uM upstream and downstream primers, 12.5 uL of 2×Phanta MaxMasterMix (Dye Plus), and water is added to 25 uL.
[0023] Furthermore, the amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 35 s, extension at 72°C for 30-60 s, 35 cycles; and final extension at 72°C for 5 min.
[0024] As a preferred embodiment of the present invention, the competent cells are DH5-alpha competent cells.
[0025] As a preferred embodiment of the present invention, the gRNA and the Cas9 protein are mixed and incubated in a metal bath, and then the Donor recombinant vector is added, mixed, and co-injected into mouse fertilized eggs.
[0026] Furthermore, the incubation is carried out in a metal bath at 25 degrees Celsius for 10 minutes.
[0027] As a preferred embodiment of the present invention, the concentration of the gRNA is 90-110 pmol / uL, the concentration of the Cas9 protein is 18-22 μM, the concentration of the Donor recombinant vector is 12-18 ng / uL, the volume ratio of the gRNA to the Cas9 protein is 3-5:1, and the total volume of the mixture of gRNA and Cas9 protein and the Donor recombinant vector is 20 uL.
[0028] In a second aspect, the present invention provides a mouse model for rapid degradation of MSTN protein constructed according to the above method.
[0029] As a preferred embodiment of the present invention, the obtained MSTN-FKPB-mCherry knock-in mice were administered with dTAG to achieve rapid and reversible degradation and clearance of MSTN protein in the mice.
[0030] The beneficial effects of the present invention are embodied in:
[0031] The present invention is based on CRISPR / Cas9-mediated gene editing technology, knocks in the human FKBP1A protein coding sequence and the red fluorescent protein mCherry sequence (marked as FKPB-mCherry tag sequence) in the mouse Mstn gene, and introduces synonymous mutations of FKBP1A to avoid interference from endogenous splicing sites, avoid off-target effects, etc., thereby establishing a mouse model for rapid degradation of MSTN protein, i.e., the mouse MSTN-FKPB-mCherry knock-in model. The fusion expression of mCherry fluorescent protein after the FKBP tag plays an indicator role, and it can be judged whether the target protein is degraded by observing whether the fluorescence becomes weak. The mouse MSTN-FKPB-mCherry knock-in model can stably and efficiently express the MSTN protein (abbreviated as MSTN-FKPB-mCherry fusion protein) fused with FKPB-mCherry tag protein. In addition, the modeling process of the mouse MSTN-FKPB-mCherry knock-in model in the present invention has the advantage of a short operating cycle.
[0032] The present invention promotes the expression of MSTN-FKPB-mCherry fusion protein by adding a fusion protein linker 3xEAAAK sequence between Mstn, FKBP1A synonymous mutation sequence and mCherry insertion sequence.
[0033] The present invention achieves rapid and reversible degradation and clearance of MSTN protein in the mouse body by administering dTAG to the knock-in mouse obtained in the later stage.
[0034] The present invention targets F0 generation positive mice (i.e., positive F0 generation heterozygous mice with knock-in) constructed using CRISPR / Cas9 technology. Due to the different genetic lineages resulting from the cutting efficiency and possible non-homologous repair, the F0 generation positive mice are mated with wild-type mice to obtain F1 generation positive mice with a stable genotype. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1This is a schematic diagram of a transgenic mouse model expressing an FKPB-mCherry tag constructed using CRISPR / Cas9 technology in an embodiment of the present invention.
[0036] Figure 2 This is the plasmid map of the Donor vector used for homologous recombination repair.
[0037] Figure 3 This is the F0 generation mouse breeding scheme in the embodiment of the present invention.
[0038] Figure 4 This is a diagram of the PCR identification strategy for the F0 and F1 generation mouse genotypes in the examples of the present invention.
[0039] Figure 5 The electrophoresis diagrams for PCR identification of F1 generation mouse genotypes in the present invention are as follows: A, 5'HA homologous recombination-positive genome; B, 3'HA homologous recombination-positive genome.
[0040] Figure 6 This is the sequencing diagram of the knock-in (KI) sequence of the F1 generation mice in the examples of the present invention.
[0041] Figure 7 This is the electrophoresis diagram for PCR identification of the F2 generation mouse genotype in the embodiment of the present invention.
[0042] Figure 8 This is a Western blot analysis of the MSTN protein expressed in the examples of the present invention. DETAILED DESCRIPTION
[0043] The present invention will be further described in detail below with reference to the accompanying drawings and examples, which are only used to explain the present invention and are not intended to limit the scope of protection of the present invention.
