Construction method of interaction plasmid library, interaction identification method of cDNA library and application

Abstract

The invention relates to the technical field of yeast two-hybrid, in particular to a construction method of an interaction plasmid library, an interaction identification method of a cDNA library and application. The two cDNA libraries can be constructed in the same vector and respectively expressed by using one yeast double expression vector, the expression of the two cDNA libraries does not generate interference, and the two cDNA libraries can be accurately subjected to interaction identification in the same yeast, so that the workload of construction and extraction of an interaction plasmid library, construction and culture of a strain and the like is greatly reduced, and the identification efficiency is remarkably improved.

Description

Technical Field

[0001] The present application relates to the technical field of yeast two-hybridization, and specifically to a method for constructing an interaction plasmid library, and a method and application of interaction identification of a cDNA library. Background Art

[0002] A cDNA plasmid library refers to a collection of clones formed by connecting cDNA fragments formed by reverse transcription of all mRNA transcribed during a certain developmental period of a certain organism with a certain vector. A cDNA plasmid library is a collection of recombinant DNA clones formed by connecting complementary DNA (cDNA) formed by reverse transcription with an appropriate vector (commonly used phage or plasmid vector) to transform the recipient bacteria, using specific tissue or cell mRNA as a template. The collection of cDNA clones containing all the mRNA information of the cell is called the interaction plasmid library of the tissue or cell. The interaction plasmid library specifically reflects the coding genes of proteins expressed in a certain tissue or cell at a specific developmental stage, so the interaction plasmid library has tissue or cell specificity.

[0003] The yeast two-hybrid system is an important method currently widely used in protein interactome research. The principle is that when the target protein and the bait protein specifically bind, the bait protein binds to the promoter of the reporter gene and starts the expression of the reporter gene in the yeast cell. If the expression product of the reporter gene is detected, it means that there is an interaction between the two, otherwise there is no interaction between the two. After this technology is miniaturized and arrayed, it can be used for large-scale protein, such as the study of interactions between cDNA files. In actual work, people have developed single-hybrid systems, three-hybrid systems, and reverse hybridization systems according to needs. The yeast two-hybrid vectors currently used are mainly based on the two cloning technologies of enzyme digestion-ligation and Gateway, which have problems such as cumbersome operation or expensive reagents.

[0004] However, when the yeast two-hybrid provided by the prior art identifies protein interactions, it is necessary to construct the exogenous gene to be studied on at least two vectors, such as a prey vector and a bait vector, and transfer these two vectors into two yeast strains for expression and hybridization culture to determine whether the two are hybridized. When it is necessary to verify the interaction of multiple pairs of proteins, it is necessary to construct multiple vectors accordingly. Today's research system is more complex, and it is often necessary to discuss and study multiple proteins. In this way, the workload of using traditional technologies increases accordingly, and it is no longer suitable for the interaction identification experiment of multiple pairs of proteins. Summary of the invention

[0005] The inventors of this application creatively constructed two cDNA libraries in yeast two-hybrid into the same vector to obtain an interaction plasmid library, which can express two cDNA libraries from different or the same sources in yeast respectively, and the two cDNA libraries can be accurately identified in the same yeast strain without interference, which greatly reduces the workload of interaction plasmid library construction and extraction, strain construction and cultivation, and significantly improves identification efficiency. The technical solution provided by this application provides help and improves efficiency for improving point-to-point, point-to-library and library-to-library protein interaction identification.

[0006] To this end, this application discloses at least the following technical solutions:

[0007] On the one hand, a method for constructing an interactive plasmid library is provided. The construction method includes: obtaining a yeast two-hybrid vector having a first multiple cloning site and a second multiple cloning site; obtaining a first cDNA library and a second cDNA library; obtaining a linearized yeast two-hybrid vector; and inserting the first cDNA library and the second cDNA library into the first multiple cloning site and the second multiple cloning site of the linearized yeast two-hybrid vector, respectively. Wherein, the yeast two-hybrid vector also has a first sequence and a second sequence, the first sequence and the second sequence are connected to form a circular DNA molecule, and the transcription direction of the first sequence is opposite to the transcription direction of the second sequence. The first sequence includes the first multiple cloning site, the coding region of the GAL4 activation domain, the first promoter, the first operator and the basic vector initiation region connected in sequence, the first promoter, the coding region of the GAL4 activation domain and the first multiple cloning site have the same transcription direction, and the first promoter is used to start the expression of the coding region of the GAL4 activation domain and / or the expression of the first cDNA library inserted into the first multiple cloning site. The second sequence includes the second multiple cloning site, the coding region of the GAL4 binding domain, the second promoter, the second operator and the yeast 2U replication origin region which are sequentially connected. The second multiple cloning site, the coding region of the GAL4 binding domain, the second promoter, the second operator and the yeast 2U replication origin region have the same transcription direction. The second promoter is used to promote the expression of the coding region of the GAL4 binding domain and / or the expression of the second cDNA library inserted into the second cloning site.

[0008] In one aspect, a method for identifying interactions of cDNA libraries is provided. The identification method comprises providing an interaction plasmid library constructed in the above aspect, transferring the interaction plasmid library into yeast to obtain recombinant yeast, and judging whether the first cDNA library and the second cDNA library interact based on the growth state of the recombinant yeast on a selective medium.

[0009] On the one hand, provided is the application of the interaction plasmid library obtained by the construction method described in the above aspects in protein interaction of the interaction plasmid library. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 A schematic diagram of the structure of a yeast two-hybrid vector provided in one embodiment.

