Application of mutations of Ndufa10 gene and S1pr4 gene in diagnosis, prediction and treatment of myopathy

Abstract

According to the invention, the correlation between Ndufa10 gene and / or S1pr4 gene mutation and muscular dystrophy morbidity is discovered. The invention provides an application of mutations of a Ndufa10 gene and an S1pr4 gene in diagnosis and prediction of myopathy. The invention further provides a muscular dystrophy animal model induced by single mutation and double mutation of the NDufa10 gene and the S1pr4 gene and a modeling method. The invention has application prospects in muscular dystrophy disease diagnosis and therapeutic drug screening.

Description

Technical Field

[0001] The present invention relates to the field of disease diagnosis, and in particular to the use of Ndufa10 gene and S1pr4 gene mutations in myopathy diagnosis and prediction. Background Art

[0002] Muscular dystrophy is a progressive muscle disease caused by genetic mutations, characterized by chronic oxidative stress and inflammation. It manifests clinically as progressive muscle weakness that affects the limbs, throat, and facial muscles to varying degrees. It can be divided into congenital muscular dystrophy and late-onset muscular dystrophy according to the time of onset. Generally speaking, congenital muscular dystrophy has obvious symptoms of muscle weakness at birth or in the first few months after birth. Late-onset muscular dystrophy, on the other hand, shows symptoms of muscle weakness only after the patient achieves independent walking.

[0003] Currently, there is still a lack of means for early diagnosis or prediction of muscular dystrophy from the genetic variation level in this field. Therefore, the field needs to develop new targets for diagnosis and prediction of muscular dystrophy. Summary of the invention

[0004] The purpose of the present invention is to provide new targets for diagnosis and prediction of muscular dystrophy.

[0005] The present invention provides the use of Ndufa10 gene and / or S1pr4 gene mutation in the diagnosis and prediction of myopathy.

[0006] The present invention also provides myopathy animal models with single mutation and double mutation of Ndufa10 gene and S1pr4 gene.

[0007] In a first aspect of the present invention, there is provided a use of a reagent combination in the preparation of a kit for diagnosing and / or predicting myopathy, wherein the reagent combination comprises a detection reagent for one or more mutant genes or proteins encoded thereof selected from the following group:

[0008] AXDND1:NM_144696, MST1L:NM_001271733, COL6A3:NM_004369, Ndufa10:NM_004544, SNTG2:NM_018968, CCDC191:NM_0208 17. COL6A6:NM_001102608, CMTR1:NM_015050, CRISP2:NM_001142435, GTF2H4:NM_001517, RIMS1:NM_001168410, VARS2:NM _020442, ABHD17B:NM_016014, LOC101928841:NM_001304433, CCDC155:NM_144688, NAPSA:NM_004851, PEG3:NM_006210, S1 pr4:NM_003775, SMIM17:NM_001193628, SRRM5:NM_001145641, ZNF473:NM_015428, ZNF57:NM_173480, ZNF845:NM_138374.

[0009] In another preferred embodiment, the reagent combination comprises

[0010] (a) a detection reagent for S1pr4 mutant protein or its encoding gene; and / or

[0011] (b) Detection reagents for Ndufa10 mutant protein or its encoding gene.

[0012] In another preferred embodiment, the myopathy is selected from the group consisting of idiopathic inflammatory myopathy, infectious myopathy, drug-induced myopathy, toxic myopathy, hereditary myopathy, or a combination thereof.

[0013] In another preferred embodiment, the myopathy is selected from the group consisting of Duchenne muscular dystrophy, Duchenne muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, distal muscular dystrophy, myotonic dystrophy, congenital muscular dystrophy, Emory muscular dystrophy, oculopharyngeal muscular dystrophy, or a combination thereof.

[0014] In another preferred embodiment, the myopathy is Duchenne muscular dystrophy.

[0015] In another preferred embodiment, the kit uses only S1pr4 or Ndufa10 mutant protein or its encoding gene as a marker for myopathy diagnosis and / or prediction.

[0016] In another preferred embodiment, the kit only uses S1pr4 and Ndufa10 mutant proteins or their encoding genes as markers for myopathy diagnosis and / or prediction.

[0017] In another preferred embodiment, compared with the wild-type S1pr4 protein, the arginine R at position 82 of the amino acid sequence of the S1pr4 mutant protein is mutated, for example, mutated to cysteine ​​C.

[0018] In another preferred embodiment, compared with the wild-type S1pr4 protein encoding gene, the 244th cytosine nucleotide C in the nucleic acid sequence of the S1pr4 mutant protein encoding gene undergoes a missense mutation, for example, mutates to a thymine nucleotide T.

[0019] In another preferred embodiment, the wild-type S1pr4 protein is a human wild-type S1pr4 protein.

[0020] In another preferred embodiment, the kit further comprises a polynucleotide molecule of a S1pr4 mutant protein or its encoding gene used as a positive control.

[0021] In another preferred embodiment, compared with the wild-type Ndufa10 protein, the arginine R at position 217 of the amino acid sequence of the Ndufa10 mutant protein is mutated, for example, mutated to tryptophan W.

[0022] In another preferred embodiment, compared with the wild-type Ndufa10 protein encoding gene, the 649th adenine nucleotide A in the nucleic acid sequence of the Ndufa10 mutant protein encoding gene undergoes a missense mutation, for example, mutates to a thymine nucleotide T.

[0023] In another preferred embodiment, the wild-type Ndufa10 protein is human wild-type Ndufa10 protein.

[0024] In another preferred embodiment, the kit further comprises a polynucleotide molecule of a Ndufa10 mutant protein or its encoding gene used as a positive control.

[0025] In another preferred embodiment, the mutant gene and protein are:

[0026] Ndufa10:NM_004544 / Missense:CGG=>TGG:R217W and / or

[0027] S1pr4:NM_003775 / Missense:CGC=>TGC:R79C.

[0028] In another preferred embodiment, the detection reagent is selected from the following group: antibodies, primers, probes, gRNA, sequencing libraries, nucleic acid chips (such as DNA chips), protein chips, or combinations thereof.

[0029] In another preferred embodiment, the detection includes detecting the genomic sequence, mRNA sequence, or cDNA sequence of the gene encoding the S1pr4 mutant protein and / or the Ndufa10 mutant protein.

[0030] In another preferred embodiment, in the detection kit, the detection reagents are primers, probes, nucleic acid chips, and gRNA for detecting the coding sequences of S1pr4 mutant protein and / or Ndufa10 mutant protein.

[0031] In another preferred embodiment, in the detection kit, the detection reagent is a specific antibody for detecting S1pr4 mutant protein and / or Ndufa10 mutant protein.

[0032] In another preferred embodiment, the kit contains one or more reagents selected from the following group:

[0033] (a) specific primers for S1pr4 gene and / or Ndufa10 gene, and optionally a specific probe;

[0034] (b) a chip for detecting mutation sites of the S1pr4 gene and / or Ndufa10 gene; and

[0035] (c) Specific antibodies for detecting S1pr4 mutant protein and / or Ndufa10 mutant protein.

[0036] In another preferred embodiment, the mutant protein includes a full-length mutant protein or a mutant protein fragment.

[0037] In another preferred embodiment, the antibody and / or probe is coupled to or carries a detectable label.

[0038] In another preferred embodiment, the detectable label is selected from the following group: a chromophore, a chemiluminescent group, a fluorophore, an isotope or an enzyme.

[0039] In another preferred embodiment, the reagent combination comprises a sequencing primer selected from the following group:

[0040] S1pr4 gene sequence primers (reverse sequencing):

[0041] 5'-CGTGAAGAGCAGACTGAAGGTGGAT-3' (SEQ ID NO: 8); and / or

[0042] Ndufa10 gene sequence primers (reverse sequencing):

[0043] 5'-CAAATCACTTTCATTTCCAAGCCAGA-3' (SEQ ID NO: 3).

[0044] In another preferred embodiment, the detection is performed on a sample selected from the following group: peripheral blood, tissue, cell, body fluid, or a combination thereof.

[0045] In another preferred embodiment, the sample is derived from mammals, more preferably from primates and humans.

[0046] In a second aspect of the present invention, a kit for diagnosing myopathy and / or predicting its susceptibility is provided, the kit comprising a detection reagent for one or more mutant genes or proteins encoded thereof selected from the following group:

[0047] AXDND1:NM_144696, MST1L:NM_001271733, COL6A3:NM_004369, Ndufa10:NM_004544, SNTG2:NM_018968, CCDC191:NM_0208 17. COL6A6:NM_001102608, CMTR1:NM_015050, CRISP2:NM_001142435, GTF2H4:NM_001517, RIMS1:NM_001168410, VARS2:NM _020442, ABHD17B:NM_016014, LOC101928841:NM_001304433, CCDC155:NM_144688, NAPSA:NM_004851, PEG3:NM_006210, S1 pr4:NM_003775, SMIM17:NM_001193628, SRRM5:NM_001145641, ZNF473:NM_015428, ZNF57:NM_173480, ZNF845:NM_138374.

