Gene target spot and medicine for treating hepatopathy

Abstract

The invention discloses a gene target spot and a medicine for treating liver diseases. Detection and analysis on the liver function and the liver tissue of a NDufa7 gene knockout mouse find that knockout of the NDufa7 gene can cause abnormal liver function and damaged liver tissue of the mouse, and meanwhile, real-time quantitative fluorescent PCR (Polymerase Chain Reaction) finds that inhibition of the expression of the NDufa7 gene can induce the occurrence of the non-alcoholic fatty liver disease, so that the NDufa7 gene knockout mouse can be used for detecting the liver function and the liver tissue of the NDufa7 gene knockout mouse. The NDufa7 gene can be used as a liver disease treatment gene target to develop liver disease treatment drugs. Besides, the survival rate of the cells under the stimulation of oleic acid can be improved through overexpression of the NDufa7 gene in the cells, and oleic acid is a common reagent for inducing cell models such as non-alcoholic fatty liver diseases, that is, overexpression of the NDufa7 gene can prevent or improve the liver diseases and can be used as a liver disease treatment medicine. The invention fully proves that Ndufa7 participates in the occurrence of liver diseases and is beneficial to the development of drugs for preventing, improving or treating liver diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a gene target and a drug for treating liver disease. Background Art

[0002] The liver is the largest internal organ of the human body, the largest digestive gland in the human digestive system, and the hub of fat transportation. The metabolic processes of lipid digestion, absorption, decomposition, synthesis and transportation are all carried out in the liver. As an important organ of metabolism, the liver has extremely important and complex functions. Liver diseases, such as fatty liver (including non-alcoholic fatty liver disease and alcoholic fatty liver disease), cirrhosis, liver failure, liver cancer, etc., are common and harmful diseases. At the current medical level, it is difficult to have good treatment plans and drugs. The development of liver disease treatment plans is still a difficult problem that people are committed to solving.

[0003] A large number of studies have shown that mitochondrial function is closely related to liver health. As an organelle for energy metabolism in cells, mitochondria dysfunction is associated with a series of liver diseases. For example, non-alcoholic fatty liver disease (NAFLD) refers to a clinical pathological syndrome characterized by excessive fat deposition in hepatocytes caused by factors other than alcohol and other clear liver damage, including simple fatty liver (NAFL), non-alcoholic steatohepatitis (NASH), and NASH-related liver fibrosis. NAFLD has become the most common chronic liver disease, with a global prevalence of 32.4%. Studies have shown that liver mitochondrial dysfunction plays an important role, including mitochondrial morphological changes, mitochondrial DNA damage, fatty acid metabolism disorders and energy metabolism abnormalities, oxidative stress, lipid peroxidation, and abnormal mitochondrial autophagy. Therefore, research on liver mitochondria has become a new and important breakthrough in the prevention and treatment of NAFLD.

[0004] For example, Gao Xiaoqiang (Affiliated Hospital of Guizhou Medical University) reported in 2022 that mitochondrial dysfunction promotes the progression of hepatocellular carcinoma (HCC) and affects the prognosis of tumors. Studies have shown that regulating mitochondrial function is an effective treatment. However, there are currently no mitochondrial targeted drugs for the treatment of HCC.

[0005] Therefore, research on liver disease treatment plans and drugs from the perspective of mitochondrial function is an important direction for developing generally positive effects on liver health and the treatment of various liver diseases. Summary of the invention

[0006] The main purpose of the present invention is to develop liver disease prevention and treatment drugs with generally positive significance for liver health and the treatment of various liver diseases based on the research of mitochondrial function.

[0007] The first object of the present invention is to provide the use of Ndufa7 gene as a target in the preparation of drugs for preventing, improving and / or treating liver diseases.

[0008] The second object of the present invention is to provide the use of Ndufa7 gene in preparing medicine for preventing, improving and / or treating liver disease.

[0009] The third object of the present invention is to provide the use of an expression promoter of Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating liver disease.

