A biomarker for heart failure and its application

Abstract

The present invention belongs to the field of medicine, and specifically discloses a biomarker for heart failure and its application. The biomarker of the present invention includes tryptophan and its metabolites combined with intestinal flora. The biomarker provided by the present invention can be used for early warning of the risk of heart failure and guide the adjustment of the intestinal microbial environment; it can be used to indicate the association between tryptophan and metabolites combined with changes in intestinal flora and heart failure, and assist in diagnosis. The present invention also provides new targets for the prevention and treatment of heart failure, which can be used for drug target research, precision medication, pathogenesis research, etc.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and specifically relates to a biomarker, in particular a biomarker for heart failure and an application thereof. Background Art

[0002] Heart failure (HF) is abbreviated as HF. It refers to the inability to fully discharge venous blood from the heart due to the systolic and / or diastolic function of the heart, resulting in blood congestion in the venous system and insufficient blood perfusion in the arterial system, which causes a syndrome of cardiac circulatory disorders. This syndrome is mainly manifested as pulmonary congestion and vena cava congestion. Heart failure is a common clinical syndrome and the terminal state of many cardiovascular diseases. It is also a serious social public health problem faced by countries around the world. With the aging of the population, the prevalence of HF is still rising year by year, bringing a heavy burden to the public health care system and individual families.

[0003] Biomarkers play a vital role in all aspects of clinical practice and patient management. The application of biomarkers provides a rapid, objective, low-cost quantitative tool that can be used to diagnose diseases, assess the severity of diseases, identify individuals with significant risk significance, and predict patient prognosis. The diagnosis of heart failure can be based on the patient's medical history and clinical symptoms and signs, such as the presence of objective evidence of cardiac structural or functional abnormalities such as enlarged heart chambers, third heart sound, heart murmur, abnormal echocardiogram, and elevated levels of natriuretic peptides (B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide).

[0004] CN115327129A discloses the application of a plasma molecular marker, kynurenine, in the detection of early heart failure. It is well known in the art that tryptophan is a relatively advanced metabolite of the human body, with many changes in the human body, and its content is easily affected by various factors. Kynurenine, as the most important metabolite of tryptophan, is also easily affected by various factors. Kynurenine alone is not accurate and reliable as a marker for the development stages of complex heart failure diseases, and a more accurate and reliable biomarker needs to be found.

[0005] CN115181799A discloses markers, methods and systems for predicting, preventing or treating heart failure. The relative abundance of Turicibacter sp.TS3 bacteria was detected by sequencing technology, but there is no record of the direct connection between the metabolic biomarker PAGln and the microbial marker Turicibacter sp.TS3.

[0006] At different stages of the development of heart failure, many small molecule metabolites and intestinal microbial flora undergo complex changes. It is difficult to accurately diagnose heart failure at different stages simply by using metabolic markers or microbial markers. Therefore, there is still a lack of reliable biomarkers and effective drugs for heart failure, and further in-depth research is also needed in the molecular mechanism of preventing and treating heart failure. Summary of the invention

[0007] In view of the lack of reliable biomarkers for heart failure in clinical practice, the present invention provides a novel biomarker for heart failure and its application, which realizes clinical non-invasive and low-cost diagnosis or prediction of heart failure.

[0008] The present invention explores a new combined biomarker for heart failure by establishing a rat model of heart failure induced by the left anterior descending coronary artery. The biosynthetic pathways in the heart failure model group are obtained by metabolomics analysis, and the intestinal flora in the rats in the heart failure model group is analyzed by microbial diversity to infer a biomarker axis for detecting heart failure disease, and the importance of the new biomarker in heart failure is verified by animal experiments through exogenous administration of inhibitors or drugs. The technical scheme of the present invention will be described in detail below.

[0009] In a first aspect, the present invention provides a biomarker for heart failure, comprising a metabolic biomarker combined with a microbial marker; wherein the metabolic biomarker comprises one or more of tryptophan and its metabolites; and the microbial marker comprises the genus Parabacteroides.

[0010] Preferably, the metabolic biomarker is tryptophan and its kynurenine pathway metabolites; the microbial marker includes Parabacteroides bacteria. Further preferably, the metabolic biomarker includes tryptophan and kynurenic acid; the microbial marker is Parabacteroides_distasonis bacteria.

[0011] Furthermore, the metabolic marker is the ratio of kynurenic acid to tryptophan KYNA / TRP, and the microbial marker is Parabacteroides_distasonis bacteria.

[0012] Preferably, the biomarkers are selected from samples to be tested of a subject, wherein the samples to be tested for metabolic markers include blood, plasma or serum samples of the subject, and the samples to be tested for microbial markers include fecal samples of the subject.

[0013] The second aspect of the present invention provides a substance for detecting the biomarkers of the present invention for preparing a product for diagnosing heart failure in a subject or predicting whether a subject has a risk of heart failure.

[0014] The third aspect of the present invention provides a product, which includes a substance for detecting the biomarker of the present invention, and the product is used to diagnose, detect or evaluate heart failure, conduct prognosis assessment of heart failure, and predict the risk of heart failure-related diseases.

[0015] Preferably, the product comprises reagents, devices and / or equipment for detecting the level and / or quantity and / or abundance of biomarkers in a sample to be tested; further preferably, the product comprises a kit.

[0016] In one embodiment, the kit further comprises instructions, which record a reference data set of biomarker levels according to the first aspect of the present invention derived from heart failure patients and / or healthy controls.

[0017] A fourth aspect of the present invention provides a system for predicting the risk of heart failure, the system comprising:

[0018] (1) A data acquisition unit, wherein the data acquisition unit includes a unit for acquiring the level or content of tryptophan and its kynurenine pathway metabolite kynurenic acid from a sample collected from a subject and the number or abundance of intestinal Parabacteroides bacteria from a sample collected from a subject.

[0019] (2) A judgment unit, wherein the judgment unit compares the tryptophan / kynuric acid ratio KYNA / TRP and the number or abundance of intestinal Parabacteroides bacteria with a preset threshold value, and classifies the subject as a patient with a high or low risk of heart failure.

[0020] The Parabacteroides genus is preferably Parabacteroides_distasonis.