[0048] In another preferred embodiment, the kit comprises:

[0049] (a) a detection reagent for S1pr4 mutant protein or its encoding gene; and / or

[0050] (b) a detection reagent for Ndufa10 mutant protein or its encoding gene;

[0051] and (c) labels or instructions;

[0052] Wherein, the components (a) and (b) are respectively located in one or more different containers or in the same container.

[0053] In another preferred embodiment, the component (a) can be used as a control substance or a reference substance.

[0054] In another preferred embodiment, the label or instructions indicate that the kit is used for:

[0055] (i) detecting myopathy and / or susceptibility thereto; and / or

[0056] (ii) Determine the subtype of myopathy.

[0057] In another preferred embodiment, the myopathy is selected from the group consisting of Duchenne muscular dystrophy, Duchenne muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, distal muscular dystrophy, myotonic dystrophy, congenital muscular dystrophy, Emory muscular dystrophy, oculopharyngeal muscular dystrophy, or a combination thereof.

[0058] In another preferred embodiment, the myopathy is Duchenne muscular dystrophy.

[0059] In another preferred embodiment, the kit uses only S1pr4 or Ndufa10 mutant protein or its encoding gene as a marker for myopathy diagnosis and / or prediction.

[0060] In another preferred embodiment, the kit only uses S1pr4 and Ndufa10 mutant proteins or their encoding genes as markers for myopathy diagnosis and / or prediction.

[0061] In another preferred embodiment, compared with the wild-type S1pr4 protein, the arginine R at position 82 of the amino acid sequence of the S1pr4 mutant protein is mutated, for example, mutated to cysteine ​​C.

[0062] In another preferred embodiment, compared with the wild-type S1pr4 protein encoding gene, the 244th cytosine nucleotide C in the nucleic acid sequence of the S1pr4 mutant protein encoding gene undergoes a missense mutation, for example, mutates to a thymine nucleotide T.

[0063] In another preferred embodiment, compared with the wild-type Ndufa10 protein, the arginine R at position 217 of the amino acid sequence of the Ndufa10 mutant protein is mutated, for example, mutated to tryptophan W.

[0064] In another preferred embodiment, compared with the wild-type Ndufa10 protein encoding gene, the 649th adenine nucleotide A in the nucleic acid sequence of the Ndufa10 mutant protein encoding gene undergoes a missense mutation, for example, mutates to a thymine nucleotide T.

[0065] In another preferred embodiment, the wild-type Ndufa10 protein is human wild-type Ndufa10 protein.

[0066] In another preferred embodiment, the kit comprises sequencing primers selected from the following group:

[0067] S1pr4 gene sequence primers (reverse sequencing):

[0068] 5'-CGTGAAGAGCAGACTGAAGGTGGAT-3' (SEQ ID NO: 8); and

[0069] Ndufa10 gene sequence primers (reverse sequencing):

[0070] 5'-CAAATCACTTTCATTTCCAAGCCAGA-3' (SEQ ID NO: 3).

[0071] In another preferred embodiment, the description contains the following contents:

[0072] If the subject carries the S1pr4 mutant gene and / or the Ndufa10 mutant gene, or expresses the S1pr4 mutant protein and / or the Ndufa10 mutant protein, it indicates that the subject suffers from the myopathy or has the risk of developing the myopathy.

[0073] In a third aspect of the present invention, a method for preparing a myopathy animal model of a non-human mammal is provided, the method comprising the following steps:

[0074] A non-human mammal with a S1pr4 gene mutation and a non-human mammal with a Ndufa10 gene mutation are hybridized, and heterozygous non-human mammals with double mutations in the S1pr4 gene and the Ndufa10 gene are obtained from the offspring, thereby obtaining the myopathy animal model.

[0075] In another preferred embodiment, the non-human mammal with S1pr4 gene mutation is obtained by the following steps:

[0076] (a1) providing non-human mammalian cells, and mutating the S1pr4 gene in the cells to obtain cells with S1pr4 gene mutation;

[0077] (b1) Using the cells with S1pr4 gene mutation obtained in step (a), preparing the non-human mammal myopathy animal model.

[0078] In another preferred embodiment, the S1pr4 gene mutation causes the encoded S1pr4 mutant protein to undergo a mutation at position 82 of the amino acid sequence of arginine R, for example, to cysteine ​​C, compared to the wild-type S1pr4 protein.

[0079] In another preferred embodiment, the S1pr4 gene mutation refers to a missense mutation of the 244th cytosine nucleotide C in its nucleic acid coding sequence, for example, a mutation to a thymine nucleotide T.

[0080] In another preferred embodiment, the step (a1) comprises treating the cells with the following reagents:

[0081] (i) a gene editing protein or an expression vector thereof, wherein the gene editing protein is selected from the group consisting of CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof; and

[0082] (ii) S1pr4 gene targeting gRNA or its expression vector;

[0083] (iii) a donor oligonucleotide comprising the mutated nucleotide and flanked by wild-type gene homologous sequences.

[0084] In another preferred example, the S1pr4 gene targeting gRNA targets one or more nucleic acid sequences selected from the following group: SEQ ID NO: 4, 5, 6.

[0085] In another preferred embodiment, the step (b1) further comprises screening non-human mammals to obtain an animal model of S1pr4 gene mutation.

[0086] In another preferred embodiment, the screening is performed using S1pr4 gene sequence sequencing primers, preferably the primers are shown in SEQ ID NO:8.

[0087] In another preferred embodiment, the non-human mammal with Ndufa10 gene mutation is obtained by the following steps:

[0088] (a2) providing non-human mammalian cells, and mutating the Ndufa10 gene in the cells to obtain cells with Ndufa10 gene mutation;

[0089] (b2) Using the cells with Ndufa10 gene mutation obtained in step (a), preparing the non-human mammal myopathy animal model.

[0090] In another preferred embodiment, the Ndufa10 gene mutation causes the Ndufa10 mutant protein it encodes to undergo a mutation in the arginine R at position 217 of the amino acid sequence, for example, to tryptophan W, compared to the wild-type Ndufa10 protein.

[0091] In another preferred embodiment, the Ndufa10 gene mutation refers to a missense mutation of the 649th adenine nucleotide A in its nucleic acid coding sequence, for example, a mutation to a thymine nucleotide T.

[0092] In another preferred embodiment, the step (a2) comprises treating the cells with the following reagents:

[0093] (i) a gene editing protein or an expression vector thereof, wherein the gene editing protein is selected from the group consisting of CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof; and

[0094] (ii) Ndufa10 gene targeting gRNA or its expression vector;

[0095] (iii) a donor oligonucleotide comprising the mutated nucleotide and flanked by wild-type gene homologous sequences.

[0096] In another preferred example, the Ndufa10 gene targeting gRNA targets one or more nucleic acid sequences selected from the following group: SEQ ID NO: 1, 2.

[0097] In another preferred embodiment, the step (b2) further comprises screening non-human mammals to obtain an animal model of Ndufa10 gene mutation.

[0098] In another preferred embodiment, the screening is performed using Ndufa10 gene sequence sequencing primers, preferably the primers are shown in SEQ ID NO:3.

[0099] In another preferred embodiment, the steps (a1) and / or (a2) further include introducing silent mutations to prevent the binding and re-cutting of the sequence by the gRNA after homology-directed repair.

[0100] In a fourth aspect of the present invention, a method for preparing a myopathy animal model of a non-human mammal is provided, wherein the method comprises the following steps:

[0101] (a) providing non-human mammalian cells, and mutating the S1pr4 gene and / or the Ndufa10 gene in the cells to obtain cells with mutations in the S1pr4 gene and / or the Ndufa10 gene;

[0102] (b) using the cells with S1pr4 gene and / or Ndufa10 gene mutation obtained in step (a) to prepare the non-human mammal myopathy animal model.

[0103] In another preferred embodiment, the cell is a somatic cell, a germ cell, a fertilized egg, or an embryonic stem cell.

[0104] In another preferred embodiment, the S1pr4 gene mutation causes the encoded S1pr4 mutant protein to undergo a mutation at position 82 of the amino acid sequence of arginine R, for example, to cysteine ​​C, compared to the wild-type S1pr4 protein.

[0105] In another preferred embodiment, the S1pr4 gene mutation refers to a missense mutation of the 244th cytosine nucleotide C in its nucleic acid coding sequence, for example, a mutation to a thymine nucleotide T.

[0106] In another preferred embodiment, the Ndufa10 gene mutation causes the Ndufa10 mutant protein it encodes to undergo a mutation in the arginine R at position 217 of the amino acid sequence, for example, to tryptophan W, compared to the wild-type Ndufa10 protein.

[0107] In another preferred embodiment, the Ndufa10 gene mutation refers to a missense mutation of the 649th adenine nucleotide A in its nucleic acid coding sequence, for example, a mutation to a thymine nucleotide T.