[0011] Figure 2 A schematic diagram of a flow chart of a method for identifying interactions in a cDNA library provided in one implementation scheme.

[0012] Figure 3 The electrophoresis diagram of the AD library and the BD library provided in one embodiment.

[0013] Figure 4 The electrophoresis diagram of the linearized pGAB-Dual Drive-IF-1 plasmid fragment provided in one embodiment.

[0014] Figure 5 The figure is a PCR electrophoresis diagram of transformant colonies of a transformation interaction plasmid library provided in one embodiment.

[0015] Figure 6 The electrophoresis diagram of the linearized pGAB-Dual Drive-IF-2 plasmid fragment provided in one embodiment.

[0016] Figure 7 A plate map of transformants from an activation plasmid library is provided for one embodiment.

[0017] Figure 8 The growth status of 40 four-deficient plates of recombinant transformants of the interaction plasmid library provided in one embodiment for 3 days.

[0018] Fig. 9 The growth status of recombinant transformants of the self-activation plasmid library provided in one embodiment on eight four-deficient plates for 3 days.

[0019] Fig.10 An electrophoresis diagram of PCR amplification products of an extracted interaction plasmid library or self-activation plasmid library is provided in one embodiment. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0021] Construction method of interaction plasmid library

[0022] Some embodiments provide a method for constructing an interactive plasmid library. The construction method includes: obtaining a yeast two-hybrid vector having a first multiple cloning site and a second multiple cloning site; obtaining a first cDNA library and a second cDNA library; obtaining a linearized yeast two-hybrid vector; and inserting the first cDNA library and the second cDNA library into the first multiple cloning site and the second multiple cloning site of the linearized yeast two-hybrid vector, respectively. Wherein, the yeast two-hybrid vector also has a first sequence and a second sequence, the first sequence and the second sequence are connected to form a circular DNA molecule, and the transcription direction of the first sequence is opposite to the transcription direction of the second sequence. The first sequence includes the first multiple cloning site, the coding region of the GAL4 activation domain, the first promoter, the first operator and the basic vector initiation region connected in sequence, the first promoter, the coding region of the GAL4 activation domain and the first multiple cloning site have the same transcription direction, and the first promoter is used to initiate the expression of the coding region of the GAL4 activation domain and / or the expression of the first cDNA library inserted into the first multiple cloning site. The second sequence includes the second multiple cloning site, the coding region of the GAL4 binding domain, the second promoter, the second operator and the yeast 2U replication origin region which are sequentially connected. The second multiple cloning site, the coding region of the GAL4 binding domain, the second promoter, the second operator and the yeast 2U replication origin region have the same transcription direction. The second promoter is used to promote the expression of the coding region of the GAL4 binding domain and / or the expression of the second cDNA library inserted into the second cloning site.

[0023] In some embodiments, the yeast dual expression vector further comprises a termination region. The termination region is located between the transcription terminal of the first sequence and the transcription terminal of the second sequence. In some embodiments, the termination region is such as SEQ ID NO: 11, and the termination region comprises two synthetic termination sequences. The two termination sequences are respectively used to terminate the expression of the coding region of the GAL4 activation domain in the first sequence and / or the expression of the first target gene inserted in the first multiple cloning site, and to terminate the expression of the coding region of the GAL4 binding domain in the second sequence and / or the expression of the second target gene inserted in the second cloning site.

[0024] In some embodiments, the first cloning site and the second cloning site each have at least two restriction endonuclease sites.

[0025] In some embodiments, the yeast dual expression vector further has two T7 promoters inserted between the first multiple cloning site and the coding region of the GAL4 activation domain and between the second multiple cloning site and the coding region of the GAL4 binding domain, respectively.

[0026] In some embodiments, the first promoter and the second promoter are both promoters suitable for yeast.

[0027] In some embodiments, the first promoter and the second promoter are both selected from; GK (phosphoglycerol kinase) type promoter, GAP (3-phosphoglyceraldehyde dehydrogenase) type promoter, ADH (alcohol dehydrogenase) type promoter, G3P (glyceraldehyde 3-phosphate dehydrogenase) type promoter, ICL1 (isocitrate lyase) type promoter, AOX1 (alcohol oxidase 1) type promoter, TEF (transcription elongation factor EF-1a) type promoter, GAL1 (galactokinase) type promoter, GAL1 (galactokinase gene) type promoter, Trp1 (tryptophan operon) promoter or its derivative promoters.

[0028] In some embodiments, the first promoter is the ADH1 promoter.

[0029] In some embodiments, the second promoter is a truncated ADH1 promoter.

[0030] In some embodiments, the first gene operon includes a first operator and a promoter of the first operator, and the second gene operon includes the first operator and a promoter of the second operator.

[0031] In some embodiments, the first operator gene and the second operator gene are both selected from LEU2, TRP1 or HIS. The first operator gene is a LEU gene, and its promoter is selected from a LEU2 promoter (LEU2 promoter). The second operator gene is selected from a TRP gene, and its promoter is selected from a TRP1 promoter (TRP1 promoter).

[0032] In some embodiments, the second sequence further includes: a resistance gene expression cassette located between the second promoter and the yeast 2U replication initiation region, the transcription direction of the resistance gene expression cassette being the same as the second multiple cloning site; an f1 initiation region connected between the transcription end point of the resistance gene cassette and the second promoter; and a resistance gene connected to the transcription start end of the yeast 2U replication initiation region.