[0044] Example 1
[0045] Establishment of the MSTN-FKPB-mCherry knock-in model in C57BL / 6J mice using CRISPR / Cas9-mediated gene editing technology
[0046] Targeting the human gene FKBP1A, a mouse transgenic strategy was designed, and the CDS sequence of FKBP1A was knocked into the third exon of the Mstn gene (NCBI reference sequence: NM_010834.3) on mouse chromosome 1 using CRISPR / Cas9 technology. Figure 1 The specific steps include:
[0047] 1. gRNA was designed based on the CRISPR / Cas9 system. The sequence of the gRNA action site specific to the third exon of the Mstn gene is shown in Table 1.
[0048] Table 1. gRNA action sites
[0049] Sequence (5'-3') Sequence number GGGAAGACCTTCCATGACTTGGG SEQ ID NO.1
[0050] Note: The italic bases in the sequence are PAM.
[0051] 2. Based on the principle of homologous recombination repair and in combination with the knock-in target sequence (referred to as the knock-in sequence), a Donor vector was designed. The Donor vector contains a 5' homology arm, 3xEAAAK, a synonymous mutation sequence of the FKBP1A gene (labeled as Mutant HumanFKBP1A CDS-p.F37V), 3xEAAAK, a red fluorescent protein mCherry sequence, and a 3' homology arm. Its main components are shown in Table 2, and the nucleotide sequences of the corresponding elements are shown in Table 3.
[0052] Table 2. Main components of Donor vector
[0053]
[0054] Table 3. Partial nucleotide sequence of Donor vector
[0055]
[0056]
[0057]
[0058]
[0059] Note: The underlined bases are introduced synonymous mutations. The sequence before mutation is TTT, and the sequence after mutation is GTT.
[0060] 3. Using In-Fusion technology, the above 3xEAAAK, Mutant Human FKBP1A CDS-p.F37V (TTT to GTT), and mCherry were assembled into a Donor vector. That is, the 5' homology arm, fusion protein linker 3xEAAAK, FKBP1A gene synonymous mutation sequence, 3xEAAAK, red fluorescent protein mCherry sequence, and 3' homology arm were connected to the Donor vector backbone in order. The specific process is as follows:
[0061] (1) Using high-fidelity Taq DNA polymerase and a BAC (RPCI-23.C) plasmid (thermofisher) as a template, fragment-1 (i.e., the fragment containing the 5' homology arm) and fragment-3 (i.e., the fragment containing the 3' homology arm) containing homologous sequences from the mouse genome were amplified. The sequences of the amplification primers are shown in Table 4, the amplification system is shown in Table 5, and the amplification procedure is shown in Table 6.
[0062] The 3xEAAAK-Mutant Human FKBP1A CDS (without the ATG start codon)-3xEAAAK-mCherry sequence (denoted as fragment-2) was synthesized (Shanghai Sangon Co., Ltd.).
[0063] Table 4 Amplification primer nucleotide sequences
[0064]
[0065] Table 5. PCR system
[0066]
[0067]
[0068] Table 6. PCR program
[0069]
[0070] (2) Acc65I (NEB, R0599) and AscI (NEB, R0558) endonucleases were used to digest the existing plasmid (customized from Saiye Bio, internal catalog number Cat: VB139; specifically, it was modified from the commercial plasmid Addgene #50005 to provide the vector backbone). The digestion system is shown in Table 7. The digestion product was subjected to gel electrophoresis and the target band was cut out. The DNA gel recovery kit (OMEGA, D2000) was used to recover and purify the linearized plasmid (4201 bp, i.e., the vector backbone).
[0071] Table 7. Enzyme digestion system
[0072] Components Dosage plasmid DNA 1.0 μg <![CDATA[10×rCutSmart TM Buffer]]> 5.0μL AscI 1 μL Acc65I 0.5μL <![CDATA[ddH2O]]> to 50.0 μL
[0073] (3) Using a seamless cloning kit (NEB, E2621), the PCR amplified fragment was ligated with the linearized plasmid according to the reaction system shown in Table 8. The reaction was performed using a PCR instrument and incubated at 50°C for 60 min; then placed on ice for transformation.