[0010] The fourth object of the present invention is to provide an animal model with Ndufa7 gene knockout for use in screening or evaluating drugs for treating liver diseases.

[0011] The fifth object of the present invention is to provide a drug containing an expression promoter of the Ndufa7 gene.

[0012] The sixth object of the present invention is to provide a method for constructing an animal model of liver disease.

[0013] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0014] The present invention detected the liver function of Ndufa7 knockout mice and found that inhibiting the down-regulation of Ndufa7 gene expression will lead to abnormal liver function and liver tissue damage in mice. Six liver function tests found that the levels of amino acid transferases (ALT, AST) in the serum of Ndufa7 knockout mice were significantly increased. In addition, the present invention used real-time fluorescence quantitative PCR analysis of liver tissue of Ndufa7 knockout mice and found that inhibiting the expression of Ndufa7 gene can induce the occurrence of non-alcoholic fatty liver disease, confirming that Ndufa7 is down-regulated in liver disease.

[0015] The present invention further studied the relevant mechanism, and the results showed that the deletion of the Ndufa7 gene will lead to abnormalities in the mitochondrial respiratory chain and ATP synthesis, increased oxidative stress, loss of mitochondrial structural integrity and other related mitochondrial function decline, thereby confirming that there is a close relationship between the involvement of the Ndufa7 gene in the pathogenesis of liver disease and the mitochondrial dysfunction caused by mitochondrial energy metabolism.

[0016] That is, the present invention fully proves that Ndufa7 is involved in the pathogenesis of liver disease and has important application value in preventing, improving or treating liver disease and drug development.

[0017] Therefore, in a first aspect, the present invention seeks to protect the use of the Ndufa7 gene as a target in the preparation of drugs for preventing, improving and / or treating liver diseases.

[0018] In a second aspect, the present invention seeks to protect the use of the Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating liver disease.

[0019] In addition, the present invention found that the survival rate of cells under oleic acid stimulation can be increased by overexpressing the Ndufa7 gene in cells, and oleic acid is a common reagent for inducing cell models such as non-alcoholic fatty liver disease, that is, overexpressing the Ndufa7 gene can prevent or improve liver disease and can be used as a drug for treating liver disease. Therefore, in the third aspect, the present invention claims the use of an expression promoter of the Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating liver disease.

[0020] Optionally, the Ndufa7 gene expression promoter includes an expression cassette of the Ndufa7 gene or an expression vector containing the Ndufa7 gene.

[0021] Specifically, the liver disease includes at least one of fatty liver, cirrhosis, liver failure, and liver cancer.

[0022] Specifically, the liver disease is a liver disease caused by mitochondrial dysfunction.

[0023] Specifically, the fatty liver is non-alcoholic fatty liver or alcoholic fatty liver.

[0024] Specifically, the non-alcoholic fatty liver disease includes non-alcoholic fatty liver disease caused by a high-fat diet.

[0025] The present invention also claims to protect the use of an animal model with Ndufa7 gene knocked out in screening or evaluating drugs for treating liver diseases.

[0026] The present invention also provides a medicine containing an expression promoter of the Ndufa7 gene, and the medicine can be used as a medicine for preventing, improving and / or treating liver diseases.

[0027] Optionally, the Ndufa7 gene expression promoter includes an expression cassette of the Ndufa7 gene or an expression vector containing the Ndufa7 gene.

[0028] Specifically, the liver disease includes at least one of fatty liver, cirrhosis, liver failure, and liver cancer.

[0029] Specifically, the liver disease is a liver disease caused by mitochondrial dysfunction.

[0030] Specifically, the fatty liver is non-alcoholic fatty liver or alcoholic fatty liver.

[0031] Specifically, the non-alcoholic fatty liver disease includes non-alcoholic fatty liver disease caused by a high-fat diet.

[0032] The present invention also provides a method for constructing an animal model of liver disease, the method comprising: knocking out the Ndufa7 gene of an animal used for constructing the model, or inhibiting the expression of the Ndufa7 gene, to construct the animal model of liver disease.