[0033] In some embodiments, the resistance gene is selected from one of the genes encoding ampicillin, tetracycline, chloramphenicol, streptomycin, hygromycin, spectinomycin, kanamycin, blasticidin, geneticin, hygromycin B, mycophenolic acid, puromycin, zeocin or neomycin.

[0034] In some embodiments, Figure 1 As shown, the first sequence of the yeast dual expression vector includes a first multiple cloning site (MCS1, SEQ ID NO: 10), a T7 promoter (T7 RNA Polymerase Promoter, SEQ ID NO: 9), a coding region of a GAL4 activation domain (GAL4 activation domain, SEQ ID NO: 8), an ADH1 promoter (ADH1 Promoter, SEQ ID NO: 7), a LEU2 operator (including LEU2 promoter and LEU2 gene, SEQ ID NO: 6) and pUCorigin (SEQ ID NO: 5) connected in sequence. The second sequence of the yeast dual expression vector includes a sequentially connected second multiple cloning site (MCS2, SEQ ID NO: 12), a T7 promoter (T7 RNA Polymerase Promoter, SEQ ID NO: 9), a coding region of a GAL4 binding domain (GAL4 DNA binding domain, SEQ ID NO: 13), a Truncated ADH1 Promoter (SEQ ID NO: 14), a f1 origin (SEQ ID NO: 1), a TRP1 operon (including a TRP1 gene and a TRP1 promoter, SEQ ID NO: 2), a yeast 2U replication origin (Yeast 2U replication origin, SEQ ID NO: 3) and a kanamycin resistance gene (Kanamycin resistance gene, SEQ ID NO: 4).

[0035] like Figure 1The nucleotide sequence of the yeast dual expression vector in is arranged in sequence with f1origin shown in SEQ ID NO.1 as the starting nucleotide sequence, through TRP1 operator shown in SEQ ID NO:2, Yeast2Ureplicationorigin shown in SEQ ID NO:3, Kanamycinresistancegene shown in SEQ ID NO:4, pUCorigin shown in SEQ ID NO:5, LEU2 operator shown in SEQ ID NO:6, ADH1Promoter shown in SEQ ID NO:7, GAL4activationdomain shown in SEQ ID NO:8, T7 promoter shown in SEQ ID NO:9, MCS1 shown in SEQ ID NO:10, termination region shown in SEQ ID NO:11, MCS2 shown in SEQ ID NO:12, GAL4DNAbindingdomain shown in SEQ ID NO:13, and TruncatedADH1Promoter shown in SEQ ID NO:14, and the nucleotide sequences shown in the sequence table are all forward chain sequences in this order.

[0036] like Figure 1 As shown in , the directions in which the sequences in each region of the yeast dual expression vector are transcribed are shown by the arrows.

[0037] like Figure 1 As shown in , the yeast dual expression vector further has a sequence as shown in SEQ ID NO: 15 between Kanamycin resistance gene and the pUCorigin, and a sequence as shown in SEQ ID NO: 16 between the LEU2 operon and the ADH1 promoter.

[0038] Construction of yeast dual expression vector

[0039] Some embodiments provide a method for constructing a yeast dual expression vector, which comprises: obtaining a basic vector consisting of the first sequence and the second sequence by seamless cloning; synthesizing the termination region; and inserting the termination region between the transcription end point of the first multiple cloning site and the transcription end point of the second multiple cloning site.

[0040] In some embodiments, the construction of the basic vector includes: synthesizing a first fragment, the first fragment includes the first multiple cloning site, the coding region of the GAL4 activation domain and the first promoter; synthesizing a second sequence, the second sequence includes a first gene operon; synthesizing a third fragment, the third fragment includes a basic vector initiation region and a first yeast 2U replication initiation region; synthesizing a fourth fragment, the fourth fragment includes a second yeast 2U replication initiation region, the second gene operon, the second promoter, and a coding region of the GAL4 binding domain; homologously recombine the first fragment, the second fragment, the third fragment and the fourth fragment; transforming the homologous recombination product into Escherichia coli, screening positive colonies, and extracting and recovering the basic vector from the culture of the positive colonies.

[0041] In some embodiments, the step of synthesizing the first fragment includes: using pGADT7 (Coollebo Company) as a template, F1 (SEQ ID NO: 17) and R1 (SEQ ID NO: 18) as a primer pair, performing high-fidelity enzyme PCR amplification, performing gel electrophoresis and recovering the amplified product to obtain the first fragment (SEQ ID NO: 19).

[0042] In some embodiments, the step of synthesizing the second fragment includes: using pGADT7 as a template and F2 (SEQ ID NO: 20) and R2 (SEQ ID NO: 21) as a primer pair, performing high-fidelity enzyme PCR amplification, performing gel electrophoresis and recovering the amplified product to obtain the second fragment (SEQ ID NO: 22).

[0043] In some embodiments, the step of synthesizing the third fragment includes: using pGBKT7 (Coollebo Company) as a template, F3 (SEQ ID NO: 23) and R3 (SEQ ID NO: 24) as a primer pair, performing high-fidelity enzyme PCR amplification, performing gel electrophoresis and recovering the amplified product to obtain the third fragment (SEQ ID NO: 25).