[0108] In another preferred embodiment, the step (a) is performed by a gene editing method, preferably a gene editing method mediated by a CRISPR / Cas system, such as a CRISPR / Cas9 system.

[0109] In another preferred embodiment, the step (a) comprises treating the cells with the following reagents:

[0110] (i) a gene editing protein or an expression vector thereof, wherein the gene editing protein is selected from the group consisting of CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof; and

[0111] (ii) S1pr4 gene targeting gRNA and Ndufa10 gene targeting gRNA, or their expression vectors;

[0112] (iii) a donor oligonucleotide comprising the mutated nucleotide and flanked by wild-type gene homologous sequences.

[0113] In another preferred example, the S1pr4 gene targeting gRNA targets one or more nucleic acid sequences selected from the following group: SEQ ID NO: 4, 5, 6.

[0114] In another preferred example, the Ndufa10 gene targeting gRNA targets one or more nucleic acid sequences selected from the following group: SEQ ID NO: 1, 2.

[0115] In another preferred embodiment, the step (a) further includes introducing a silent mutation to prevent the binding and re-cutting of the gRNA to the sequence after homology-directed repair.

[0116] In another preferred embodiment, the step (b) comprises the steps of:

[0117] (i) culturing the cell to develop into a mutant non-human mammal;

[0118] (ii) mating and breeding the mutant non-human mammal with a wild-type non-human mammal, and screening the offspring to obtain heterozygous non-human mammals with double mutations in the S1pr4 gene and / or the Ndufa10 gene, thereby obtaining the myopathy animal model.

[0119] In another preferred embodiment, the screening is performed using S1pr4 gene and / or Ndufa10 gene sequence sequencing primers.

[0120] In another preferred embodiment, the S1pr4 gene sequence sequencing primer is shown as SEQ ID NO:3.

[0121] In another preferred example, the sequencing primer of Ndufa10 gene sequence is shown as SEQ ID NO:8.

[0122] In another preferred embodiment, the step (b) further comprises the steps of:

[0123] (iii) mating and breeding the heterozygous non-human mammals, and screening the offspring to obtain homozygous non-human mammals with S1pr4 gene and / or Ndufa10 gene mutations, thereby obtaining the myopathy animal model.

[0124] In another preferred embodiment, both the heterozygous non-human mammal and the homozygous non-human mammal can reproduce normally.

[0125] In another preferred embodiment, the myopathy animal model has one or more characteristics selected from the following group compared with the wild-type control animal:

[0126] (a) Decreased grip strength;

[0127] (b) elevated creatine kinase levels;

[0128] (c) Muscle fibrosis.

[0129] In another preferred embodiment, the non-human mammal is a rodent or a primate, preferably including mice, rats, rabbits, and monkeys.

[0130] In another preferred embodiment, the myopathy is selected from the group consisting of Duchenne muscular dystrophy, Duchenne muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, distal muscular dystrophy, myotonic dystrophy, congenital muscular dystrophy, Emory muscular dystrophy, oculopharyngeal muscular dystrophy, or a combination thereof.

[0131] In a fifth aspect of the present invention, there is provided a method for screening or identifying a therapeutic agent for treating or alleviating myopathy, comprising the steps of:

[0132] (a) in a test group, applying a test compound to a myopathy animal model prepared by the method described in the third aspect or the fourth aspect of the present invention, and detecting the severity of myopathy Q1 of the animal model in the test group; in a control group, applying a control compound (including a solvent) to a myopathy animal model prepared by the method described in the third aspect or the fourth aspect of the present invention, and detecting the severity of myopathy Q2 of the animal model in the control group;

[0133] (b) comparing the severity Q1 and severity Q2 detected in the previous step to determine whether the test compound is a potential therapeutic agent for treating or alleviating myopathy;

[0134] If the severity Q1 is significantly lower than the severity Q2, it indicates that the test compound is a potential therapeutic agent for treating or alleviating myopathy.

[0135] In another preferred embodiment, the control compound is a glucocorticoid (such as prednisolone).

[0136] In another preferred embodiment, the reduction in severity of myopathy is manifested as one or more selected from the following group: improved grip strength, reduced creatine kinase levels, and reduced muscle fibrosis.

[0137] In another preferred embodiment, the screened therapeutic agent is an antibody drug, a chemical drug, a traditional Chinese medicine, or a combination thereof.

[0138] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0139] In a sixth aspect of the present invention, a myopathy animal model of a non-human mammal is provided, wherein the model is prepared using the method described in the third aspect or the fourth aspect of the present invention.

[0140] In a seventh aspect of the present invention, there is provided use of a S1pr4 modulator and / or a NDUFA10 modulator in the preparation of a medicament for treating and / or alleviating myopathy.

[0141] In another preferred embodiment, the S1pr regulator is a S1pr4-specific regulator.

[0142] In another preferred embodiment, the S1pr regulator is a S1pr4 agonist.

[0143] In another preferred embodiment, the S1pr4 agonist has an agonistic effect on S1pr4 but has no agonistic effect on S1pr1.

[0144] In another preferred embodiment, the S1pr4 agonist is (S,E)-1-(2-ethyl-4-(1-((2-methyl-[1,1'-biphenyl]-4-yl)methoxy)imino)ethyl)benzyl)pyrrolidine-3-carboxylic acid

[0145]

[0146] In another preferred embodiment, the NDUFA10 regulator is a NDUFA10 agonist.

[0147] In another preferred embodiment, the myopathy is selected from the group consisting of idiopathic inflammatory myopathy, infectious myopathy, drug-induced myopathy, toxic myopathy, hereditary myopathy, or a combination thereof.

[0148] In another preferred embodiment, the myopathy is selected from the group consisting of Duchenne muscular dystrophy, Duchenne muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, distal muscular dystrophy, myotonic dystrophy, congenital muscular dystrophy, Emory muscular dystrophy, oculopharyngeal muscular dystrophy, or a combination thereof.

[0149] In another preferred embodiment, the myopathy is Duchenne muscular dystrophy.

[0150] In an eighth aspect of the present invention, a pharmaceutical composition for treating myopathy is provided, comprising an active ingredient selected from the group consisting of a S1pr4 modulator, a NDUFA10 modulator, or a combination thereof.

[0151] In another preferred embodiment, the S1pr regulator is a S1pr4-specific regulator.

[0152] In another preferred embodiment, the S1pr regulator is a S1pr4 agonist.

[0153] In another preferred embodiment, the S1pr4 agonist has an agonistic effect on S1pr4 but has no agonistic effect on S1pr1.

[0154] In another preferred embodiment, the S1pr4 agonist is (S,E)-1-(2-ethyl-4-(1-((2-methyl-[1,1'-biphenyl]-4-yl)methoxy)imino)ethyl)benzyl)pyrrolidine-3-carboxylic acid

[0155]

[0156] In another preferred embodiment, the NDUFA10 regulator is a NDUFA10 agonist.

[0157] In another preferred embodiment, the myopathy is selected from the group consisting of idiopathic inflammatory myopathy, infectious myopathy, drug-induced myopathy, toxic myopathy, hereditary myopathy, or a combination thereof.

[0158] In another preferred embodiment, the myopathy is selected from the group consisting of Duchenne muscular dystrophy, Duchenne muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, distal muscular dystrophy, myotonic dystrophy, congenital muscular dystrophy, Emory muscular dystrophy, oculopharyngeal muscular dystrophy, or a combination thereof.

[0159] In another preferred embodiment, the myopathy is Duchenne muscular dystrophy.

[0160] In a ninth aspect of the present invention, there is provided a method for screening or identifying a therapeutic agent for treating or alleviating myopathy, comprising the steps of:

[0161] (a) in a test group, a test compound is contacted with S1pr4 protein or cells expressing S1pr4 protein, and the activity F1 of S1pr4 protein in the test group is detected; in a control group, a control reagent (including a solvent) is contacted with S1pr4 protein or cells expressing S1pr4 protein, and the activity F2 of S1pr4 protein in the test group is detected;

[0162] (b) comparing the active F1 and active F2 detected in the previous step to determine whether the test compound is a potential therapeutic agent for treating or alleviating myopathy;

[0163] If the activity F1 is significantly higher than the activity F2, it indicates that the test compound is a potential therapeutic agent for treating or alleviating myopathy.

[0164] In another preferred embodiment, the S1pr4 protein activity is the β-arrestin recruitment activity of the S1pr4 protein.

[0165] In another preferred embodiment, the control reagent and the test compound are in equal amounts.

[0166] In another preferred embodiment, the control reagent is a natural S1pr4 ligand (such as S1P).

[0167] In another preferred embodiment, the control reagent is S1P.

[0168] In another preferred embodiment, the screened therapeutic agent is an antibody drug, a chemical drug, a traditional Chinese medicine, or a combination thereof.