[0021] The present invention does not limit the data acquisition method of the data acquisition unit, which can be data obtained through hospital laboratory examinations, or can be collected from various possible collection channels, such as blood testing instruments, detection equipment based on mass spectrometry, liquid chromatography-mass spectrometry, amplicon sequencers, etc. and having certain data processing and storage functions. The detection equipment includes but is not limited to liquid chromatography-mass spectrometry, sequencing systems or platforms.

[0022] In a fifth aspect, the present invention provides the use of the biomarker of the present invention in diagnosing, detecting or evaluating heart failure, performing prognostic evaluation of heart failure, and predicting the risk of heart failure-related diseases. The diagnosis, prediction or evaluation of heart failure comprises the following steps:

[0023] (1) using reagents to measure the level or content of tryptophan and its kynurenine pathway metabolite kynurenic acid in the sample collected from the subject, and the number or abundance of intestinal flora Parabacteroides bacteria, to obtain the kynurenic acid / tryptophan ratio KYNA / TRP and the Parabacteroides bacteria measurement value;

[0024] (2) comparing the measured value with a reference value;

[0025] (3) When the kynurenic acid / tryptophan ratio KYNA / TRP is higher than the reference value and the amount of Parabacteroides is lower than the reference value, the subject is predicted to suffer from heart failure or to be at risk of suffering from heart failure; otherwise, the subject is predicted to not suffer from heart failure or to be not at risk of suffering from heart failure.

[0026] Preferably, the reagent refers to any reagent that can be used to display the amount or level of tryptophan and its kynurenine pathway metabolites and Parabacteroides to be tested, and may also include other components. Examples of other components include but are not limited to LC-MS / MS, amplicon sequencing, and flow cytometry related assay reagents.

[0027] In a preferred embodiment, LC-MS / MS is used to determine the content of kynurenic acid and tryptophan.

[0028] In a preferred embodiment, qPCR technology is used to measure the number or abundance of Parabacteroides bacteria.

[0029] The subject may be any mammal, preferably a human.

[0030] The type of the sample includes but is not limited to tissue sample or fluid sample.Tissue sample includes somatic cell sample, and fluid sample includes blood and its components such as plasma, serum, etc.Biological sample can be a sample of any mammalian origin, preferably a sample derived from people.The example that can be used for the biological sample type of the present invention includes but is not limited to one or more of the following: urine, feces, tears, whole blood, serum, plasma, blood components, bone marrow, cells, tissues, organs, body fluids, saliva, cheek swabs, lymph, cerebrospinal fluid, lesion exudates and other fluids produced by health.Biological sample can also be freezing, fixing, paraffin embedded or fresh biopsy sample.

[0031] The reference value is a value obtained from a biological sample of a normal subject. The reference value can be a specific value or a range of values.

[0032] The Parabacteroides genus is preferably Parabacteroides_distasonis.

[0033] In certain embodiments, the reference value can be a sample test value from a normal subject. Preferably, the value of a sample from a normal subject of the same age as the subject to be tested, and further preferably, the reference value and the measured value are obtained by the same method.

[0034] In another embodiment, according to the application of the present invention, a method for establishing heart failure, diagnosis, prognosis assessment and risk prediction of heart failure-related diseases is provided, the method comprising the steps of identifying differentially expressed substances in the blood or differential strains in the feces between patients and healthy controls.

[0035] Wherein, the differentially expressed substance is tryptophan and its kynurenine pathway metabolite kynurenic acid, and more preferably the kynurenic acid / tryptophan ratio KYNA / TRP.

[0036] The differential strain is of the genus Parabacteroides, more preferably Parabacteroides_distasonis.

[0037] The sixth aspect of the present invention provides the use of the biomarkers of the present invention as targets for screening drugs for preventing or treating heart failure.

[0038] Preferably, the effects of the candidate drug on the biomarkers before and after use are utilized to determine whether the candidate drug can be used to prevent or treat heart failure.

[0039] In one embodiment, according to the use of the present invention, a method for screening heart failure drugs is provided, comprising the following steps:

[0040] (1) using a reagent to measure the kynurenic acid / tryptophan ratio KYNA / TRP and / or the amount of Parabacteroides bacteria in a sample collected from a subject with heart failure to obtain a first measurement value;

[0041] (2) administering the drug to a subject with heart failure;

[0042] (3) measuring the kynurenic acid / tryptophan ratio KYNA / TRP and / or the amount of Parabacteroides in the sample collected from the subject after administration in step (2), to obtain a second measurement value;

[0043] (4) comparing the first measured value of step (1) and the second measured value of step (3); when the second measured value KYNA / TRP is less than the first measured value KYNA / TRP, screening the drug as a drug useful for treating or alleviating heart failure; otherwise, screening the drug as a drug useless for treating or alleviating heart failure;

[0044] Or, compare the first measured value of step (1) and the second measured value of step (3); when the amount of the second measured value of the genus Parabacteroides is greater than the amount of the first measured value of the genus Parabacteroides, screen the drug as a drug useful for treating or alleviating heart failure; otherwise, screen the drug as a drug that is useless for treating or alleviating heart failure;

[0045] In the method, the subject is preferably an animal model suffering from heart failure, such as rats, mice, dogs, pigs, monkeys, orangutans, etc. Such animals can be induced to suffer from heart failure by artificial means.

[0046] The Parabacteroides genus is preferably Parabacteroides_distasonis.

[0047] The present invention has achieved the following beneficial technical effects:

[0048] (1) The present invention first discovered the strong correlation between the tryptophan metabolic pathway and the intestinal flora Parabacteroides and heart failure, and obtained a new biomarker KYNA / TRP-Parabacteroides_distasonis through metabolomics analysis and microbial diversity analysis. The kynurenic acid to tryptophan ratio (KYNA / TRP) of the present invention can better characterize the changes in the kynurenine pathway in the human body, excluding interference from other factors, and is more accurate.

[0049] (2) This study first gave rats with heart failure an oral kynurenine pathway inhibitor to inhibit the kynurenine pathway in the rats with heart failure. On this basis, qPCR technology was used to quantify the Parabacteroides_distasonis in the feces of rats with heart failure. This more accurately reflects the connection between the Parabacteroides_distasonis species and the kynurenine pathway and its relationship with heart failure. The experimental results are more accurate and reliable.