[0044] In some embodiments, the step of synthesizing the fourth fragment includes: using pGBKT7 as a template, F4 (SEQ ID NO: 26) and R4 (SEQ ID NO: 27) as a primer pair, performing high-fidelity enzyme PCR amplification, performing gel electrophoresis and recovering the amplified product to obtain the fourth fragment (SEQ ID NO: 28).

[0045] Among them, PCR amplification used Novazonics' 2×Phanta Max Master Mix high-fidelity enzyme and kit instructions, please refer to the official website manual https: / / www.vazyme.com / product / 120.htmL to recover and purify the PCR product. This experiment used Novazonics' FastPure Gel DNA Extraction Mini Kit purification kit, please refer to the official website manual https: / / www.vazyme.com / companyfile / 2149.htmL.

[0046] In some embodiments, the step of homologously recombinating the first fragment, the second fragment, the third fragment and the fourth fragment includes: taking 40 ng of the first fragment, 36 ng of the second fragment, 70 ng of the third fragment, and 66 ng of the fourth fragment, 10 μL of 2×CE Mix (from Norvegian ClonExpress μLtra One Step Cloning Kit V2), and controlling the final reaction system to a total volume of 20 μL; performing the recombination reaction at 50°C for 30 min; reducing the temperature to 4°C or immediately cooling on ice; then performing a traditional Escherichia coli transformation experiment to obtain positive clones; expanding the positive clone bacterial solution and extracting the plasmid; and detecting the successfully constructed basic vector.

[0047] In some embodiments, the termination region is synthesized using known methods.

[0048] In some embodiments, the termination region is cloned into the yeast dual expression vector using two restriction endonuclease sites in both the first cloning site and the second cloning site for enzyme ligation.

[0049] Construction of interaction plasmid library and interaction

[0050] In some embodiments, the first cDNA library (used as AD library) and the second cDNA library (used as BD library) are simultaneously inserted into the yeast dual expression vector provided in the examples to construct a plasmid library carrying both the first cDNA and the second cDNA. These steps specifically include:

[0051] 1. Extraction of total RNA

[0052] The total RNA of maize SAM tissue was extracted by Trizol method.

[0053] 2. Reverse recording to obtain AD library and BD library

[0054] This step includes reverse transcribing the extracted total RNA to obtain the first-chain cDNA, and then amplifying the first-chain cDNA by PCR to obtain a cDNA library.

[0055] In some embodiments, the purified total RNA (0.2-4.0 μg), 1.0 μL CDS primer, 1.0 μL dNTP and the remaining deionized water are prepared into a 7.5 μL solution, incubated at 65°C for 5 min, and then ice-bathed for 2-3 min to obtain a reverse transcribed sample solution. Then, 7.88 μL of the sample solution, 1.0 μL SuperScript IV reverse transcriptase (2000 U / μL), 1.0 μL RNase inhibitor (40 U / μL), 4.0 μL SuperScript IV first-strand buffer (5×), 1 μL DTT (100 mM), 4 μL betaine (5 M), 0.12 μL MgCl2 (1 M) and 1 μL TSO primer (10 μM) are used to form a reverse transcription mixture, and the first-strand cDNA is obtained at 55°C for 10 min and 80°C for 10 min.

[0056] In some embodiments, 1.0-5.0 μL of first-chain cDNA, 1.0 μL of AD-F, 1.0 μL of AD-R, 25 μL of KAPA hot start HiFi high-fidelity enzyme premix (Roche, KK2602) and the remaining amount of deionized water, a total of 50 μL of PCR reaction system, PCR reaction, PCR product electrophoresis detection, according to the brightness of the band and the size distribution, the optimal number of cycles is selected, and PCR amplification is performed to obtain 200 μL of cDNA library product. The PCR reaction procedure includes: 95°C 3min reaction for 1 cycle; 98°C 20s, 62-67°C 15s and 72°C 3min, a total of 11, 13, 15, 17 or 19 cycles, wherein annealing stability is determined according to the primer; 72°C 5min reaction for 1 cycle; 4°C 1min reaction for 1 cycle.

[0057] In some embodiments, 1.0-5.0 μL of first-chain cDNA, 1.0 μL of BD-F, 1.0 μL of BD-R, 25 μL of KAPA hot start HiFi high-fidelity enzyme premix (Roche, KK2602) and the remaining amount of deionized water, a total of 50 μL of PCR reaction system, PCR reaction, PCR product electrophoresis detection, according to the brightness of the band and the size distribution, the optimal number of cycles is selected, and PCR amplification is performed to obtain 200 μL of cDNA library product. The PCR reaction procedure includes: 95°C 3min reaction for 1 cycle; 98°C 20s, 62-67°C 15s and 72°C 3min, a total of 11, 13, 15, 17 or 19 cycles, wherein annealing stability is determined according to the primer; 72°C 5min reaction for 1 cycle; 4°C 1min reaction for 1 cycle.

[0058] Table 1 shows the primers involved, wherein r represents ribonucleotide, N is A, C, G or T, and V is A, G or C. "AD" means used for synthesizing AD library, and "BD" means used for synthesizing BD library.