[0074] Table 8. In-Fusion System
[0075]
[0076] (4) The In-Fusion ligation product was transformed into DH5-alpha competent cells, and then the competent cells were added to LB liquid culture medium and cultured in a shaking incubator at 37°C for 30 minutes. The obtained culture was spread on LB solid culture medium containing ampicillin and cultured overnight. After ampicillin resistance (AmpR) screening, the monoclonal clones grown on the LB solid culture medium were picked and cultured in LB liquid culture medium. After that, the bacterial liquid was subjected to PCR identification. After confirming that the ligation was successful, the bacterial liquid was sent for sequencing. According to the sequencing results, the monoclonal clones with successful ligation and correct sequence were selected for shaking, and the bacterial liquid was collected for plasmid extraction to obtain the Donor recombinant vector. Its plasmid map is shown as follows: Figure 2 shown.
[0077] The nucleotide sequence of the Donor recombinant vector is shown in SEQ ID NO.20:
[0078]
[0079] 4. Preparation of injection compound
[0080] Tube 1 solution: Add 0.8 μL of 100 pmol / μL gRNA to RNase-free water, then add 0.2 μL of 20 μM Cas9 protein (NEB, Catalog No.: M0646M), mix well, and incubate in a metal bath at 25°C for 10 minutes to obtain Tube 1 solution.
[0081] Tube 2 solution: Donor recombinant vector with a final concentration of 15 ng / uL;
[0082] The solution in tube 1 and the solution in tube 2 were mixed to obtain an injection complex, and the total volume of the injection complex was 20 μL.
[0083] 5. Microinjection and embryo transfer
[0084] After superovulation of female C57BL / 6J mice, fertilized C57BL / 6J mice were obtained through in vitro fertilization. The resulting injection complex was then injected into the fertilized C57BL / 6J mouse eggs using a glass microinjection needle with an extremely fine tip (0.1-0.5 μm). The microinjected fertilized eggs were then transferred into the oviduct of surrogate C57BL / 6J mice through embryo transfer. After the pups were born, F0 generation mice were obtained. The genotype of the F0 generation mice was identified by PCR. Figure 3 shown.
[0085] The specific operation of the above embryo transplantation is as follows: the fertilized eggs after microinjection are cultured in vitro to morulas and quality tested; a small incision is made in the oviduct capsule of the surrogate mother mouse, and after the direction of the oviduct fimbria is clearly seen, the transplant tube is inserted from the opening into the oviduct fimbria 2 to 3 mm, and the embryos with good development quality are blown into the magnum, and the transplant tube is pulled out after a short pause.
[0086] 6. The positive F0 generation mice were mated with C57BL / 6J mice (Wild type, Wt) to obtain F1 generation mice, and their genotypes were identified by PCR. If positive mice (F1 generation heterozygotes) were born, it means that the knock-in sequence has been integrated into the germ cells, such as Figure 4 shown.
[0087] 7. The F1 generation heterozygous mice were self-pollinated, and the resulting F2 generation mice were genotyped to obtain MSTN-FKPB-mCherry homozygous knock-in mice, that is, mice expressing MSTN-FKBP-mCherry fusion protein were obtained.
[0088] 8. By administering dTAG to the knock-in mice, rapid and reversible degradation and clearance of MSTN protein in the mice can be achieved.
[0089] Example 2
[0090] Mouse genotype PCR identification results
[0091] 1. DNA extraction
[0092] Select newborn mice aged 3-4 weeks, cut off approximately 0.3 cm of tail, and place in a 1.5 ml EP tube (labeled with the corresponding mouse number on the tube cap) containing 50 μl of lysis buffer and 1 μl of proteinase K. Centrifuge until the tail is at the bottom of the EP tube and incubate in a 55°C metal bath overnight. The next day, set the metal bath temperature to 95°C for 5 minutes to inactivate proteinase K. Vortex the tail on a shaker for 15 seconds to completely lyse the tail. Centrifuge at 12,000 rpm for 5 minutes. The supernatant can be used directly as a template for genotyping or stored at -20°C until needed.
[0093] 2. PCR identification results of F1 generation mouse genotype
[0094] DNA was extracted from the mouse tail tip and genotyped by PCR amplification. Figure 4 The PCR identification strategy in the protocol uses primers F1 / R1 for amplification. A 2.8 kb fragment should be amplified in genomes with positive 5' HA homologous recombination, while no band should be observed in genomes with negative 5' HA homologous recombination. A 3.5 kb fragment should be amplified in genomes with positive 3' HA homologous recombination, while no band should be observed in genomes with negative 3' HA homologous recombination. The amplification system is shown in Table 9, and the amplification procedure is shown in Table 10. Specific primers used for PCR identification are shown in Table 11.