[0050] (3) The present invention has been double-validated by administering KYNA / TRP pathway indoleamine 2,3-dioxygenase inhibitors and Dengzhan Shengmai drugs, proving its important role in heart failure and its accuracy, specificity and sensitivity as a heart failure marker. It can be used as a target for the diagnosis of heart failure. It has achieved clinical non-invasive, low-cost detection, diagnosis or prediction of heart failure, and has good practical value.

[0051] (4) The biomarkers of the present invention can also be used as targets for screening drugs for preventing or treating heart failure, providing new targets for preventing and treating heart failure, and can be used for drug target research, precision medication, pathogenesis research, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 These are the echocardiographic parameters of rats 28 days after modeling (n=9 in each group), left ventricular ejection fraction (EF), left ventricular fractional shortening (FS); compared with the sham operation group, "***" indicates P<0.001.

[0053] Figure 2 The hemodynamic parameters of rats 28 days after modeling (n = 9 in each group) included left ventricular end-diastolic pressure (LVEDP), left ventricular systolic pressure (LVSP), maximum rate of decrease of left ventricular pressure (±dp / dt min ), maximum rate of rise of left ventricular pressure (±dp / dt max ); compared with the sham operation group, “*” indicates P < 0.05, “**” indicates P < 0.01, and “***” indicates P < 0.001.

[0054] Figure 3 The results are the detection results of serum B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide in rats 28 days after modeling (n=9 in each group), compared with the sham operation group, "***" means P<0.001.

[0055] Figure 4 These are the results of detection of tryptophan and its metabolite kynurenic acid and the kynurenic acid / tryptophan ratio KYNA / TRP in the serum of rats with heart failure 28 days after modeling (n=9 in each group). Compared with the sham operation group, "*" indicates P<0.05 and "**" indicates P<0.01.

[0056] Figure 5 It is the heat map of Spearman correlation analysis between KYNA / TRP ratio and cardiac function related parameters.

[0057] Figure 6 Mass spectrometry imaging of myocardial tissue in rats with heart failure.

[0058] Figure 7is the genus-level Chao index of the intestinal flora of rats in each group and its Wilcoxon rank sum test, p = 0.0712.

[0059] Figure 8 This is the principal coordinate analysis (PCoA) diagram of the intestinal flora of rats in each group at the genus level.

[0060] Fig. 9 is the relative abundance distribution of intestinal flora at the genus level in each group of rats.

[0061] Fig.10 It is a Wilcoxon rank sum test bar chart of the intestinal flora of rats in each group at the genus level.

[0062] Fig.11 It is a comparison of Parahacteroides_distasonis species in the intestinal flora of each group of rats.

[0063] Fig.12 The correlation between the rat serum kynurenic acid / tryptophan ratio KYNA / TRP and the relative abundance of Parahacteroides_distasonis species.

[0064] Fig.13 It is a diagram of the experimental design for validation of inhibition of kynurenine pathway, which is divided into 5 groups (n=9 in each group).

[0065] Fig.14 These are the echocardiographic parameters of rats in each group 28 days after modeling (n=9 in each group), left ventricular ejection fraction (EF), left ventricular fractional shortening (FS); compared with the model group, "***" indicates P<0.001.

[0066] Fig.15 The hemodynamic parameters of rats in each group 28 days after modeling (n = 9 in each group) included left ventricular end-diastolic pressure (LVEDP), left ventricular systolic pressure (LVSP), maximum rate of decrease of left ventricular pressure (±dp / dt min ), maximum rate of rise of left ventricular pressure (±dp / dt max ); compared with the model group, “*” indicates P < 0.05, “**” indicates P < 0.01, and “***” indicates P < 0.001.

[0067] Fig.16 These are the test results of serum B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide in rats of each group 28 days after modeling (n=9 in each group). Compared with the model group, "***" indicates P<0.001.

[0068] Fig.17These are the results of the determination of indoleamine 2,3-dioxygenase and kynurenine aminotransferase activities in the serum of rats in each group 28 days after modeling (n=9 in each group). Compared with the model group, “*” indicates P<0.05, “**” indicates P<0.01, and “***” indicates P<0.001.

[0069] Fig.18 It is the heat map of Spearman correlation analysis between indoleamine 2,3-dioxygenase and kynurenine aminotransferase activities and cardiac function indexes.

[0070] Fig.19 Comparison of the content of Parahacteroides_distasonis species in the intestinal flora of rats in each group 35 days after modeling (n=9 in each group); compared with the model group, "*" indicates P<0.05, and "***" indicates P<0.001.

[0071] Fig. 20 Comparison of cardiac function indices among rats in each group 28 days after modeling (n=9 in each group), left ventricular ejection fraction (EF), left ventricular fractional shortening (FS); compared with the model group, "*" indicates P < 0.05, "**" indicates P < 0.01, and "***" indicates P < 0.001.

[0072] Fig.21 The hemodynamic parameters of rats in each group 28 days after modeling (n = 9 in each group) included left ventricular end-diastolic pressure (LVEDP), left ventricular systolic pressure (LVSP), maximum rate of decrease of left ventricular pressure (±dp / dt min ), maximum rate of rise of left ventricular pressure (±dp / dt max ); compared with the model group, “*” indicates P < 0.05, “**” indicates P < 0.01, and “***” indicates P < 0.001.

[0073] Fig. 22 These are the test results of serum B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide in rats of each group 28 days after modeling (n=9 in each group). Compared with the model group, "**" indicates P<0.01 and "***" indicates P<0.001.

[0074] Fig.23 These are the results of the detection of tryptophan and its metabolite kynurenic acid and the kynurenic acid / tryptophan ratio KYNA / TRP in the serum of rats with heart failure 28 days after modeling (n=9 in each group). Compared with the model group, "*" indicates P<0.05 and "**" indicates P<0.01.

[0075] Fig.24 Comparison of the relative abundance of Parahacteroides_distasonis in rats of each group; compared with the model group, "*" indicates P < 0.05, and "**" indicates P < 0.01. DETAILED DESCRIPTION

[0076] The following content describes in detail various exemplary embodiments of the present invention, which should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention. It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. It should be understood by those skilled in the art that, as long as the purpose of the present invention can be achieved, other steps or operations may also be included before and after the steps involving the method, or between the steps, such as further optimizing and / or improving the method described in the present invention.

[0077] In addition, for the numerical range in the present invention, it is understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0078] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail. Unless otherwise specified, "%" is a percentage based on weight.