[0059] Table 1 Primers

[0060] Primer name Sequence (5'→3') CDS Primer (AD) GgtcgccgtatcattacgACtcatTTTTTTTTTTTTTTTTTTTTTTTTTTTVN,SEQ ID NO:29 CDS Primer (BD) gccgtcttctgcttgtctacgattcatTTTTTTTTTTTTTTTTTTTTTTTTTTTVN,SEQ ID NO:30 TSO(AD) gtaccagattacgct / rG / / rG / / rG / ,SEQ ID NO:31 TSO(BD) tcagaggaggacctg / rG / / rG / / rG / ,SEQ ID NO:32 AD-F tacgacgtaccagattacgct,SEQ ID NO:33 AD-R tcggtggtcgccgtatcatt,SEQ ID NO:34 BD-F tcggtggtcgccgtatcatt,SEQ ID NO:35 BD-R cgtatgccgtcttctgcttg,SEQ ID NO:36

[0061] In some embodiments, the obtained cDNA library products were purified using KAPA purification magnetic beads (Roche, KK8000), and sorted in three groups of ratio ranges of 0.4 (>2000 bp), 0.4-0.5 (2000 bp~1000 bp), and 0.5-0.6 times the product volume to obtain AD library and BD library respectively. The obtained AD library and BD library were subjected to electrophoresis detection, such as Figure 2 As shown, both showed good diffuse bands, indicating that the obtained AD library and BD library fragments were highly homogenized.

[0062] 3. Construction of interaction plasmid library

[0063] The embodiment provides the steps of constructing an interactive plasmid library, including obtaining a linearized yeast dual expression vector fragment, performing a multi-fragment recombination reaction with the sequence shown in SEQ ID NO: 11, the AD library and the BD library, transforming the obtained recombinant fragment into Escherichia coli, screening positive clones, and extracting the interactive plasmid library from the culture of the positive clones. What primers are used for colony PCR detection? This embodiment provides relative Figure 1 The vector lacks the plasmid of the termination region shown in SEQ ID NO: 11 (named as pGAB-DualDrive-IF-1) and Figure 1 The vector shown (named pGAB-DualDrive-IF-2) was used as the basic plasmid for preparing the interactive plasmid library.

[0064] Among them, the step of obtaining the linearized yeast dual expression vector fragment includes: transforming pGAB-DualDrive-IF-1 or pGAB-DualDrive-IF-2 into Escherichia coli, inverting and culturing in a 37°C incubator for one day, inoculating the monoclonal strain into LB medium containing kanamycin and culturing for 12 to 16 hours, and extracting using the PlasmidDNAMiniKit1 kit produced by Omega Bio-tek to obtain a large amount of yeast dual expression vector (concentration>100ng / μL). 5μg of yeast dual expression vector (pGAB-DualDrive-IF-1), 5μLBamHI-HF, 5μLNdeⅠ, 10μL10×cutsmart buffer and 85μL deionized water are prepared into a reaction system, incubated at 30°C for 4h for double enzyme digestion, and the enzyme digestion products are detected by electrophoresis, and the enzyme digestion products are purified using the CyclePureKit purification kit (OmegaBio-tek) to obtain the linearized yeast dual expression vector (pGAB-DualDrive-IF-1). Figure 4 and Figure 6 As shown, the linearized products of pGAB-DualDrive-IF-1 and pGAB-DualDrive-IF-2 were detected by electrophoresis and both showed a single band, indicating that the linearized fragments of pGAB-DualDrive-IF-1 and pGAB-Dual Drive-IF-2 were obtained.

[0065] Among them, the multi-fragment recombination reaction system contains 30-60 μg (1 μL) AD library, 30-60 μg (1 μL) BD library product, 10 μg (1 μL) sequence shown in SEQ ID NO: 11, 200 μg (1-2 μL) linearized yeast dual expression vector (pGAB-Dual Drive-IF-1), 5 μL 2×CE Mix and the rest deionized water in 10 μL. The multi-fragment recombination reaction conditions include 50°C reaction for 30 min and then dropping to 4°C.

[0066] Each plasmid in the interaction plasmid library obtained in the embodiment carries two cDNA fragments, one for the AD interaction element and the other for the BD interaction element, so as to perform interaction detection in yeast. Figure 5 As shown, the obtained transformants were used to transform 30 plates, 96 single clones were randomly selected, and 72 single clones were able to amplify bands of different sizes, preliminarily indicating that each plasmid in the interactive plasmid library carried both AD sequences and BD sequences.

[0067] In some comparative examples, the yeast dual expression vector (pGAB-DualDrive-IF-2) was double-digested with BspdⅠ and SacⅠ in the same manner to obtain linearized pGAB-Dual Drive-IF-2. 200μg (1-2μL) of linearized pGAB-Dual Drive-IF-2, 60μg (1μL) of BD library product, 5μL of 2×CE Mix and the remaining amount of deionized water, a total of 10μL of multi-fragment recombination reaction system, were transformed into Escherichia coli in the same manner as in the above embodiment, and positive clones were screened. The self-activation plasmid library was extracted from the culture of the positive clones. Each plasmid in the obtained self-activation plasmid library carries only a cDNA fragment, which is a BD action element. By comparing with the same embodiment, the genes that can be self-activated in the cDNA library are discovered. Figure 7 Growth is shown 16 hours after transformation of 6 plates from activated transformants.

[0068] 4. cDNA library interaction test

[0069] The method for cDNA library interaction test includes: preparing competent yeast Y2HGold; transferring the interaction plasmid library and the self-activation plasmid library obtained in the above embodiment into the competent Y2HGold; coating the transformants on the four-deficiency screening medium SD / -Leu / -Trp / -Ade / -His, and detecting positive colonies by colony PCR; extracting cDNA plasmids and self-activation plasmids from positive colonies; performing PCR amplification on the interaction plasmid library and the self-activation plasmid library; and constructing libraries for sequencing of PCR amplification products.