[0169] In the tenth aspect of the present invention, there is provided a method for screening or identifying a therapeutic agent for treating or alleviating myopathy, comprising the steps of:

[0170] (a) in a test group, a test compound is contacted with NDUFA10 protein or cells expressing NDUFA10 protein, and the activity of NDUFA10 protein in the test group is detected F1; in a control group, a control reagent (including a solvent) is contacted with NDUFA10 protein or cells expressing NDUFA10 protein, and the activity of NDUFA10 protein in the test group is detected F2;

[0171] (b) comparing the active F1 and active F2 detected in the previous step to determine whether the test compound is a potential therapeutic agent for treating or alleviating myopathy;

[0172] If the activity F1 is significantly higher than the activity F2, it indicates that the test compound is a potential therapeutic agent for treating or alleviating myopathy.

[0173] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0174] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0175] Figure 1 Shows 23 gene mutations screened out after sequencing and analyzing the genes of muscular dystrophy families.

[0176] Figure 2 The identification of mutations of S1pr4 R79C and Ndufa10 R217W in a pedigree of late-onset muscular dystrophy is shown; wherein, (a) a Chinese pedigree diagram containing four generations. Patients are marked with black fill, individuals with mild symptoms are marked with black squares, males are represented by squares and female circles, and the first and second generations are already sick. The symbols below each member indicate the mutation carrying status of S1pr4 R79C (green) and Ndufa10 R217W (purple), respectively; (b) S1pr4 R79C is located in ICL1 (intracellular loop 1); (c) Sanger sequencing verification of S1pr4 R79C; (d) Ndufa10 R217W is located in the deoxynucleoside kinase domain (dNK); and (e) Sanger sequencing verification of Ndufa10 R217W.

[0177] Figure 3 Sanger sequencing validation of Ndufa10 mutant mice is shown.

[0178] Figure 4 Sanger sequencing validation of the S1pr4 mutation is shown.

[0179] Figure 5 Sanger sequencing validation of the S1pr4 gene in S1pr4 / Ndufa10 double mutant mice is shown.

[0180] Figure 6 Sanger sequencing validation of the Ndufa10 gene in S1pr4 / Ndufa10 double mutant mice is shown.

[0181] Figure 7 The results of the paw grip strength, serum creatine kinase level and muscle fibrosis of S1pr4 mutant mice are shown; among them, the paw grip strength of S1pr4 mutant mice is no different from that of normal mice (a), the serum creatine kinase level of S1pr4 mutant mice is no different from that of WT (b), and the muscles of S1pr4 mutant mice do not show muscle fibrosis (HE staining and picrosirius red staining), indicating that S1pr4 mutation does not cause muscular dystrophy.

[0182] Figure 8 The results of paw grip strength, serum creatine kinase level and muscle fibrosis of Ndufa10 mutant mice are shown; the paw grip strength of Ndufa10 mutant mice is no different from that of normal mice (a), the serum creatine kinase level of Ndufa10 mutant mice is no different from that of WT mice (b), and muscle fibrosis is not observed in the muscles of Ndufa10 mutant mice (HE staining and picrosirius red staining); this indicates that Ndufa10 mutation does not lead to muscular dystrophy.

[0183] Fig. 9 The figure shows the test results of paw grip strength, serum creatine kinase level, and muscle nuclear fiber and collagen deposition of S1pr4 / Ndufa10 mutant mice; among them, the paw grip strength of S1pr4 / Ndufa10 mutant mice was significantly reduced compared with normal mice from 5 months of age (a), the serum creatine kinase level of S1pr4 / Ndufa10 mutant mice was significantly increased (b), and the muscles of S1pr4 / Ndufa10 mutant mice showed nuclear fiber and collagen deposition, indicating muscle fibrosis (HE staining and picrosirius red staining), which can be diagnosed as muscular dystrophy.

[0184] Fig.10 Shown are the changes in body weight of double mutant mice after drug administration.

[0185] Fig.11 Shown are the changes in grip strength of double mutant mice after drug administration.

[0186] Fig.12 The results showed that the creatine kinase content in the serum of double mutant mice was significantly higher than that in healthy mice; after administration, the creatine kinase content was significantly reduced, while the prednisolone administration group had no reducing effect.

[0187] Fig.13 It is a representative image of the nucleated fibers in the middle of the muscle after drug administration.

[0188] Fig.14 The results of the examination of the number of centrally nucleated fibers in muscles after drug administration are shown.

[0189] Fig.15 It is a representative picture of collagen area after drug administration.

[0190] Fig.16 It is a statistical graph of collagen area after drug administration.

[0191] Fig.17 It is a representative image of immunofluorescence of macrophages after drug administration.

[0192] Fig.18 It is the immunofluorescence statistics of macrophages after drug administration.

[0193] Fig.19 Shown are the changes in body weight of Duchenne muscular dystrophy model mice after drug administration.

[0194] Fig. 20 Shown are changes in grip strength of Duchenne muscular dystrophy model mice after drug administration.

[0195] Fig.21 Shown are changes in creatine kinase in Duchenne muscular dystrophy model mice.

[0196] Fig. 22 It is a representative image of the nucleated fibers in the middle of the muscle after drug administration.

[0197] Fig.23 The results of the examination of the number of centrally nucleated fibers in muscles after drug administration are shown.

[0198] Fig.24 It is a representative picture of collagen area after drug administration.

[0199] Fig.25 It is a statistical graph of collagen area after drug administration.

[0200] Fig.26 It is a representative image of immunofluorescence of macrophages after drug administration.

[0201] Fig. 27 It is the immunofluorescence statistics of macrophages after drug administration. DETAILED DESCRIPTION

[0202] After extensive and in-depth research, the inventors have developed for the first time a use of Ndufa10 gene and / or S1pr4 gene mutations in myopathy diagnosis and prediction. Based on a family study of patients with muscular dystrophy, the inventors discovered Ndufa10 gene mutations and S1pr4 gene mutations associated with muscular dystrophy. Mouse model studies have confirmed that Ndufa10 gene and S1pr4 gene double mutant mice develop muscular dystrophy after growing to 5 months of age, with significantly reduced grip strength, significantly increased creatine kinase levels, and muscle fibrosis. On this basis, the present invention was completed.

[0203] the term

[0204] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0205] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0206] As used herein, the terms "comprise", "include", and "contain" are used interchangeably and include not only closed definitions, but also semi-closed and open definitions. In other words, the terms include "consisting of", "consisting essentially of".

[0207] Muscular dystrophy

[0208] Muscular dystrophy is a progressive muscle disease caused by genetic mutations, characterized by chronic oxidative stress and inflammation. It manifests clinically as progressive muscle weakness that affects the limbs, throat, and facial muscles to varying degrees. It can be divided into congenital muscular dystrophy and late-onset muscular dystrophy according to the time of onset. Generally speaking, congenital muscular dystrophy has obvious symptoms of muscle weakness at birth or in the first few months after birth. Late-onset muscular dystrophy, on the other hand, shows symptoms of muscle weakness only after the patient achieves independent walking.

[0209] The present invention provides a kit and method for diagnosing myopathy and / or predicting its susceptibility. The method of the present invention performs diagnosis and / or prediction by detecting S1pr4 mutant protein or its encoding and / or Ndufa10 mutant protein or its encoding gene.

[0210] In a preferred embodiment, the myopathy is selected from the group consisting of Duchenne muscular dystrophy, Duchenne muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, distal muscular dystrophy, myotonic dystrophy, congenital muscular dystrophy, Emory muscular dystrophy, oculopharyngeal muscular dystrophy, or a combination thereof.

[0211] Animal models

[0212] In the present invention, a non-human mammalian model of myopathy is provided.

[0213] In the present invention, examples of non-human mammals include (but are not limited to): mice, rats, rabbits, monkeys, etc., more preferably rats and mice.

[0214] The animal model of the present invention can be prepared by gene editing technology. For example, animal cells are subjected to single mutation of S1pr4 gene, single mutation of Ndufa10 gene, or double mutation of S1pr4 and Ndufa10 gene, and the mutant cells are cultured to obtain myopathy animal model. Alternatively, for example, the S1pr4 gene and Ndufa10 gene of the parent animal are mutated respectively, and after hybridization, the double mutant myopathy animal model is screened in the offspring.

[0215] As used herein, the term "single mutation" refers to having a S1pr4 gene mutation or a Ndufa10 gene mutation. As used herein, the term "double mutation" refers to having both a S1pr4 gene mutation and a Ndufa10 gene mutation. Preferably, the S1pr4 gene mutation causes the S1pr4 mutant protein it encodes to mutate at position 82 of the amino acid sequence, for example, to cysteine ​​C, compared to the wild-type S1pr4 protein. Preferably, the Ndufa10 gene mutation causes the Ndufa10 mutant protein it encodes to mutate at position 217 of the amino acid sequence, for example, to tryptophan W, compared to the wild-type Ndufa10 protein. The gene mutation animal model of the present invention may be heterozygous or homozygous mutations in the S1pr4 gene and / or the Ndufa10 gene. Preferably, the above mutations cause the S1pr4 and / or Ndufa10 proteins to have reduced or lost activity.