[0079] the term

[0080] The terms used in the present invention have the meanings commonly understood by those of ordinary skill in the relevant art. However, in order to better understand the present invention, some definitions and related terms are explained as follows:

[0081] In this article, the terms "heart failure", "HF" and "heart failure" can be used interchangeably, which refers to the inability of the heart's contractile and / or diastolic function to adequately remove venous blood from the heart, resulting in blood congestion in the venous system and insufficient blood perfusion in the arterial system, thereby causing a syndrome of cardiac circulatory disorders.

[0082] Herein, the terms "comprise", "include", and "contain" are interchangeable and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include "consisting of", "consisting essentially of".

[0083] Herein, the term "amount" includes meanings of content, level, absolute amount, relative amount and the like.

[0084] As used herein, the term "KYNA / TRP" refers to the ratio of kynurenic acid to tryptophan content.

[0085] In this article, Parabacteroides_distasonis refers to Bacteroides distasonis.

[0086] Those skilled in the art should understand that as long as the purpose of the present invention can be achieved, other steps or operations may be included before, after, or between the steps involved in the method, such as further optimizing and / or improving the method described in the present invention.

[0087] Example 1 Construction of heart failure rat model and sample collection

[0088] 1.1 Preparation of rat left anterior descending coronary artery ligation (LAD) model

[0089] 18 SPF male SD rats (purchased from Beijing Huafukang Biotechnology Co., Ltd.), weighing 240±10g, were fasted for 12 hours before modeling after acclimation for 3 days. They were randomly divided into sham operation group and model group. The model group was anesthetized by intraperitoneal administration of 0.2 ml / 100 g with 3% sodium pentobarbital solution prepared with sterile saline. The rats were depilated and skinned, disinfected, and the skin was cut longitudinally about 2 cm along the left edge of the left sternum under sterile conditions. The muscle tissue was bluntly separated between the fourth or fifth ribs, the chest cavity was opened and the pericardium was cut open, the heart was hooked out with a blunt retractor, and the left atrial appendage and the pulmonary artery cone were threaded, the left anterior descending branch of the coronary artery were ligated, and then the heart was quickly returned to the chest cavity, and the chest cavity and skin were sutured. After the ligation of the left anterior descending branch of the coronary artery, the electrocardiogram of each rat was observed, and the ST segment arch elevation ≥0.1mV was retained, that is, the rat had symptoms of myocardial ischemia. The sham operation group was treated in the same manner as the model animals except that the coronary artery was not ligated.

[0090] Blood samples were collected 28 days after modeling, serum was placed in an ice bath for 30 minutes, centrifuged at 4°C and 3000 rpm for 10 minutes, and the supernatant was aliquoted and frozen in a -80°C refrigerator for later use. Fresh feces of rats were collected by abdominal massage for intestinal flora analysis and stored in a -80°C ultra-low temperature refrigerator for later use.

[0091] 1.2 Confirmation of rat heart failure model

[0092] Cardiac function, hemodynamics and biochemical indexes were tested 28 days after modeling.

[0093] The small animal ultrasound system was used for measurement, and the results of cardiac function test were as follows Figure 1The results showed that compared with the sham operation group, the left ventricular ejection fraction and left ventricular fractional shortening of the rats in the model group were significantly reduced on the 28th day after acute myocardial infarction induced by coronary artery ligation, indicating that heart failure may occur in the rats.

[0094] The carotid artery intraventricular catheterization method was used to evaluate the cardiac hemodynamic parameters of rats in each group. Figure 2 The hemodynamic evaluation showed that the left ventricular end-diastolic pressure in the model group was higher than that in the sham operation group. On the contrary, compared with the sham operation group, the left ventricular systolic pressure and the maximum rate of decrease of left ventricular pressure (±dp / dt min ) and the maximum rate of rise of left ventricular pressure (±dp / dt max ) was significantly reduced.

[0095] Serum was collected from rats 28 days after modeling and tested for rat B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide using the THERMO fully automatic microplate reader MK3 according to the ELISA kit. Figure 3 Biochemical indexes showed that the concentrations of B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide in the model group were significantly higher than those in the sham-operated rats. The above results showed that the rat heart failure model was successfully established.

[0096] Example 2 Amino Acid Targeted Metabolomics Analysis

[0097] 2.1 Experimental methods

[0098] 2.1.1 Sample pretreatment

[0099] Preparation of internal standard dilution: First, dissolve the standard in 1 ml of methanol: water (1:1), vortex to mix thoroughly, and obtain the standard stock solution. Dilute the stock solution with pure methanol. After dilution, the internal standard mass concentrations are as follows: alanine-d4 (4.7 ng / ml), arginine-d4 (10.8 ng / ml), aspartic acid-d3 (6.8 ng / ml), citrulline-d2 (8.9 ng / ml), glutamic acid-d3 (7.5 ng / ml), glycine-15N (19.3 ng / ml), leucine-d3 (6.7 ng / ml). ml), methionine-d3 (7.6 ng / ml), ornithine-d2 (8.5 ng / ml), phenylalanine-13C6 (8.6 ng / ml), tyrosine-13C6 (9.4 ng / ml), valine-d8 (6.3 ng / ml), carnitine-D3 (10 ng / ml), creatinine-13C5 (10 ng / ml), trimethylamine oxide-D9 (10 ng / ml). Mix well and store in a 4°C refrigerator for later use.

[0100] Take 4 μl of blood sample and place it in a 4°C refrigerator to thaw. Add 996 μl of extract containing internal standard (85% acetonitrile solution containing

[0101] 1.7 μmol ammonium formate), vortex mix, centrifuge at 4°C, 12000 rpm for 5 min, and take the supernatant into a sample vial for testing.

[0102] 2.1.2 Chromatographic conditions

[0103] Ultra-high performance liquid chromatography ACQUITY BEH Amide column (2.1 mm × 100 mm, 1.7 μm), mobile phase A: acetonitrile (containing 0.2% formic acid and 1 mmol ammonium formate); mobile phase B: ultrapure water (containing 0.1% formic acid and 1 mmol ammonium formate); gradient elution: (0-0.5 min, 85% A; 0.5-5.5 min, 85-80% A; 5.5-12.5 min, 80-60% A; 12.5-13.0 min, 60-85% A; 13.0-15.0 min, 85% A), column temperature 40 ° C, flow rate 0.3 mL·min -1 , injection volume 5 μl.