[0033] Optionally, the animal is a mouse.

[0034] In a specific embodiment of the present invention, the ID of the Ndufa7 gene in the NCBI database is 66416.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] The present invention detects and analyzes the liver function and liver tissue of Ndufa7 gene knockout mice and finds that knocking out the Ndufa7 gene will lead to abnormal liver function and damaged liver tissue in mice. At the same time, through real-time quantitative fluorescence PCR, it is found that inhibiting the expression of the Ndufa7 gene can induce the occurrence of non-alcoholic fatty liver disease, and the Ndufa7 gene can be used as a liver disease treatment gene target to develop liver disease treatment drugs. In addition, the present invention finds that the survival rate of cells under oleic acid stimulation can be increased by overexpressing the Ndufa7 gene in cells, and oleic acid is a common reagent for inducing cell models such as non-alcoholic fatty liver disease, that is, overexpressing the Ndufa7 gene can prevent or improve liver disease and can be used as a liver disease treatment drug.

[0037] The present invention fully proves that Ndufa7 is involved in the occurrence of liver disease, which is beneficial to the development of drugs for preventing, improving or treating liver disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 These are the detection results of mRNA expression levels of Mfn1, PPARα, CHOP, NF-κB, Trx1 and Prdx2.

[0039] Figure 2 The results are shown in Table 1. The liver weight ratio and liver-tibia ratio of each model mouse were calculated.

[0040] Figure 3 The liver function test results of each model mouse.

[0041] Figure 4 Liver staining results (hematoxylin-eosin (HE) staining, Masson staining, Sirius red staining and Oil Red O staining) and transmission electron microscopy (TEM) images (0.5K) of each model mouse.

[0042] Figure 5 Statistical results of liver fibrosis degree and lipid droplet distribution in mice.

[0043] Figure 6 The electron microscopic observation results (7.5K) of liver mitochondria of each model mouse.

[0044] Figure 7 The effect of overexpression of Ndufa7 gene on the survival rate of cells stimulated by oleic acid.

[0045] In the figures, *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention is further described below in conjunction with the accompanying drawings and specific embodiments. However, it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0047] The experimental mice used in the embodiments of the present invention are 5-month-old C57BL / 6 wild-type mice (WT mice) and 5-month-old Ndufa7 gene knockout mice (KO mice) constructed by CRISPR / Cas9 gene editing technology; the ID of the Ndufa7 gene in the NCBI database (https: / / www.ncbi.nlm.nih.gov) is 66416.

[0048] Example 1 Effects of knocking out the Ndufa7 gene and high-fat diet on liver function in mice

[0049] 1. Construction of mouse models with different diets

[0050] The present invention uses a normal diet (ND) and a high-fat diet (HFD) to feed WT mice and KO mice respectively, and constructs four model mice, namely, normal diet model (ND-WT) mice, normal diet model (ND-KO) mice, high-fat diet model (HFD-WT) mice and high-fat diet model (HFD-KO) mice. The nutritional composition of the normal diet and the high-fat diet are shown in Table 1 and Table 2, respectively.

[0051] Table 1 Nutrient composition of normal diet

[0052]

[0053]

[0054] Table 2 Nutrient composition of high-fat diet

[0055] Component (unit) gm(%) Kcal(%) protein 26.2 20 Fat 26.3 20 carbohydrate 34.9 20 total 60 Total energy (kcal / gm) 5.24

[0056] The high-fat model was established for 13 weeks. The mice were weighed and recorded at a fixed time every week, and the body weight changes of mice in each group were used to evaluate the establishment of the high-fat model.