[0095] Table 9. PCR system
[0096] Components Dosage (uL) Mouse DNA 1 Upstream primer F (10uM) 1 Downstream primer R (10uM) 1 Premix Taq Polymerase 12.5 <![CDATA[ddH2O]]> 9.5 total 25
[0097] Table 10. PCR program
[0098]
[0099]
[0100] Table 11. PCR amplification primers
[0101] Primer name Sequence (5'-3') Primer type Sequence Listing F1 CCTTCCCGTTTTATGTTTCTTTCCT Upstream primer SEQ.ID.NO.11 R1 ATGGTTTTCTTCTGCATTACGGG Downstream primer SEQ.ID.NO.12 F2 GAGTGCAGGTGGAAACCATCTC Upstream primer SEQ.ID.NO.13 R2 TTTTCCCCAAGACTTTACAAACCC Downstream primer SEQ.ID.NO.14
[0102] Identification results such as Figure 5 As shown, mice No. 15, 18, 19, 22, 23, 24, and 27 are F1 generation mice that are positive for homologous recombination in both arms.
[0103] Note: If the DNA sample is not very pure or if there is not enough PCR extension time, it may not be possible to amplify long PCR products. Figure 4 For other PCR identification strategies, using primers F4 / R5, the target allele should be amplified as a 460 bp fragment. The sequences of primers F4 / R5 are shown in Table 13.
[0104] 3. Sequencing results of knock-in sequences of F1 generation mice
[0105] PCR amplification was performed using primers F3 / R3, and the product was sequenced.
[0106] The sequencing results are as follows Figure 6 The results showed that the knock-in site of the positive F1 generation No. 15 mouse was correct and the knock-in sequence was correct without mutation. Among them, the specific primers used for PCR amplification are shown in Table 12:
[0107] Table 12. PCR amplification primers
[0108]
[0109]
[0110] 4. PCR identification results of F2 generation mouse genotype
[0111] DNA was extracted from the mouse tail tip and genotyped by PCR amplification. Figure 4 The PCR identification strategy in the experiment was performed using primers F5 / R3 and F4 / R5 for PCR. The genotypes of F2 mice were divided into three categories based on the length of the PCR fragments: knock-in homozygous (Homozygous), knock-in heterozygous (Heterozygous, He), and wild type (Wildtype, Wt). The PCR fragment lengths corresponding to different genotypes were: two bands of 460bp and 1619bp (knock-in homozygous); three bands of 460bp, 503bp, and 1619bp (knock-in heterozygous), and a 503bp band (wild type). The specific primers used for PCR identification are shown in Table 13:
[0112] Table 13. PCR amplification primers
[0113] Primer name Sequence (5'-3') Primer type Sequence Listing F5 ACTGCTCAGGAGAGTGTGAATTT Upstream primer SEQ.ID.NO.19 R3 GCTCTCACTTCCTTGCCTAGATTG Downstream primer SEQ.ID.NO.16 F4 TCAAGACCACCTACAAGGCCAA Upstream primer SEQ.ID.NO.17 R5 TCACTTCCTTGCCTAGATTGTAGTT Downstream primer SEQ.ID.NO.18
[0114] Example 3
[0115] Evaluation of targeting strategies for transient knockout of MSTN
[0116] The expression of MSTN protein in the muscle tissue of F2 mice was detected by Western blot.
[0117] Identification results such as Figure 8As shown, after dTAG administration to F2 heterozygous mice, the MSTN-FKPB-mCherry fusion protein was degraded, while the MSTN protein was normally expressed in the muscle tissue of mice that were not administered dTAG.
[0118] The above results show that the present invention uses In-Fusion technology to construct a Donor vector, and by co-injecting the Donor vector, gRNA and Cas9 mRNA into mouse fertilized eggs, the human FKBP1A gene sequence is knocked into the mouse genome using CRISPR / Cas9-mediated gene editing technology, and used as the FKPB-mCherrytag sequence expressed in fusion with the mouse Mstn gene. Then, through embryo transplantation and breeding of the resulting positive F0 generation mice, parents that can stably and efficiently express the MSTN-FKPB-mCherry fusion protein are finally obtained, so that the dTAG protein rapid degradation system model mouse can be used to achieve rapid, complete and reversible MSTN protein degradation induced by small molecule degraders, providing new ideas and approaches to solving the problem that traditional gene knockout animal models cannot explore the direct regulatory mechanism of the protein of interest.