[0104] 2.1.3 Mass spectrometry

[0105] Waters triple quadrupole mass spectrometer (TQ-S): multiple reaction monitoring (MRM) in positive ion mode was used for acquisition; the capillary voltage was 0.4 KV; the cone voltage was 20 V. The ion source temperature was 150 °C; the desolvation temperature was 400 °C; the desolvation flow rate was 800 L·h -1 ; Cone hole gas flow rate is 150L·h -1 The parameters of amino acid parent-daughter ion pairs, cone voltage and collision energy are shown in Table 1.

[0106] Table 1 Correspondence between amino acid types and parent ions, daughter ions, cone voltage, and collision energy

[0107]

[0108]

[0109] 2.1.4 Data Analysis

[0110] Data analysis MarkerLynx V 4.1 was used to perform ion pair integration and other operations on the acquired spectra.

[0111] 2.2 Experimental Results

[0112] 2.2.1 Analysis of serum amino acid metabolomics in rats with heart failure model

[0113] Through the amino acid metabolomics analysis of the model rats, two different metabolites, tryptophan and kynurenic acid, were obtained. Compared with the control group and the sham operation group, the serum kynurenic acid and tryptophan content in the heart failure model group increased, and the kynurenic acid / tryptophan ratio KYNA / TRP was significantly increased. Figure 4 .

[0114] 2.2.2 Spearman correlation analysis between KYNA / TRP ratio and cardiac function

[0115] In order to more clearly show the relationship between the kynuric acid / tryptophan ratio KYNA / TRP and cardiac function, Spearman correlation analysis was used. The results are shown in Figure 5 It was found that the kynuric acid / tryptophan ratio KYNA / TRP was significantly correlated with the maximum rate of decrease of left ventricular pressure (±dp / dt min ), B-type natriuretic peptide, N-terminal pro-brain natriuretic peptide and left ventricular systolic pressure (LVSP) were significantly positively correlated, and were significantly negatively correlated with left ventricular ejection fraction (EF), left ventricular fractional shortening (FS) and left ventricular end-diastolic pressure (LVEDP). This indicates that the kynurenine pathway of tryptophan metabolism may aggravate the degree of heart failure.

[0116] 2.2.3 Mass spectrometry imaging of myocardial tissue in rats with heart failure model

[0117] Mass spectrometry imaging was performed on rats in each group, and the results were as follows: Figure 6 The results of mass spectrometry imaging showed that the distribution of kynurenic acid, tryptophan and kynurenine in the myocardial tissue of rats with heart failure model increased significantly compared with the sham operation group.

[0118] Taken together the above experimental results indicate that the kynurenine pathway of tryptophan metabolism worsens the occurrence and progression of heart failure.

[0119] Example 3 Analysis of intestinal flora in rats with heart failure

[0120] 3.1 16S rDNA gene sequencing analysis

[0121] 3.1.1 DNA extraction and PCR amplification from stool samples

[0122] use The total DNA in the feces of the 31 fecal samples selected for sequencing (n = 9-12 per group) was isolated and extracted using the soil DNA extraction kit (Omega Bio-tek, Norcross, GA, US). Then, the V3-V4 region of the mouse bacterial 16S rRNA gene was amplified according to the primers shown in Table 2, and specific primers were synthesized and amplified by PCR.

[0123] Table 2 PCR amplification primer information for bacterial 16S rRNA gene sequencing

[0124]

[0125] Amplification system (20 μl): 4 μl of 5× TransStart FastPfu buffer, 2 μl of 2.5 mM dNTPs, 0.8 μl of upstream primer (5 uM), 0.8 μl of downstream primer (5 uM), 0.4 μl of TransStart FastPfu DNA polymerase, 10 ng of template DNA, and ddH2O to 20 μl. Each sample was repeated 3 times.

[0126] Amplification parameters: 95°C pre-denaturation for 3 minutes, 27 cycles (95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 30 seconds), then 72°C stabilization for 10 minutes, and finally storage at 4°C (PCR instrument: ABI Model 9700).

[0127] 3.1.2 Illumina Miseq sequencing

[0128] The PCR products of the same sample were mixed and recovered using 2% agarose gel. The recovered products were purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA), detected by 2% agarose gel electrophoresis, and analyzed by Quantus TM Fluorometer (Promega, USA) was used to detect and quantify the recovered products. NEXTflexTM Rapid DNA-Seq Kit (Bioo Scientific, USA) was used to build the library. Illumina's Miseq PE300 platform (Shanghai Meiji Biopharmaceutical Technology Co., Ltd.) was used for sequencing.

[0129] 3.1.3 Data processing

[0130] (1) The raw sequencing sequences were quality controlled using fastp (https: / / github.com / OpenGene / fastp, version 0.20.0) software, and spliced ​​using FLASH (http: / / www.cbcb.umd.edu / software / flash, version 1.2.7) software: (1) The bases with a quality value of less than 20 at the tail of the reads were filtered, and a 50-bp window was set. If the average quality value in the window was less than 20, the back-end bases were truncated from the window. After quality control, the reads less than 50 bp were filtered, and the reads containing N bases were removed;

[0131] (2) Based on the overlap relationship between PE reads, the paired reads were spliced ​​(merged) into a sequence, with a minimum overlap length of 10 bp;

[0132] (3) The maximum mismatch ratio allowed in the overlap region of the spliced ​​sequence is 0.2, and non-compliant sequences are screened out;

[0133] (4) Samples are distinguished based on the barcodes and primers at both ends of the sequence, and the sequence direction is adjusted. The allowed number of mismatches for the barcode is 0, and the maximum number of mismatches for the primers is 2.

[0134] UPARSE software (http: / / drive5.com / uparse / , version 7.1) was used to cluster the sequences into OTUs and remove chimeras based on 97% similarity. RDP classifier (http: / / rdp.cme.msu.edu / , version 2.2) was used to annotate each sequence by species classification and compare it to the Silva 16S rRNA database (version 138), with the comparison threshold set at 70%.