[0070] In some embodiments, the steps of preparing competent yeast Y2HGol include:

[0071] 1) Yeast Y2HGold strain (Weidi Biotechnology: CAT#: YC1002) was streaked on a YPDA solid plate (Coolaber, PM2011-500g + agar, CA1331-500g), and a fresh single colony was picked and transferred to 5 mL YPDA liquid culture medium (in a 50 mL centrifuge tube) and shaken at 30°C and 250 rpm for 12 h. Then 50 μL of the bacterial solution was inoculated into 50 mL YPDA liquid culture medium (in a 250 mL conical flask) and shaken at 250 rpm until OD600 was about 0.15-0.3 (16-20 h).

[0072] 2) Collect the bacterial liquid, centrifuge at 700g for 5 min to collect the bacteria, discard the supernatant, resuspend in 100 mL YPDA liquid culture medium, and shake at 30°C and 250 rpm until OD600 = 0.4-0.5.

[0073] 3) Collect the bacterial liquid, centrifuge at 700g for 5 min to collect the cells, discard the supernatant, and resuspend in 50mL of sterile ddH2O.

[0074] 4) Collect the bacterial liquid, centrifuge at 700g for 5 min to collect the cells, discard the supernatant, and resuspend in 15 mL of 1.1XTE / liAC (Weidi Biotechnology: YC4210L) pre-cooled at 4°C.

[0075] 5) Collect the bacterial solution, centrifuge at 1500g for 30 seconds, discard the supernatant, and resuspend in 0.6mL 1.1XTE / liAC to obtain the solution of competent yeast Y2HGol.

[0076] In some embodiments, the step of transferring the interaction plasmid library and the self-activation plasmid library obtained in the above embodiments into the competent Y2HGold comprises:

[0077] 1) Place 10 mg / mL salmon sperm DNA (Clarmar) in a pH 7.0 phosphate buffer at 95°C for 3 min, then place on ice for 3 min;

[0078] 2) Take 5-15 μg of the above-obtained interaction plasmid library or self-activation plasmid library, mix with 40 μL salmon sperm DNA solution, 600 μL yeast competent medium and 2.5 mL PEG / LiAc (Weidi Biotechnology: YC5001M), incubate in a 30°C water bath for 45 min, and mix by flipping 6-8 times every 15 min;

[0079] 3) Add 160 μL sterile DMSO (Weidi Biotechnology: YC6020S);

[0080] 4) Incubate in a 42°C water bath for 20 min, invert 6-8 times every 10 min to mix thoroughly;

[0081] 5) Centrifuge at 4000 rpm for 40 seconds, discard the supernatant, add 2×YPDA or YPD Plus (Weidi Biotechnology: YC6006S) and resuspend in 3 mL;

[0082] 6) After shaking at 30°C and 200 rpm for 1.5 h, centrifuge for 30 s and discard the supernatant;

[0083] 7) The collected bacteria were resuspended in 18 mL of 0.9% NaCl, 300 μL of the resuspended bacterial solution was plated, and cultured at 30°C for 48-72 h;

[0084] 8) Take 300 μL of bacterial solution, 300 μL of 10-fold diluted bacterial solution (diluted with double distilled water), and 300 μL of 100-fold diluted bacterial solution (diluted with double distilled water), and spread them on two-deficient plates SD / -Leu-Trp to test the transformation efficiency. In addition, take 300 μL of transformant bacterial solution of the interaction plasmid library and 300 μL of transformant bacterial solution of the self-activation plasmid library on four-deficient plates SD / -Leu / -Trp / -Ade / -His to screen the interaction genes in the cDNA library and the genes that can be self-activated in the cDNA library. Figure 8 The graph shows the growth of 40 plates containing four deficient recombinants of the interactive plasmid library for 3 days. Fig. 9 The growth status of eight four-deficient plates of recombinant transformants from the self-activated plasmid library after 3 days is shown.

[0085] In some embodiments, the step of detecting positive colonies by colony PCR comprises:

[0086] 1) TaKaRa

[9164] Rapid DNA preparation of bacteria, fungi and other microorganisms Lysis solution The transformants obtained in the above examples were lysed to prepare a lysis solution;

[0087] 2) The lysate was heat denatured at 80° C. for 15 min, centrifuged at low speed, 1 to 5 μL of the supernatant template was taken, PCR was performed using CX-Primer-F (SEQ ID NO: 37) and CX-Primer-R (SEQ ID NO: 38) as primer pairs, and the PCR products were detected by electrophoresis using 1% agarose gel, and positive colonies were determined based on the electrophoresis bands.

[0088] In some embodiments, the step of extracting cDNA plasmids and self-activating plasmids from positive colonies comprises:

[0089] 1) Collect positive colonies on the four-deficiency interaction screening plate cultured for 2 to 4 days or the self-activation plate cultured for 6 to 7 days, centrifuge the resulting yeast solution at 12,000 rpm for 1 min at room temperature, discard the supernatant, and the precipitate is the collected bacteria.

[0090] 2) Resuspend the collected bacteria in 37°C lysis solution (classic yeast plasmid extraction kit (containing lytic enzyme), PE054, Coolbo; the kit includes package A and package B, package A is the enzyme solution, package B includes solution I, solution II, solution III, solution IV, eluent matrix plasmid adsorption column), incubate on a 37°C shaker (200-250rpm) for 1-2h, centrifuge the obtained enzyme solution at 12000rpm at room temperature for 1min, discard the supernatant, and the obtained precipitate is the lysed bacteria.