[0216] In the present invention, the corresponding gene can be mutated by introducing an exogenous gene (or fragment). In the art, the technology of mutating the target gene by introducing an exogenous gene by gene editing methods (e.g., by CRISPR / Cas system) is known, and these conventional techniques can be used in the present invention.

[0217] The homozygous or heterozygous non-human mammal obtained by the method of the present invention is fertile and develops normally. The mutated S1pr4 gene and / or Ndufa10 gene can be inherited by the offspring mice according to Mendelian law.

[0218] Candidate drugs or therapeutic agents

[0219] The present invention also provides a method for screening candidate drugs or therapeutic agents for treating myopathy using the animal model of the present invention.

[0220] In the present invention, candidate drugs or therapeutic agents refer to substances that are known to have certain pharmacological activities or are being tested and may have certain pharmacological activities, including but not limited to nucleic acids, proteins, chemically synthesized small molecules or macromolecular compounds, cells, etc. The administration of candidate drugs or therapeutic agents can be oral, intravenous, intraperitoneal, subcutaneous, or spinal administration.

[0221] The main advantages of the present invention include:

[0222] 1) The present invention discovered the correlation between Ndufa10 gene and / or S1pr4 gene mutation and muscular dystrophy, and confirmed through mouse model studies that double mutation of Ndufa10 gene and S1pr4 gene can cause muscular dystrophy in mice. Based on this, the diagnosis and prediction of muscular dystrophy by detecting reagents for Ndufa10 gene and S1pr4 gene mutation is provided.

[0223] 2) The present invention provides a muscular dystrophy mouse model with Ndufa10 gene and / or S1pr4 gene mutation and a modeling method, which is helpful for the development and screening of new muscular dystrophy therapeutic drugs.

[0224] 3) The present invention provides uses and methods of NDUFA10 modulators and / or S1pr4 modulators for treating myopathy, and provides methods for screening potential therapeutic drugs for myopathy.

[0225] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0226] Example 1 Study on the association between Ndufa10 and S1pr4 mutations and myopathy

[0227] The inventors found that males and females in a family began to show muscular dystrophy phenotypes at the age of 50, and the symptoms worsened with age, showing strong family hereditary disease characteristics. The family was sequenced for the entire genome, and after bioinformatics analysis of the sequencing results, 23 gene mutations were screened out that were common to all patients but not to their healthy spouses ( Figure 1 ). In the table, column W is the name of the mutated gene, column X is the corresponding mutation site, and then the test results of each sample are followed. Each sample has 4 columns of data. In column Z, 0|1 indicates a heterozygous mutation, 1|1 indicates a homozygous mutation, and 0|0 indicates no mutation.

[0228] Through extensive research on muscular dystrophy and the functions of 23 mutant genes, two genes, Ndufa10 and S1pr4, have attracted attention. Among them, the former is a subunit of mitochondrial respiratory chain complex I, which may be related to mitochondrial energy production, and muscle cells have a large demand for energy. Muscle cells may affect the function of muscle cells by reducing mitochondrial energy efficiency; while the latter is related to immune function and may be the main cause of changes in muscle tissue traits in patients with muscular dystrophy. Therefore, the inventors first studied Ndufa10 and S1pr4 mutations as potential pathogenic gene mutations for muscular dystrophy.

[0229] Figure 2The results of the target-disease association study show the mutation identification of S1pr4R79C and Ndufa10 R217W in the late-onset muscular dystrophy pedigree. Among them, (a) is a Chinese pedigree chart containing four generations. Patients are marked with black fill, individuals with mild symptoms are marked with black squares, males are represented by squares, and females are represented by circles. The first and second generations are already sick. The symbols under each member represent the mutation carrying status of S1pr4 R79C (green) and Ndufa10 R217W (purple). (b) shows that S1pr4R79C is located in ICL1 (intracellular loop 1). (c) is the Sanger sequencing verification of S1pr4 R79C. (d) shows that Ndufa10 R217W is located in the deoxynucleoside kinase domain (dNK). (e) is the Sanger sequencing verification of Ndufa10 R217W.

[0230] Figure 2 In the figure, all black indicates patients who have been diagnosed. These patients have both heterozygous mutations in S1pr4 and Ndufa10. Other generations have inherited one mutation, two mutations, or none of them, all in line with Mendel's law of inheritance. Since the disease will only occur at a certain age, it is currently impossible to observe or confirm whether the next generation of individuals will develop the disease, but according to their own feelings, some individuals have already felt mild muscle symptoms, which are represented by 1 / 4 black filling.

[0231] Through whole genome sequencing of muscular dystrophy patient families, it was found that Ndufa10 and S1pr4 of all patients were mutated. In the Ndufa10 mutant mouse model, it was found that Ndufa10 can cause mitochondrial dysfunction, without gender selectivity, and both males and females have this phenotype. In the S1pr4 mutant mouse model, it was found that the S1pr4 mutation can lead to increased inflammation levels, without gender selectivity, and both males and females have this phenotype. In the following examples, the effect of the double mutation of Ndufa10 and S1pr4 on the onset of muscular dystrophy was further verified by mouse models.

[0232] Example 2 Establishment of Ndufa10 R217W mutant gene animal model

[0233] Unless otherwise specified, the reagents and materials used in the present invention are commercially available or can be prepared according to literature methods. Experimental reagents and methods not specifically specified are conventional reagents and methods.

[0234] The present invention utilizes CRISPR / Cas9 gene editing technology to target the Ndufa10 gene of mice.

[0235] The DNA sequences recognized by the gRNA designed based on the mouse Ndufa10 gene are as follows:

[0236] gRNA2(Cas9_D10A)(matches reverse strand of gene):TGGATCCTGCTCTGTACCTCCGG(SEQ ID NO:1)

[0237] gRNA3(Cas9_D10A)(matches forward strand of gene):CAGAGCAGGATCCAGAAGAAAGG(SEQ ID NO:2)

[0238] The method of targeting the Ndufa10 gene of mutant mice mainly includes the following steps:

[0239] a) Preparation of gRNA and cas9 mRNA

[0240] The R217W (AGG to TGG) mutation site in the donor oligonucleotide was introduced into exon 5 by homology-directed repair. A silent mutation (ATC to ATA) was introduced to prevent gRNA binding and re-cutting of the sequence after homology-directed repair. Cas9 mRNA, gRNA and donor oligonucleotide produced by in vitro transcription were co-injected into fertilized eggs for the production of KI mice.

[0241] b) Sperm and egg collection

[0242] Semen was collected by penile electrical stimulation ejaculation. The menstrual cycle of female mice was observed every day, and female mice with normal menstrual cycle were selected for superovulation and egg collection.

[0243] c) Microinjection

[0244] Using single sperm microinjection technology, a single sperm is injected into the egg cell. When the fertilized egg is still in the single cell stage, the mixture of the above cas9mRNA and gRNA2 and gRNA3 is injected into the nucleus of the fertilized egg.

[0245] d) Surrogacy and childbirth

[0246] The embryos were transferred to the oviduct the day after microinjection. The 3-4 pronuclear stage embryos were transferred into the middle of the ampulla of the oviduct of the surrogate mouse 0-3 days after ovulation. The female mouse was pregnant until delivery to obtain the F0 generation mice.

[0247] e) F0 generation reproduction

[0248] F0 mice were crossed with wild-type mice to obtain F1 mice.

[0249] f) F1 generation PCR identification

[0250] The tail samples of F1 mice were collected, the genome was extracted, and PCR amplification was performed on the gene target sites. In this example, three F1 mice were obtained, which were named No. 8, No. 9 and No. 12 respectively.

[0251] g) Sequencing confirmation

[0252] Sequence primer (reverse sequencing): CAAATCACTTTCATTTCCAAGCCAGA (SEQ ID NO: 3), the result is as follows Figure 3 As shown, mice numbered 8, 9, and 12 had a point mutation in one allele (AGG to TGG)

[0253] Example 3 Establishment of an animal model with a point mutation (R82C) at the S1pr4 site

[0254] This example uses CRISPR / Cas9-mediated genome engineering technology to establish a mouse S1pr4 site mutation (R82C) mouse model. Unless otherwise specified, the reagents and materials used in the present invention are commercially available or can be prepared according to literature methods. Experimental reagents and methods not specifically specified are all conventional reagents and methods.

[0255] The mouse S1pr4 gene is located on mouse chromosome 10. One exon has been identified. R82 is located on exon 1. Exon 1 was selected as the target site, and the gRNA targeting vector and donor oligonucleotide (with the targeting sequence bound to 120 bp of homologous sequence on both sides) were designed.