[0135] 3.2 Metagenomic sequencing analysis

[0136] 3.2.1 DNA extraction, library construction and metagenomic sequencing

[0137] Total genomic DNA was extracted from rat fecal samples using the EZNA soil DNA kit (Omega Bio-tek, Norcross, GA, US) according to the manufacturer's instructions. The concentration and purity of the extracted DNA were determined using TBS-380 and NanoDrop2000, respectively. The quality of the DNA extract was checked on a 1% agarose gel. The DNA extract was fragmented to an average size of about 400 bp using Covaris M220 (China Gene Co., Ltd.) for paired end library construction. Paired end libraries were constructed using NEXTflexTM rapid DNA sequence (Bioo Scientific, Austin, Texas, USA). Adapters containing a full set of sequencing primer hybridization sites were connected to the blunt ends of the fragments. Paired end sequencing was performed using the NovaSeq kit / Hiseq X kit for Illumina Novasek / Hiseq Xten (Illumna Inc., San Diego, California, USA) at Majorbio Bio Pharm Technology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.Illumina.com).

[0138] 3.2.2 Sequence quality control and genome assembly

[0139] Fastp (https: / / github.com / OpenGene / fastp, version 0.20.0) was used to cut the quality of the adapter sequences at the 3' and 5' ends of the reads; fastp (https: / / github.com / OpenGene / fastp, version 0.20.0) was used to remove reads with a length less than 50 bp, an average base quality value less than 20, and N bases after cutting, and high-quality pair-end reads and single-end reads were retained; the optimized sequences were assembled using the splicing software MEGAHIT (https: / / github.com / voutcn / megahit, version 1.1.2) based on the principle of succinct de Bruijngraphs. Contigs with ≥ optimized sequence bp were selected in the splicing results as the final assembly results.

[0140] 3.2.3 Gene prediction, classification and functional annotation

[0141] MetaGene was used to identify open reading frames (ORFs) in contigs (http: / / metagene.cb.ku-tokyo.ac.jp / ), and predicted ORFs of 100 bp or longer were retrieved and translated into amino acid sequences using the NCBI translation table (http: / / www.ncbi.nlm.nih.gov / Taxonomy / taxonomyhome.html / index.cgi?chapter=tgencodes#SG1). A non-redundant gene catalog was constructed using CD-HIT (http: / / www.bioinformatics.org / cd-hit / 4.6.1) with 90% sequence identity and 90% coverage. SOAPaligner was used to map quality-controlled reads to a non-redundant gene catalog with 95% identity (http: / / www.bioinformatics.org / cd-hit / , version 4.6.1) and gene abundance in each sample was assessed.

[0142] 3.2.4 Species and functional annotation

[0143] 3.2.4.1 Species taxonomic annotation

[0144] 1 Diamond (http: / / www.diamondsearch.org / index.php, version 0.8.35) was used to align the amino acid sequences of the non-redundant gene set with the NR database (BLASTP alignment parameters were set with the expected value e-value of 1e -5 ), and obtain species annotations through the taxonomic information database corresponding to the NR library, and then use the sum of gene abundances corresponding to the species to calculate the abundance of the species.

[0145] 3.2.4.2 KEGG functional annotation

[0146] The amino acid sequences of the non-redundant gene set were aligned with the KEGG database (version 94.2) using Diamond (http: / / www.diamondsearch.org / index.php, version 0.8.35) (BLASTP alignment parameters were set with an expected value of e-value of 1e -5 ). Obtain the KEGG function corresponding to the gene. The abundance of the corresponding functional category is calculated using the sum of the gene abundances corresponding to KO, Pathway, EC, and Module.

[0147] 3.3 Relative quantification of Parabacteroides distasonis by fluorescence quantitative PCR

[0148] 3.3.1 Primer sequences

[0149] (1) Primer sequence of housekeeping gene (internal reference primer 16s)

[0150] 338F:ACTCCTACGGGAGGCAGCAG (SEQ ID NO: 3)

[0151] 518R:ATTACCGCGGCTGCTGG (sequence 4)

[0152] (2) Target gene primer sequence

[0153] Parabacteroides-F: TGCCTATCAGAGGGGGATAAC (sequence 5)

[0154] Parabacteroides-R: GCAAATATTCCCATGCGGGAT (sequence 6)

[0155] 5.2 DNA extraction

[0156] Weigh each sample and extract DNA. For specific operation steps, please refer to Soil DNA KIT (D5625 Omega). Finally, add 80ul of elution buffer to elute and collect 70ul of DNA.

[0157] 3.3.2 Fluorescence quantitative PCR detection

[0158] 3.3.2.1 Experimental samples

[0159] The DNA sample was diluted 100 times and used as a template for detection.

[0160] 3.3.2.2 Real-time quantitative PCR test materials and instruments

[0161] Quantitative PCR reagents: 2X SG Fast qPCR Master Mix (B639271, BBI, Roche).

[0162] Quantitative PCR instrument: LightCycler 480 II fluorescent quantitative PCR instrument (Roche, Rotkreuz, Switzerland).

[0163] 3.3.2.3 PCR reaction steps

[0164] (1) Preparation of reaction mixture

[0165]

[0166] (2) PCR cycling conditions

[0167]

[0168] (3) Instrument operation

[0169] After completing the above steps, the 96 / 384-well plate with the added samples was placed in the LightCycler 480 II (Roche) for reaction.

[0170] 3.4 Analysis of intestinal flora in rats with heart failure

[0171] The intestinal microbiota has become a core factor affecting human health and disease, and the intestinal microbiota has a certain impact on the onset of cardiovascular disease. At the same time, the intestinal flora is also involved in tryptophan metabolism. Therefore, changes in the composition of intestinal microorganisms also play an important role in the occurrence and development of heart failure. However, it is not clear how changes in the intestinal flora interfere with the process of heart failure. Therefore, 16s rDNA sequencing was performed on fecal samples of these heart failure model rats to clarify how the intestinal microbiota affects heart failure.

[0172] 3.4.1 Analysis of α-diversity of intestinal flora in rats with heart failure model

[0173] The rank sum test was used to perform a difference analysis test on the α diversity index. The results are as follows Figure 7 The differences in the composition of the intestinal microbiota between the sham group and the model group were analyzed by evaluating α diversity. Figure 7 Compared with the sham operation group, the Chao index in the HF model group was significantly increased.

[0174] The results showed that the richness of intestinal microbial communities increased in rats with heart failure model, demonstrating the link between the composition and changes of intestinal microbial communities and heart failure.