[0091] 3) Preheat Solution II and Solution III in a 40°C water bath until the precipitate is completely dissolved, and let stand at room temperature for later use.

[0092] 4) Add 180 μL of Solution I to the bacterial pellet and mix by pipetting or vortexing.

[0093] 5) Add 180 μL of solution II, mix thoroughly by inverting 6-8 times, and let stand at room temperature for 5 min.

[0094] 6) Add 440 μL of Solution III and immediately mix by inverting the tube.

[0095] 7) Centrifuge at 12000rpm for 10min at room temperature. Carefully pipette the supernatant into the adsorption column, let stand at room temperature for 2min, centrifuge at 1,2000rpm for 1min at room temperature, and discard the penetration solution. Note: There may be white suspended matter after centrifugation, just take the supernatant and avoid it. A small amount of suspended matter will not affect the extraction results.

[0096] 8) Add 500 μL of washing solution IV to the adsorption column, centrifuge at 12000 rpm for 1 min at room temperature, and discard the flow-through solution.

[0097] 9) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 2 min at room temperature.

[0098] 10) Transfer the adsorption column to a new 1.5 mL centrifuge tube, add 30-50 μL of eluent (preheated at 65-70°C) to the center of the adsorption column, let stand at room temperature for 2 minutes, and centrifuge at 1,2000 rpm for 1 minute at room temperature.

[0099] 11) The permeate is the obtained interaction plasmid library or self-activation plasmid library, which is subjected to PCR through a detection step such as colony PCR, and the amplified product is detected by electrophoresis. If a single bright band without dragging appears, it indicates that the extracted interaction plasmid library or self-activation plasmid library is intact and not degraded.

[0100] In some embodiments, in order to improve the detection accuracy of the plasmids in the extracted interaction plasmid library or activation plasmid library, the extracted plasmid library containing the plasmids is also PCR amplified, and the amplified products are sequenced and verified. Specifically, it includes:

[0101] 1) The penetration solution containing the interaction plasmid library or the self-activation plasmid library obtained above is formulated into an amplification system as shown in Table 2, and PCR amplification is performed according to the procedure shown in Table 3; the test products of the cDNA library interaction and the self-activation test products in the cDNA library can be sorted by adding different combinations of barcodes, for example, different barcode combination types can be added during amplification, mixed and sequenced (third-generation sequencing) and finally sorted and analyzed through sequencing data. For example, the embodiment provides 5 groups of primers containing barcodes to produce 25 combination types. Among them, AD+BD is used in combination, for example: AD-barcode1+BD-barcode2 is used to amplify the interaction experiment product; AD-barcode1+BD-barcode3 is used to amplify the self-activation product. Fig.10 As shown, the quality of the amplified product is good.

[0102] AD-barcode1: GCGCTCTGTGTGCAGCcatacgacgtaccagattacg, SEQ ID NO:39

[0103] AD-barcode2: TCATGAGTCGACACTAcatacgacgtaccagattacg, SEQ ID NO:40

[0104] AD-barcode3: TATCTATCGTATACGCcatacgacgtaccagattacg, SEQ ID NO:41

[0105] AD-barcode4: ATCACACTGCATCTGAcatacgacgtaccagattacg, SEQ ID NO:42

[0106] AD-barcode5:ACGTACGCTCGTCATAcatacgacgtaccagattacg,SEQ ID NO:43

[0107] BD-barcode1: GCGCTCTGTGTGCAGCcatcatggaggagcagaagct, SEQ ID NO:44

[0108] BD-barcode2: TCATGAGTCGACACTAcatcatggaggagcagaagct, SEQ ID NO: 45

[0109] BD-barcode3: TATCTATCGTATACGCcatcatggaggagcagaagct, SEQ ID NO:46

[0110] BD-barcode4: ATCACACTGCATCTGAcatcatggaggagcagaagct, SEQ ID NO:47

[0111] BD-barcode5: ACGTACGCTCGTCATAcatcatggaggagcagaagct, SEQ ID NO:48

[0112] 2) 5 μL of product was taken out from the 13th, 15th and 17th cycles of PCR amplification and loaded into 1.5% agarose Goldenview gel in 1X TAE buffer together with 0.1 μg 5-kb DNA size marker for comparison to determine the optimal cycle number. The amplified product was purified using the KAPAPure Beads kit and the purified 500 bp product was sequenced.

[0113] Table 2 PCR reaction system

[0114] Element Dosage Plasmid library extracted from yeast cells 5.0μL(150ng) <![CDATA[DeionizedH2O]]> 18μL AD-barcode-N 1.0μL BD-barcode-N 1.0μL KAPAHiFiHotStartReadyMix 25μL Total 50μL

[0115] Table 3 PCR reaction program

[0116] Number of cycles program 1 95℃3min 18 / 20 / 22 98℃20s; 67℃15s; 72℃5min 1 72℃5min 1 4℃1min