[0057] 2. Detection of mRNA expression levels of mitochondrial fusion protein Mfn1, ligand-activated transcription factor PPARα, CHOP protein, chronic inflammatory molecule NF-κB, Trx1 and Prdx2

[0058] (1) Extraction of RNA from mouse liver tissue

[0059] ① Take 10-20 mg of liver tissue sample and put it into a 1.5 mL grinding Eppendorf tube, add two grinding magnetic beads (one large and one small), and add 350 μL Buffer RL, and grind in a ball mill at a frequency of 50 Hz and a time of 50 s;

[0060] ② Place the lysed sample in a desktop centrifuge at 4°C and centrifuge at 3000 rpm for 30 seconds, and filter the liquid;

[0061] ③ Transfer the lysate to a new collection tube and centrifuge at 12000 rpm for 10 min at 4°C.

[0062] ④ Transfer the filtrate to a new collection tube, add 50% anhydrous ethanol (1 times the volume of the filtrate), and mix thoroughly (50% anhydrous ethanol is freshly prepared);

[0063] ⑤ Transfer the filtrate to a new collection tube, centrifuge at 6000 rpm for 45 seconds at 4°C, and discard the filtrate;

[0064] ⑥ Add 700 μL Buffer RW1 to the collection tube, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate;

[0065] ⑦ Add 700 μL Buffer RW2 to the collection tube, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate;

[0066] ⑧Add 500μL Buffer RW2 to the collection tube and centrifuge at 12000rpm for 2min. Transfer the adsorption column in the collection tube to a 1.5mL RNase-free centrifuge tube, add 80μL of preheated RNase-free ddH2O to the adsorption column, leave it at room temperature with the lid open for 1min, and centrifuge at 12000rpm for 5min to elute RNA.

[0067] (2) Determination of RNA concentration in extracted mouse liver tissue

[0068] (3) Reverse transcription

[0069] The extracted mouse liver tissue RNA was reverse transcribed into cDNA. The specific method is as follows: refer to Table 3 to prepare a reaction solution for removing genomic DNA from the extracted total RNA (without adding 5×HiScript III qRT Super Mix temporarily) and place it in a PCR instrument to react at 42°C for 2 minutes. After the reaction is completed, 4 μL of 5×HiScript III qRT SuperMix is ​​added to the mixed solution, mixed and centrifuged briefly, and then placed in a PCR instrument for reverse transcription. The reaction conditions are 37°C, 15min; 85°C, 5s; after the reverse transcription is completed, the product can be directly used for RT-PCR.

[0070] Table 3

[0071] Contents volume <![CDATA[RNase-free ddH2O]]> To 16μL 4×gDNAwiper Mix 4μL Template RNA Total RNA 2μg 5×HiScript III qRT Super Mix 4μL

[0072] (4) RT-PCR detection

[0073] The sequences of the primers used for RT-PCR are shown in Table 4. The RT-PCR results were analyzed using GAPDH as an internal reference and 2 -ΔΔCt Analysis Methods The relative expression levels of mRNA were analyzed.

[0074] Table 4 Primers used for RT-PCR detection

[0075] Primer name Sequence (5′-3′) GAPDH-Forward ACAGCAACAGGGTGGTGGAC GAPDH-Reverse TTTGAGGGTGCAGCGAACTT Mfn1-Forward ATGTGGACCCCTCCTGATAGT Mfn1-Reverse GCCCAGTGATTTCAGCAAAGG PPARα-Forward CATACTCGCGGGAAAGACCA PPARα-Reverse CGTCTTCTCGGCCATACACA CHOP-Forward TATCTCATCCCCAGGAAACG CHOP-Forward GGGCACTGACCACTCTGTTT NF-κB-Forward ATGGCAGACGATGATCCCTAC NF-κB-Reverse TGTTGACAGTGGTATTTCTGGTG Trx1-Forward CAAGCCCTTCTTCCATTCC Trx1-Reverse GCAACATCCTGGCAGTCAT Prdx2-Forward CACCTGGCGTGGATCAATACC Prdx2-Reverse GACCCCTGTAAGCAATGCCC