[0175] 3.4.2 Analysis of β-diversity of intestinal flora in rats with heart failure model

[0176] Principal coordinate analysis (PCoA) was used as a measure of β diversity to analyze the β diversity of the intestinal flora in rats with heart failure. Figure 8 The results showed that the HF model group and the sham operation group could be clearly distinguished, that is, at the genus level, the distribution of bacteria with higher relative abundance in the HF model group and the sham operation group was significantly different.

[0177] 3.4.3 Analysis of species with significant differences in intestinal flora components of rats with heart failure

[0178] In order to more accurately understand the changes in the intestinal microbiome, we performed differential analysis at the genus and species levels. Figure 9-11 The data showed that there were significant differences in 4 bacterial genera between the model group and the sham operation group: Erysipelatoclostridium, Parabacteroides, Turicibacter, Dielma and Parabacteroides_distasonis. This showed that the number of Bacteroides in rats with heart failure was significantly reduced.

[0179] 3.4.4 Correlation analysis between relative abundance of intestinal flora and KYNA / TRP ratio in serum of rats with heart failure

[0180] To further explore the relationship between Parabacteroides_distasonis and the kynurenine pathway (kynurenine / tryptophan ratio KYNA / TRP), a linear analysis of the relative abundance of Parabacteroides_distasonis and the KYNA / TRP ratio was performed. Fig.12The results showed that the intestinal flora of rats, Parabacteroides_distasonis, was negatively correlated with the serum kynurenic acid / tryptophan ratio KYNA / TRP.

[0181] Example 4: Verification experiment on the effect of tryptophan kynurenine metabolic pathway on heart failure

[0182] 4.1 Preparation of rat left anterior descending coronary artery ligation (LAD) model

[0183] 45 SPF male SD rats (purchased from Beijing Huafukang Biotechnology Co., Ltd.), weighing 240 ± 10g, were fasted for 12h before modeling after acclimatization for 3 days. They were randomly divided into a control group, a sham operation group, a model group, a low-dose group and a high-dose group. According to Example 1, the method was used to construct a heart failure model for the model group, the low-dose group and the high-dose group rats. The sham operation group was operated except that the coronary artery was not ligated, and the other operations were the same as the modeling animals.

[0184] 4.2 Dosage regimen

[0185] Design of the scheme Fig.13 As shown. After modeling, the rats were injected with drugs, including 250 mg / kg / day of 1-methyltryptophan (1-MT) intraperitoneal injection of rats in the low-dose group and 500 mg / kg / day of 1-MT intraperitoneal injection of rats in the high-dose group. The control group, sham operation group and model group were given corresponding normal saline, and blood was collected from the eye sockets after continuous administration for 35 days.

[0186] 4.3 Echocardiography, hemodynamics, and biochemical index testing

[0187] After 28 days of modeling, the rats were subjected to echocardiography and hemodynamic tests. Figure 14-16 shown.

[0188] Compared with the sham operation group and the control group, the left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS) of the rats in the model group were significantly reduced; compared with the model group, the left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS) of the rats in the low-dose group showed an upward trend. In the high-dose group, the above parameters were significantly increased in a dose-dependent manner. This indicates that rats may have heart failure, and tryptophan kynurenine metabolism may aggravate the severity of heart failure.

[0189] Hemodynamic evaluation showed that the left ventricular end-diastolic pressure of the model group rats was significantly higher than that of the sham operation group and the control group; compared with the model group, the left ventricular end-diastolic pressure of the rats in the low-dose and high-dose groups showed a downward trend, and the high-dose group had a significant difference. Compared with the control group and the sham operation group, the content of brain natriuretic peptide and N-terminal brain natriuretic peptide precursor in the model group rats was significantly increased; compared with the model group, the content of brain natriuretic peptide and N-terminal brain natriuretic peptide precursor in the low-dose and high-dose groups rats was significantly reduced.

[0190] 4.3 Rat serum enzyme activity detection

[0191] The results of the assay of indoleamine 2,3-dioxygenase and kynurenine aminotransferase activities in rat serum were as follows Fig.17 Compared with the control group and the sham operation group, the activities of indoleamine 2,3-dioxygenase and kynurenine aminotransferase in the model group were significantly increased. Compared with the model group, after administration of indoleamine 2,3-dioxygenase inhibitor, the activities of serum indoleamine 2,3-dioxygenase and kynurenine aminotransferase in the low-dose group and the high-dose group were significantly decreased.

[0192] In addition, the inventors also conducted Spearman correlation analysis on indoleamine 2,3-dioxygenase and kynurenine aminotransferase and cardiac function indexes. Fig.18 The results showed that both were significantly positively correlated with B-type natriuretic peptide, N-terminal pro-brain natriuretic peptide and left ventricular end-diastolic pressure (LVEDP), and significantly negatively correlated with left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS). The above results further illustrate that inhibiting the kynurenine pathway can alleviate heart failure.

[0193] 4.4 Effects of blocking the kynurenine pathway on the intestinal flora of rats

[0194] In order to verify whether blocking the tryptophan metabolic pathway would increase the expression of Parabacteroides_distasonis, we measured the expression of Parabacteroides_distasonis in the samples by fluorescent quantitative PCR, and the steps were as in Example 3. The results are shown in Fig.19 shown.

[0195] The results showed that compared with the sham operation group, the content of Parabacteroides_distasonis in the model group rats with heart failure was significantly reduced. Compared with the model group, the content of Parabacteroides_distasonis in the low-dose group and the high-dose group rats was significantly increased. This showed that with the inhibition of the kynurenine pathway by indoleamine 2,3-dioxygenase inhibitors, the content of Parabacteroides_distasonis gradually increased.

[0196] The above results indicate that Parabacteroides_distasonis and the kynurenine pathway jointly affect the progression of heart failure.

[0197] Example 5 Application of KYNA / TRP-Parabacteroides_distasonis axis as a heart failure marker in the study of the pharmacodynamic mechanism of Dengzhan Shengmai in the treatment of heart failure

[0198] 5.1 Preparation of rat left anterior descending coronary artery ligation (LAD) model

[0199] 36 SPF male SD rats (purchased from Beijing Huafukang Biotechnology Co., Ltd.), weighing 240 ± 10g, were fasted for 12h before modeling after acclimation for 3 days. They were randomly divided into sham operation group, model group, DZSM group and positive drug group. According to the method described in Example 1, the heart failure model was constructed for the model group, the DZSM group and the positive drug (trimetazidine) group rats. The sham operation group was operated the same as the modeling animals except that the coronary artery was not ligated.