[0117] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A method for constructing an interaction plasmid library, comprising: obtaining a yeast two-hybrid vector having a first multiple cloning site and a second multiple cloning site; obtaining a first cDNA library and a second cDNA library; Obtain linearized yeast two-hybrid vector; as well as Inserting the first cDNA library and the second cDNA library into the first multiple cloning site and the second multiple cloning site of the linearized yeast two-hybrid vector respectively; Wherein, the yeast two-hybrid vector further comprises: A first sequence, wherein the first sequence includes the first multiple cloning site, the coding region of the GAL4 activation domain, the first promoter, the first operator and the basic vector initiation region connected in sequence, the first promoter, the coding region of the GAL4 activation domain and the first multiple cloning site have the same transcription direction, and the first promoter is used to promote the expression of the coding region of the GAL4 activation domain and / or the expression of the first cDNA library inserted into the first multiple cloning site; as well as a second sequence, wherein the second sequence comprises the second multiple cloning site, the coding region of the GAL4 binding domain, the second promoter, the second operator and the yeast 2U replication origin region connected in sequence, the second multiple cloning site, the coding region of the GAL4 binding domain, the second promoter, the second operator and the yeast 2U replication origin region have the same transcription direction, and the second promoter is used to promote the expression of the coding region of the GAL4 binding domain and / or the expression of the second cDNA library inserted into the second cloning site; The first sequence and the second sequence are connected to form a circular DNA molecule, and the transcription direction of the first sequence is opposite to the transcription direction of the second sequence.

2. According to the construction method of claim 1, the yeast dual expression vector further comprises a termination region, and the termination region is located between the transcription terminal of the first sequence and the transcription terminal of the second sequence.

3. The construction method according to claim 2, wherein the termination region is shown in SEQ ID NO:

11.

4. The construction method according to claim 1, wherein the first cloning site and the second cloning site each have at least two restriction endonuclease sites.

5. The construction method according to claim 1, wherein the yeast dual expression vector further has two T7 promoters inserted between the first multiple cloning site and the coding region of the GAL4 activation domain and between the second multiple cloning site and the coding region of the GAL4 binding domain, respectively.

6. The construction method according to claim 1, wherein the coding region of the GAL4 activation domain is shown as SEQ ID NO:8, and the coding region of the GAL4 binding domain is shown as SEQ ID NO:

13.

7. The construction method according to claim 1, wherein the first promoter and the second promoter are promoters suitable for yeast; Optionally, the first promoter and the second promoter are both selected from: GK (phosphoglycerol kinase) type promoter, GAP (3-phosphoglyceraldehyde dehydrogenase) type promoter, ADH (alcohol dehydrogenase) type promoter, G3P (glyceraldehyde 3-phosphate dehydrogenase) type promoter, ICL1 (isocitrate lyase) type promoter, AOX1 (alcohol oxidase 1) type promoter, TEF (transcription elongation factor EF-1a) type promoter, GAL1 (galactokinase) type promoter, or GAL1 (galactokinase gene) type promoter, or TRP1 (tryptophan operon) promoter; Optionally, the first promoter is ADH1 promoter, and its nucleotide sequence is shown in SEQ ID NO:7; Optionally, the second promoter is a truncated ADH1 promoter, and its nucleotide sequence is shown in SEQ ID NO:

14.

8. The construction method according to claim 1, wherein the first operon comprises a first operator gene and a promoter of the first operator gene, and the second operon comprises a first operator gene and a promoter of the second operator gene; Optionally, the first operator gene and the second operator gene are both selected from LEU2, TRP1 or HIS.

9. The construction method according to claim 1, wherein the basic vector origin region is shown as SEQ ID NO: 5, and the yeast 2U replication origin region is shown as SEQ ID NO:

3.

10. The construction method according to any one of claims 1 to 9, wherein the second sequence further comprises: a resistance gene located at the transcription start end of the second sequence; as well as The f1 initiation region is connected between the transcription end point of the second operon and the second promoter, and the f1 initiation region is shown in SEQ ID NO:

1.

11. The construction method according to claim 10, wherein the resistance gene is selected from one of the resistance encoding genes of ampicillin, tetracycline, chloramphenicol, streptomycin, hygromycin, spectinomycin, kanamycin, blasticidin, geneticin, hygromycin B, mycophenolic acid, puromycin, zeocin or neomycin. 12 . The construction method according to claim 1 , wherein the step of obtaining a linearized yeast two-hybrid vector comprises digesting the yeast two-hybrid vector with BamHI-HF and NdeI.

13. The construction method according to any one of claims 1 to 11, wherein the step of inserting the first cDNA library and the second cDNA library into the first multiple cloning site and the second multiple cloning site of the linearized yeast two-hybrid vector, respectively, comprises: Performing a multiplex PCR reaction on the first cDNA library, the second cDNA library, the sequence shown in SEQ ID NO: 11, and the linearized yeast two-hybrid vector; Transforming the products of the multiplex PCR reaction into Escherichia coli and screening positive colonies; and The interactive plasmid library is extracted from the positive colonies.

14. A method for identifying interactions of a cDNA library, comprising: The interactive plasmid library obtained by the construction method according to any one of claims 1 to 13; Transforming the interaction plasmid library into yeast to obtain recombinant yeast; Whether the first cDNA library and the second cDNA library interact with each other is determined according to the growth state of the recombinant yeast on the selection medium. The identification method according to claim 14 , wherein the yeast is a Y2H type yeast.

16. The identification method according to claim 14, wherein the selection medium is selected from SD / -Leu / -Trp and / or SD / -Leu / -Trp / -His / -Ade.

17. Use of the interaction plasmid library obtained by the construction method according to any one of claims 1 to 13 in protein interactions of the interaction plasmid library.

Images