[0256] gRNA1(matches reverse strand of gene):GCAGTAGTACACCCAGCGGCGGG(SEQ IDNO:4)

[0257] gRNA2(Cas9_D10A)(matches reverse strand of gene):GCGGCGGGACCGCATGTAGATGG(SEQ ID NO:5)

[0258] gRNA3(Cas9_D10A)(matches forward strand of gene):CTACATGCGGTCCCGCCGCTGGG(SEQ ID NO:6)

[0259] The method of targeting the S1pr4 gene of mutant mice mainly includes the following steps:

[0260] 1. Preparation of gRNA and cas9 mRNA

[0261] The R82C (CGC to TGC) mutation site in the donor oligonucleotide was introduced into exon 1 by homology-directed repair. Cas9 mRNA, gRNA, and donor oligonucleotide produced by in vitro transcription were co-injected into fertilized eggs for the production of KI mice.

[0262] 2. Sperm and egg collection

[0263] Semen was collected by penile electrical stimulation ejaculation. The menstrual cycle of female mice was observed every day, and female mice with normal menstrual cycle were selected for superovulation and egg collection.

[0264] 3. Microinjection

[0265] Using single sperm microinjection technology, a single sperm is injected into the egg cell. When the fertilized egg is still in the single cell stage, the mixture of the above cas9mRNA and gRNA1, gRNA2, and gRNA3 is injected into the nucleus of the fertilized egg.

[0266] 4. Surrogacy and childbirth

[0267] The embryos were transferred to the oviduct the day after microinjection. The 3-4 pronuclear stage embryos were transferred into the middle of the ampulla of the oviduct of the surrogate mouse 0-3 days after ovulation. The female mouse was pregnant until delivery to obtain the F0 generation mice.

[0268] 5. F0 generation reproduction

[0269] F0 mice were crossed with wild-type mice to obtain F1 mice.

[0270] 6. F1 generation PCR identification

[0271] Tail samples of F1 mice were collected, the genome was extracted, and PCR amplification was performed on the gene targeting site.

[0272] PCR screening

[0273] Obtain genomic DNA. Add tail digestion buffer to a microcentrifuge tube. Incubate the tube at 56°C overnight. Incubate at 98°C for 13 minutes to denature proteinase K. Spin at top speed in a microcentrifuge for 15 minutes. Take the supernatant from the tube for PCR.

[0274] PCR primers

[0275] Mouse S1pr4(R82C)-F:5'-GAACATCAGTACCTGGGTCCACGCT-3'(SEQ ID NO:7)

[0276] Mouse S1pr4(R82C)-R:5'-CGTGAAGAGCAGACTGAAGGTGGAT-3'(SEQ ID NO:8)

[0277] Mutant allele:424bp; Wildtype allele:424bp

[0278] In this example, three F1 mice were obtained and named No. 1, No. 2 and No. 6 respectively.

[0279] 7. Sequencing Confirmation

[0280] Sequence primer (reverse sequencing): 5'-CGTGAAGAGCAGACTGAAGGTGGAT-3' (SEQ ID NO: 8)

[0281] The results are as follows Figure 4 As shown, mice numbered 1, 2, and 6 had a point mutation (CGCtoTGC) in one allele.

[0282] Example 4 Establishment of a double mutant mouse model with a point mutation at the S1pr4 site (R82C) and a point mutation at the Ndufa10 site (R217W)

[0283] The double mutant mice with S1pr4 point mutation (R82C) and Ndufa10 point mutation (R217W) were obtained by hybridizing heterozygous mice with S1pr4 point mutation (R82C) and homozygous mice with Ndufa10 point mutation (R217W).

[0284] Sequencing was performed to confirm whether both genes of the offspring mice were mutated. Primer for S1pr4 gene sequence (reverse sequencing): 5'-CGTGAAGAGCAGACTGAAGGTGGAT-3' (SEQ ID NO: 8)

[0285] Ndufa10 gene sequence primer (reverse sequencing): 5'-CAAATCACTTTCATTTCCAAGCC AGA-3' (SEQ ID NO: 3)

[0286] like Figure 5 As shown, mice 134, 138, and 139 had a point mutation (CGC to TGC) in one allele, namely, the S1pr4 R82C mutation. Figure 6 As shown, mice No. 134, 135, 138, and 139 had a point mutation (AGG to TGG) in one allele, namely, the Ndufa10 R217W mutation. Therefore, it can be judged that mice No. 134, 138, and 139 had double gene mutations.

[0287] Example 5 Detection of Muscular Dystrophy Related Indicators in Mice

[0288] 5.1 Methods

[0289] Limb grip strength test

[0290] The mouse is placed horizontally on the grasping test board. Grasp the mouse's tail and pull it in the opposite direction. The movement is gentle and never violent. Pull the mouse's tail gradually until the mouse releases the grip force receptor. The maximum value recorded by the grip force receptor is the grip strength value. Repeat 3 times and take the average value.

[0291] Serum creatine kinase level detection

[0292] Blood was collected from the eye socket, left to stand for 30 min, centrifuged at 3000 rpm / min, 4°C for 15 min, serum was extracted, frozen at -20°C, and tested according to the kit instructions.

[0293] Muscle tissue biopsy

[0294] The tibialis anterior muscle, extensor digitorum longus and diaphragm of mice were fixed and sectioned for HE staining and picrosirius red staining to observe the degree of muscle fibrosis.

[0295] 5.2 Results

[0296] 1) S1pr4 mutations do not cause muscular dystrophy

[0297] The paw grip strength of S1pr4 mutant mice was no different from that of normal mice ( Figure 7 a), the serum creatine kinase level in S1pr4 mutant mice was no different from that in WT mice ( Figure 7 b), S1pr4 mutant mice did not show muscle fibrosis (HE staining and picrosirius red staining). These results indicate that S1pr4 mutation does not cause muscular dystrophy.

[0298] 2) Ndufa10 mutation does not cause muscular dystrophy

[0299] The paw grip strength of Ndufa10 mutant mice was no different from that of normal mice ( Figure 8 a), the serum creatine kinase level in Ndufa10 mutant mice was no different from that in WT mice ( Figure 8 b), Ndufa10 mutant mice did not show muscle fibrosis (HE staining and picrosirius red staining). These results indicate that Ndufa10 mutation does not cause muscular dystrophy.

[0300] 3) S1pr4 / Ndufa10 mutation causes muscular dystrophy

[0301] The paw grip strength of S1pr4 / Ndufa10 mutant mice was significantly lower than that of normal mice starting from 5 months of age. Fig. 9a), the serum creatine kinase level in S1pr4 / Ndufa10 mutant mice was significantly increased ( Fig. 9 b), The muscles of S1pr4 / Ndufa10 mutant mice showed nucleated fibers and collagen deposition, indicating muscle fibrosis (HE staining and picrosirius red staining), which can be diagnosed as muscular dystrophy.

[0302] The results showed that neither of the two single gene mutant mice developed muscular dystrophy. The double mutant mice obtained by hybridizing the S1pr4 mutant mice with the Ndufa10 mutant mice showed a muscular dystrophy phenotype, with weakened grip strength of the limbs, increased serum creatine kinase, muscle fibrosis and inflammation, etc. compared with normal mice. Therefore, the double mutant mice developed muscular dystrophy.

[0303] Example 6 Screening of therapeutic agents for muscular dystrophy

[0304] In this example, the muscular dystrophy mouse model prepared in Example 5 was used to screen potential therapeutic drugs.

[0305] Taking (S,E)-1-(2-ethyl-4-(1-((2-methyl-[1,1'-biphenyl]-4-yl)methoxy)imino)ethyl)benzyl)pyrrolidine-3-carboxylic acid (Compound 30) prepared by the inventors in the early stage as an example, its structure is shown below.

[0306]

[0307] 6.1 In vitro activity test

[0308] The test results showed that compound 30 had an EC-like activity in recruiting β-arrestin to S1pr4. 50 =9.09nM. Next, the S1pr1-5 selectivity analysis was performed on the superior compound 30. The test results showed that compared with the endogenous ligand S1P, compound 30 had no agonist activity on the S1pr2 / 3 / 5 targets, and its selectivity for S1pr1 was nearly 10 times, further proving that compound 30 is a selective S1pr4 agonist, and its agonist activity on S1pr4 is significantly higher than that of the endogenous ligand S1P.

[0309] Table 1 Selectivity of compound 30 in S1prs

[0310]

[0311] a β-restin recruitment activity based on Tango-S1pr1-CHO-K1 and Tango-S1pr4-CHO-K1 cells, expressed as EC 50 Values ​​are mean ± SD. bFLIPR analysis was performed on S1pr2-CHO and S1pr5-CHO cell lines and expressed as EC 50 Values ​​are mean ± SD. c Based on PathHunter CHO-K1-S1pr3 cell-based β-restin recruitment activity, expressed as EC 50 The data are the mean ± SD of at least two independent determinations and are reported as the mean ± SD (standard deviation).

[0312] 6.2 Model-based efficacy evaluation

[0313] Based on the above-mentioned studies on the relationship between the target and myopathy and the discovery of selective S1pr4 modulators, the present inventors evaluated the in vivo efficacy of compound 30 in a muscular dystrophy disease model caused by the S1pr4-R82C / NDUFA10-R217W double mutation.