[0200] 5.2 Dosage regimen

[0201] After the modeling was completed, rats were gavaged with drugs, including the sham operation group and the model group, which were administered with the corresponding CMCNa solution, the DZSM group, which were administered with Dengzhan Shengmai Capsules (National Medicine Standard Z20026439, Yunnan Biovalley Pharmaceuticals) 0.1 g / kg / day, and the positive drug group, which were administered with trimetazidine hydrochloride (National Medicine Standard H20083806, Yuanda Pharmaceuticals) 5.4 mg / kg / day. The drug administration process lasted for one month.

[0202] 5.3 Echocardiography

[0203] After 28 days of modeling, the rats were subjected to ultrasound cardiology testing. Fig. 20 As shown. On the 28th day after acute myocardial infarction induced by coronary artery ligation, the left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS) of rats were significantly reduced; compared with the model group, the left ventricular ejection fraction and left ventricular fractional shortening of rats in the Dengzhan Shengmai administration group and the trimetazidine administration group showed a significant correction trend. The above results indicate that the rat heart failure model was successfully established, and both trimetazidine and Dengzhan Shengmai administration showed a relieving effect on rats with heart failure model.

[0204] 5.3 Hemodynamic monitoring

[0205] After the administration, the hemodynamics of rats in each group were tested. Fig.21As shown in the data, hemodynamic evaluation showed that the left ventricular end-diastolic pressure (LVEDP) in the model group was higher than that in the sham operation group. Compared with the model group, the left ventricular end-diastolic pressure levels of rats in the Dengzhan Shengmai and trimetazidine administration groups were significantly decreased. On the contrary, compared with the sham operation group, the left ventricular systolic pressure (LVSP) and the maximum rate of decrease of left ventricular pressure (±dp / dt min ) and the maximum rate of rise of left ventricular pressure (±dp / dt max ) were significantly reduced; the Dengzhan Shengmai group and the trimetazidine group were significantly higher than the model group.

[0206] 5.4 Biochemical index detection

[0207] The concentrations of B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide in each group of rats were measured. Fig. 22 As shown in the figure, compared with the sham operation group, the concentrations of B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide in the model rats were significantly increased. Compared with the model group, the serum B-type natriuretic peptide and N-terminal pro-brain natriuretic peptide levels of rats in the Dengzhan Shengmai administration group and the trimetazidine administration group were downregulated.

[0208] 5.5 Liquid chromatography-mass spectrometry for targeted quantitative analysis

[0209] Based on the liquid chromatography-mass spectrometry technology, the detection of tryptophan and kynurenic acid in the serum of rats with heart failure was analyzed by targeted quantitative analysis. The preparation of standard solution, sample preparation, chromatographic conditions, and mass spectrometry conditions were the same as those in Example 2. The results are shown in FIG. Fig.23 shown.

[0210] Compared with the sham operation group, the levels of tryptophan, kynurenic acid and the ratio of kynurenic acid to tryptophan (KYNA / TRP) in the model group were significantly increased; the levels in the Dengzhan Shengmai group and the trimetazidine group were decreased to varying degrees compared with the model group, and the decrease in the Dengzhan Shengmai group was the most significant. The results suggest that the rat model of heart failure was successfully established.

[0211] 5.6 16s rDNA gene sequencing analysis

[0212] The steps are the same as in Example 3. The results are as follows Fig.24 As shown in the figure, compared with the sham operation group, the relative abundance of Parabacteroides distasonis in the model group decreased significantly. Compared with the model group, the relative abundance of Parabacteroides distasonis in the Dengzhan Shengmai administration group and the positive drug administration group was significantly increased.

[0213] By detecting the callback of the heart failure marker KYNA / TRP-Parabacteroides_distasonis axis in the body circulation of rats in the Dengzhan Shengmai group, it was suggested that Dengzhan Shengmai Capsule has the efficacy of treating heart failure; at the same time, it also verified the accuracy, specificity and sensitivity of KYNA / TRP-Parabacteroides_distasonis as a heart failure marker.

Claims

1. A biomarker for heart failure, characterized in that It includes metabolic biomarkers combined with microbial markers; the metabolic biomarker is the ratio of kynurenic acid to tryptophan KYNA / TRP; the microbial marker is the genus Parabacteroides.

2. The biomarker according to claim 1, characterized in that The metabolic biomarker is the ratio of kynurenic acid to tryptophan KYNA / TRP, and the microbial marker is Parabacteroides_distasonis bacteria.

3. The biomarker according to claim 1, characterized in that The biomarkers are selected from test samples of the subject; wherein the test samples of metabolic biomarkers include blood, plasma, and serum samples of the subject, and the test samples of microbial markers include feces samples of the subject.

4. A method for preparing a product for diagnosing heart failure in a subject or predicting whether a subject is at risk of heart failure by detecting a substance that is a biomarker according to any one of claims 1 to 3.

5. A product, characterized in that: The product comprises a substance for detecting the biomarker according to any one of claims 1 to 3, and the product is used to test or diagnose whether a subject suffers from heart failure; or predict whether a subject has the risk of heart failure.

6. The product according to claim 5, characterized in that The product includes reagents, devices and / or equipment for detecting the level and / or quantity and / or abundance of biomarkers in a sample to be tested.

7. The product according to claim 6, characterized in that The products include kits.

8. A system for predicting the risk of heart failure, characterized in that: It comprises a data acquisition unit and a judgment unit; wherein the data acquisition unit comprises a device for obtaining the levels of tryptophan and its kynurenine pathway metabolites from the subject's blood sample and the number or abundance of intestinal Parabacteroides bacteria from the subject's fecal sample; the judgment unit is used to compare the tryptophan / kynurenine ratio KYNA / TRP and the number or abundance of intestinal Parabacteroides bacteria with a preset threshold value, and classify the subject as a patient with a high or low risk of heart failure.

9. Use of the biomarker according to any one of claims 1 to 3 as a target for screening drugs for preventing or treating heart failure.

10. The use according to claim 9, characterized in that The effects of the candidate drug on the biomarkers before and after use are utilized to determine whether the candidate drug can be used to prevent or treat heart failure.

Images