Claims
1. A method for constructing a mouse model that rapidly degrades MSTN protein, characterized in that: The following steps are involved: The Donor vector backbone is connected with the 5' homology arm, 3xEAAAK, FKBP1A The FKBP1A gene synonymous mutation sequence, 3xEAAAK, red fluorescent protein mCherry sequence and 3' homology arm are used to obtain a Donor recombinant vector; the nucleotide sequence of the FKBP1A gene synonymous mutation sequence is shown in SEQ ID NO.4, the nucleotide sequence of 3xEAAAK is shown in SEQ ID NO.3, the nucleotide sequence of the red fluorescent protein mCherry is shown in SEQ ID NO.5, the nucleotide sequence of the 5' homology arm is shown in SEQ ID NO.2, and the nucleotide sequence of the 3' homology arm is shown in SEQ ID NO.6; the nucleotide sequence of the Donor recombinant vector is shown in SEQ.ID.NO.20; Based on mouse chromosome 1 Mstn gRNA is designed for the third exon of the gene, and the nucleotide sequence of the gRNA is shown in SEQ.ID.NO.1; The gRNA, Cas9 protein and the Donor recombinant vector are mixed and co-injected into mouse fertilized eggs to allow the FKBP1A The gene synonymous mutation sequence and the red fluorescent protein mCherry sequence were knocked into the mouse genome; The injected fertilized eggs are cultured in vitro and then transplanted into surrogate mice to continue developing until pups are born, obtaining F0 generation mice. The F0 generation mice are hybridized with wild-type mice, or the hybrid offspring are further bred to obtain mice expressing MSTN-FKPB-mCherry fusion protein, that is, a mouse model that rapidly degrades MSTN protein.
2. The construction method according to claim 1, characterized in that The Donor recombinant vector is constructed according to the following steps: Using the BAC plasmid as a template, amplifying the fragment containing the 5' homology arm and the fragment containing the 3' homology arm from the mouse genome, respectively, to obtain fragment-1 and fragment-3; The 3xEAAAK, FKBP1A The gene synonymous mutation sequence, 3xEAAAK and the red fluorescent protein mCherry sequence were sequentially connected to obtain fragment-2; The fragment-1, the fragment-2, the fragment-3 and the Donor vector backbone are connected, the obtained connection product is incubated, and transformed into competent cells, cultured, and extracted to obtain the Donor recombinant vector.
3. The construction method according to claim 2, characterized in that The primer sequences for amplifying the fragment containing the 5' homology arm are shown in SEQ.ID.NO.7 and SEQ.ID.NO.8, and the primer sequences for amplifying the fragment containing the 3' homology arm are shown in SEQ.ID.NO.9 and SEQ.ID.NO.
10.
4. The construction method according to claim 2, characterized in that When ligating the fragment-1, the fragment-2, the fragment-3, and the donor vector backbone, a 20 μL ligation system contained: 80.0 ng of the donor vector backbone, 7.19 ng of the fragment-1, 21.28 ng of the fragment-2, 27.54 ng of the fragment-3, and 10 μL of NEBuilder HiFi DNA Assembly MasterMix.
5. The construction method according to claim 2, characterized in that The competent cells are DH5-alpha competent cells.
6. The construction method according to claim 1, characterized in that After the gRNA and the Cas9 protein are mixed and incubated in a metal bath, the Donor recombination vector is added, mixed evenly, and injected into mouse fertilized eggs.
7. The construction method according to claim 6, characterized in that: The concentration of the gRNA is 90-110 pmol / uL, the concentration of the Cas9 protein is 18-22 µM, the concentration of the Donor recombinant vector is 12-18 ng / uL, the volume ratio of the gRNA to the Cas9 protein is 3-5:1, and the total volume of the mixture of the gRNA and Cas9 protein and the Donor recombinant vector is 20 uL.
8. A mouse model of rapid degradation of MSTN protein constructed according to the method of claim 1.
9. The mouse model for rapid degradation of MSTN protein according to claim 8, characterized in that: The obtained MSTN-FKPB-mCherry knock-in mice were administered dTAG to achieve rapid and reversible degradation and clearance of MSTN protein in mice.
Citation Information
Patent Citations
Partial base deletion muscle inhibin gene capable of being expressed in mouse and application
CN107034221A