[0314] Experimental animals and groups

[0315] Experimental animals: A total of 34 S1pr4-R82C / NDUFA10-R217W mice were divided into 6 groups as shown below.

[0316]

[0317] 1. Main reagents and drugs

[0318] Positive drugs: prednisolone (1 mg / kg), BAF312 (1 mg / kg), compound 30 (0.3 / 1 / 3 mg / kg)

[0319] 2 Experimental methods

[0320] Gavage administration began on day 0, and body weight was measured daily to adjust the drug dosage. Grip strength was measured at the beginning and end of the experiment to observe the movement changes of the mice. Grip strength of the four limbs of the mice, serum creatine kinase content, and changes in muscle fibrosis / inflammation were tested as indicators for evaluating drug efficacy.

[0321] 2.1 Test contents after drug treatment

[0322] As described in Example 5, the limb grip strength test, serum creatine kinase content test, and muscle tissue section pathology test were performed. After the experiment, the tibialis anterior muscle, extensor digitorum longus muscle and diaphragm of the mice were fixed and sliced ​​for HE staining and picrosirius red staining to observe the degree of muscle fibrosis. The slices were immunofluorescently incubated with F4 / 80 to observe the level of muscle inflammation.

[0323] The weight changes of double mutant mice after drug administration are shown in Fig.10As shown in the figure, after drug treatment, the double mutant mice had no difference in weight gain trends in the BAF312 1 mg / kg group and the compound 30 0.3, 1, and 3 mg / kg groups compared with the model group, and the weight gain trend in the prednisolone 1 mg / kg group was slower than that in the other groups.

[0324] Changes in grip strength of double mutant mice after drug administration Fig.11 As shown. After the double mutant mice were treated with medication, the grip strength was measured at the beginning and end of the medication, and the ratio of grip strength to body weight was statistically used to represent the change in mouse grip strength to exclude the influence of body weight. At the beginning of medication, the grip strength of the double mutant mice was significantly lower than that of wild-type mice. After 21 days of medication, the grip strength of compound 30 in the 0.3 and 1 mg / kg groups and prednisolone 1 mg / kg group was significantly increased, showing a good therapeutic effect.

[0325] Changes of creatine kinase in double mutant mice Fig.12 As shown. The creatine kinase content in the serum of double mutant mice was significantly increased compared with that of healthy mice. After drug administration, compound 30 1mg / kg, 4mg / kg and BAF312 1mg / kg could significantly reduce the creatine kinase content, while prednisolone 1mg / kg group had no reducing effect.

[0326] The current diagnostic standard for muscular dystrophy is muscle biopsy, and the improvement of muscular dystrophy is ultimately judged by observing the level of muscle fibrosis and inflammation. The degree of fibrosis can be determined by observing the number of nucleated fibers in the muscle through HE staining. Normal muscle fibers have normal spaces between them, the nuclei are located at the periphery, and there is no inflammatory cell infiltration in the muscle fibers; muscles with fibrosis will experience hypertrophy and atrophy, resulting in different sizes of muscle fibers, rounded contours of hypertrophic fibers, inward migration of muscle cell nuclei, and a large number of inflammatory cell infiltrations around damaged cells. Regenerating muscle fibers with centrally located nuclei, which are almost completely absent in undamaged muscles, can be used as a marker of previous necrosis-regeneration cycles.

[0327] Representative images of intermediate nucleated fibers in double mutant mice Fig.13 As shown, the statistics of nucleated fibers are as follows Fig.14 shown.

[0328] The degree of muscle fibrosis can be determined by counting the number of nucleated fibers in the middle of the muscle. The statistical results show that the model group has the highest proportion of nucleated fibers. After drug treatment, each drug group can significantly reduce the number of nucleated fibers in the middle. Compound 30 has the largest reduction in nucleated fibers in the 1mg / kg group, which is stronger than the BAF312 1mg / kg group and the prednisolone 1mg / kg group, indicating that the treatment effect of compound 30 1mg / kg is better than that of BAF312 1mg / kg group and the prednisolone 1mg / kg group, and the reduction of compound 301mg / kg is higher than that of compound 30 3mg / kg. There is no difference in the treatment effect, indicating that compound 30 can achieve a therapeutic effect at 1mg / kg.

[0329] Another indicator for determining the degree of fibrosis is the collagen area. The collagen area of ​​double mutant mice is represented by Fig.15 As shown; collagen area statistics are as follows Fig.16 Compared with healthy subjects, patients with muscular dystrophy had collagen deposition, resulting in a significant increase in the collagen area ratio in the muscle. The experimental statistical results showed that the model group had the highest collagen area ratio. After drug treatment, the compound 30 1mg / kg, 3mg / kg, BAF312 1mg / kg and prednisolone 1mg / kg groups significantly reduced collagen deposition.

[0330] Based on the number of intermediate nucleated fibers and the percentage of collagen deposition, the compound 30 1mg / kg, compound 30 3mg / kg, BAF312 1mg / kg and prednisolone 1mg / kg groups can significantly improve the degree of fibrosis in double mutant mice. The therapeutic effect of compound 30 1mg / kg is stronger than that of prednisolone 1mg / kg group, indicating that compound 30 1mg / kg can achieve a therapeutic effect.

[0331] Representative immunofluorescence images of macrophages in double mutant mice are shown in Fig.17 As shown; macrophage immunofluorescence statistics as shown Fig.18 shown.

[0332] One of the typical pathological characteristics of muscular dystrophy is muscle inflammation. After drug treatment, the double mutant mice showed a significant reduction in macrophage content and muscle inflammation in all drug treatment groups, among which the compound 30 1 mg / kg group had the largest reduction.

[0333] Based on all the above results, compound 30 1mg / kg can significantly improve the pathological characteristics of double mutant mice, including reducing creatine kinase content, reducing fibrosis level and reducing muscle inflammation, to achieve therapeutic effects. The therapeutic effect is stronger than that of the positive drug prednisolone 1mg / kg group, indicating that compound 30 is expected to become a new compound for the treatment of muscular dystrophy.

[0334] The results show that the double mutant mouse myopathy model of the present invention can be used to screen potential therapeutic drugs for muscular dystrophy. At the same time, S1pr4 protein can also be used as a screening target, and S1pr4 agonists can be screened by detecting the activation effect of compounds on S1pr4, thereby screening potential therapeutic drugs for muscular dystrophy.

[0335] Example 7. In vivo efficacy test for Duchenne muscular dystrophy

[0336] This example verifies the in vivo efficacy of compound 30 screened by the protein target and animal model of the present invention in the Duchenne muscular dystrophy myopathy model. The experimental scheme and results are as follows:

[0337] 1 Experimental Materials

[0338] Experimental animals and groups

[0339] Experimental animals: A total of 35 Duchenne muscular dystrophy model mice were divided into 6 groups as shown below.

[0340]

[0341] Main reagents and drugs

[0342] Positive drug prednisone (1mg / kg): Duchenne muscular dystrophy is the most common muscular dystrophy subtype and has the most research reports among all muscular dystrophy subtypes. Currently approved treatments for Duchenne muscular dystrophy include anti-inflammatory glucocorticoids and gene therapy.

[0343] 2 Experimental methods

[0344] The drug was administered by gavage starting from day 0, and the body weight was measured every day to adjust the drug dosage. The grip strength test was performed every 2 days to observe the changes in the grip strength of the mice until the end of the experiment on day 21. The grip strength of the mice's limbs, serum creatine kinase content, and muscle fibrosis / inflammation changes were tested as indicators for evaluating drug efficacy.

[0345] 2.1 Test contents after drug treatment

[0346] Treatment outcome testing was performed as described in Example 6.

[0347] Body weight changes of Duchenne muscular dystrophy model mice after drug administration Fig.19 As shown in the figure, after drug treatment, the weight gain trend of the Duchenne muscular dystrophy model mice was similar to that of the model group in the BAF312 1 mg / kg group, the prednisolone group, and the compound 30 0.3 and 1 mg / kg groups. The weight gain trend of the compound 30 3 mg / kg group was slower than that of the other groups.

[0348] Changes in grip strength of Duchenne muscular dystrophy model mice after drug administration Fig. 20 As shown. After drug treatment, the grip strength of Duchenne muscular dystrophy model mice was measured every 2 days, and the ratio of grip strength to body weight was statistically used to represent the change in mouse grip strength to exclude the influence of body weight. In the first 14 days, the grip strength of all groups of mice increased, and the rate of increase in the drug-treated group was higher than that in the model group, especially the compound 30 3mg / kg grip strength increase was the most significant, showing a good therapeutic effect. However, after 14 days, the grip strength of all groups began to decrease. Analysis of the reason may be that the grip strength measurement is too frequent, and the mice have become accustomed to the grip strength test and no longer violently grasp and resist.

[0349] Changes of creatine kinase in Duchenne muscular dystrophy model mice Fig.21 As shown. The creatine kinase content in the serum of Duchenne muscular dystrophy model mice was significantly increased compared with that of healthy mice. After drug treatment, compound 30 0.3mg / kg, 1mg / kg, 3mg / kg and prednisolone 1mg / kg can significantly reduce the content of creatine kinase, while BAF312 1mg / kg group has no reducing effect. And the reduction in 30 1mg / kg group is greater than that in prednisolone 1mg / kg group, indicating that the therapeutic effect of 30 1mg / kg is better than that of prednisolone.

[0350] At present, the gold standard for diagnosing muscular dystrophy is muscle biopsy, and the improvement of muscular dystrophy is ultimately judged by observing the level of muscle fibrosis and inflammation. The degree of fibrosis can be determined by observing the number of nucleated fibers in the muscle through HE staining. The gaps between normal muscle fibers are normal, the nuclei are located around, and there is no inflammatory cell infiltration in the muscle fibers; muscles with fibrosis will experience hypertrophy and atrophy, resulting in different sizes of muscle fibers, rounded contours of hypertrophic fibers, inward migration of muscle cell nuclei, and a large number of inflammatory cell infiltration around damaged cells. Regenerating muscle fibers with centrally located nuclei, which are almost completely missing in undamaged muscles, can be used as a marker of previous necrosis-regeneration cycles.

[0351] Representative of intermediate nucleated fibers in Duchenne muscular dystrophy model mice Fig. 22 As shown; the statistics of nucleated fibers are as follows Fig.23 shown.

[0352] The degree of muscle fibrosis can be determined by counting the number of nucleated fibers in the middle of the muscle. The statistical results showed that the model group had the highest proportion of nucleated fibers. After drug treatment, the compound 30 1mg / kg, compound 30 3mg / kg, BAF312 1mg / kg and prednisolone 1mg / kg groups could significantly reduce the number of nucleated fibers in the middle, and the compound 30 0.3mg / kg group had no significant difference compared with the model group. The compound 30 1mg / kg and compound 30 3mg / kg groups had the largest reduction in nucleated fibers, which was stronger than the BAF312 1mg / kg and prednisolone 1mg / kg groups, indicating that the treatment effects of compound 30 1mg / kg and compound 30 3mg / kg were better than those of BAF312 1mg / kg and prednisolone 1mg / kg groups, and there was no difference in the treatment effects of compound 30 1mg / kg and compound 30 3mg / kg, indicating that compound 30 1mg / kg can achieve the therapeutic effect.

[0353] Collagen area in Duchenne muscular dystrophy model mice Fig.24 As shown; collagen area statistics are as follows Fig.25 shown.

[0354] Another indicator for judging the degree of fibrosis is the collagen area. Compared with healthy people, patients with muscular dystrophy have collagen deposition, resulting in a significant increase in the collagen area ratio in the muscle. The experimental statistical results show that the model group has the highest collagen area ratio. After drug treatment, the compound 30 0.3mg / kg, compound 30 1mg / kg, compound 30 3mg / kg and prednisolone 1mg / kg groups significantly reduced collagen deposition. There was no difference between the BAF312 1mg / kg group and the model group, indicating that it could not reduce collagen deposition. The effect of compound 30 1mg / kg and compound 30 3mg / kg in reducing collagen deposition was stronger than that of the prednisolone 1mg / kg group, and there was no difference in the effect of compound 30 1mg / kg and compound 30 3mg / kg in reducing collagen deposition.

[0355] Based on the number of intermediate nucleated fibers and the percentage of collagen deposition, the compound 30 1mg / kg, compound 30 3mg / kg and prednisolone 1mg / kg groups can significantly improve the degree of fibrosis in Duchenne muscular dystrophy mice, and the BAF312 1mg / kg group has a poor improvement effect on muscle fibrosis. The therapeutic effects of compound 30 1mg / kg and compound 30 3mg / kg are stronger than those of prednisolone 1mg / kg group, and there is no difference in the therapeutic effects of compound 30 1mg / kg and compound 30 3mg / kg, indicating that compound 30 1mg / kg can achieve a therapeutic effect.

[0356] Representative images of macrophage immunofluorescence in Duchenne muscular dystrophy model mice Fig.26 As shown; macrophage immunofluorescence statistics as shown Fig. 27 shown.

[0357] One of the typical pathological characteristics of Duchenne muscular dystrophy is muscle inflammation. The first-line drug for treating Duchenne muscular dystrophy, glucocorticoids, exerts its therapeutic effect by alleviating muscle inflammation. After drug treatment, the compound 30 1mg / kg, 3mg / kg and prednisolone 1g / kg groups of Duchenne muscular dystrophy model mice significantly reduced the content of macrophages and alleviated muscle inflammation. The BAF312 1mg / kg group had no improvement on muscle inflammation.

[0358] Based on all the above results, compound 30 1mg / kg and 3mg / kg and prednisolone 1mg / kg can significantly improve the pathological characteristics of Duchenne muscular dystrophy model mice, including reducing creatine kinase content, reducing fibrosis level and reducing muscle inflammation, so as to achieve therapeutic effects. Moreover, the therapeutic effects of compound 30 1mg / kg and 3mg / kg groups are stronger than those of positive drug prednisolone 1mg / kg group, indicating that compound 30 is expected to become a new compound for the treatment of Duchenne muscular dystrophy, proving that the protein target and animal model of the present invention have the ability to screen potential therapeutic drugs for Duchenne muscular dystrophy.

[0359] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Use of a reagent combination in the preparation of a kit for diagnosing and / or predicting myopathy, characterized in that: The reagent combination comprises one or more detection reagents for mutant genes or proteins encoded therein selected from the following groups: AXDND1:NM_144696, MST1L:NM_001271733, COL6A3:NM_004369, Ndufa10:NM_004544, SNTG2:NM_018968, CCDC191:NM_0208 17. COL6A6:NM_001102608, CMTR1:NM_015050, CRISP2:NM_001142435, GTF2H4:NM_001517, RIMS1:NM_001168410, VARS2:NM _020442, ABHD17B:NM_016014, LOC101928841:NM_001304433, CCDC155:NM_144688, NAPSA:NM_004851, PEG3:NM_006210, S1 pr4:NM_003775, SMIM17:NM_001193628, SRRM5:NM_001145641, ZNF473:NM_015428, ZNF57:NM_173480, ZNF845:NM_138374.

2. The use according to claim 1, characterized in that The mutant genes and proteins are: Ndufa10:NM_004544 / Missense:CGG=>TGG:R217W and / or S1pr4:NM_003775 / Missense:CGC=>TGC:R79C.

3. A kit for diagnosing myopathy and / or predicting its susceptibility, characterized in that: The kit comprises: (a) a detection reagent for S1pr4 mutant protein or its encoding gene; and / or (b) a detection reagent for Ndufa10 mutant protein or its encoding gene; and (c) labels or instructions; Wherein, the components (a) and (b) are respectively located in one or more different containers or in the same container.

4. A method for preparing a myopathy animal model of a non-human mammal, characterized in that: The method comprises the following steps: A non-human mammal with a S1pr4 gene mutation and a non-human mammal with a Ndufa10 gene mutation are hybridized, and heterozygous non-human mammals with double mutations in the S1pr4 gene and the Ndufa10 gene are obtained from the offspring, thereby obtaining the myopathy animal model.

5. The preparation method according to claim 4, characterized in that: The S1pr4 gene mutation causes the arginine R at position 82 of the amino acid sequence of the S1pr4 mutant protein encoded by the S1pr4 mutant protein to mutate compared with the wild-type S1pr4 protein.

6. The preparation method according to claim 4, characterized in that: The Ndufa10 gene mutation causes the arginine R at position 217 of the amino acid sequence of the Ndufa10 mutant protein encoded by it to mutate compared with the wild-type Ndufa10 protein.

7. A method for screening or identifying a therapeutic agent for treating or alleviating myopathy, characterized in that: Includes steps: (a) in a test group, applying a test compound to a myopathy animal model prepared by the method of claim 4, and detecting the severity of myopathy Q1 of the animal model in the test group; in a control group, applying a control compound (including a solvent) to a myopathy animal model prepared by the method of claim 4, and detecting the severity of myopathy Q2 of the animal model in the control group; (b) comparing the severity Q1 and severity Q2 detected in the previous step to determine whether the test compound is a potential therapeutic agent for treating or alleviating myopathy; If the severity Q1 is significantly lower than the severity Q2, it indicates that the test compound is a potential therapeutic agent for treating or alleviating myopathy.

8. The method according to claim 7, characterized in that The screened therapeutic agent is an antibody drug, a chemical drug, a traditional Chinese medicine, or a combination thereof.

9. Use of S1pr4 modulators and / or NDUFA10 modulators in the preparation of drugs for treating and / or alleviating myopathy.

10. The use according to claim 9, characterized in that The NDUFA10 regulator is an NDUFA10 agonist.

Images