[0076] The results of the mRNA expression levels of Mfn1, PPARα, CHOP, NF-κB, Trx1 and Prdx2 were shown in Figure 1 As shown. Figure 1It can be seen that the mRNA level of mitochondrial fusion protein Mfn1 was significantly reduced in ND-KO mice, indicating abnormal mitochondrial fusion and dysfunction in mitochondrial dynamics; the ligand-activated transcription factor PPARα is mainly expressed in fatty acid oxidation organs and is the main regulator of liver β-oxidation, used to regulate lipid metabolism levels. Compared with the ND-WT group of mice, the mRNA expression level of PPARα in ND-KO mice with Ndufa7 gene deletion was significantly reduced, and a high-fat diet caused a severe decrease in the liver PPARα level of WT mice, indicating that Ndufa7 gene deletion and high-fat diet will affect the lipid metabolism level of mouse liver; CHOP is a cellular protein that mainly participates in the regulation of cell proliferation, differentiation and energy metabolism, and its mRNA level is also in the Ndufa7 gene The expression of Trx1 in KO mice was significantly decreased after HFD induction.

[0077] 3. Biochemical analysis

[0078] In order to observe the effects of Ndufa7 gene knockout and high-fat diet on mouse liver function, the liver and tibia of the mice were taken and weighed, and the liver weight ratio and liver-tibia ratio of the mice were measured and calculated. At the same time, serum was taken for liver function test.

[0079] The calculation results of liver weight ratio and liver tibia ratio of each model mouse are as follows Figure 2 As shown. Figure 2 It can be seen that compared with normal mice, HFD induction significantly increased the liver tissue weight of mice (P<0.01).

[0080] Alanine aminotransferase (ALT), aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) are important markers of liver damage. The degree of liver damage is positively correlated with the increase in their levels. In addition, the liver is the site of albumin synthesis. The increase or decrease in albumin content reflects the health of the liver. The liver function test results of each model mouse are as follows: Figure 3 As shown. Figure 3The results show that Ndufa7 gene knockout caused the AST and ALT levels of ND-KO mice to be significantly higher than those of ND-WT mice (P<0.01), indicating that Ndufa7 gene knockout would cause a certain degree of damage to the liver function of mice; under the condition of high-fat diet induction, in addition to showing obvious differences in the levels of ALT, AST and LDH between WT and KO mice (P<0.01), the Albumin content of KO mice was lower than that of WT mice to a certain extent (P<0.05).

[0081] In summary, knockout of the Ndufa7 gene can cause liver damage in mice, and this damage may be more serious under the induction of a high-fat diet.

[0082] Example 2 Effects of knocking out the Ndufa7 gene and high-fat diet on mouse liver tissue

[0083] 1. Pathological and electron microscopic analysis of liver tissues in each model mouse

[0084] The liver tissues of each model mouse were taken for HE, Oil Red O, Masson and Sirus Red staining; the hematoxylin stain in HE dye dyes the chromatin and cell nucleus into purple-blue, and the eosin stain dyes the components in the cytoplasm and extracellular matrix into red; Oil Red O is a strong lipid solvent and lipid dye, which is easier to bind to triglycerides and presents small lipid droplets. Its specific binding with lipids makes the lipid-containing area appear red under an optical microscope, realizing the visualization of lipids; after Masson staining, muscle fibers appear red, and collagen fibers appear green or blue; after Sirus red staining, collagen fibers are dyed red and muscle fibers are dyed yellow. In addition, the distribution of fat droplets in mouse liver can be observed and intuitively analyzed under transmission electron microscopy. The degree of liver fibrosis and the distribution of fat droplets were statistically analyzed by combining the staining results and transmission electron microscopy results.

[0085] The liver staining results and transmission electron microscopy images of each model mouse are shown in Figure 4 The statistical results of the degree of liver fibrosis and lipid droplet distribution in mice are shown in Figure 5 shown. Figure 4 HE staining results showed that the hepatocytes of ND-WT mice were round in shape and the nuclei were located in the center of the hepatocytes, while the intercellular spaces of ND-KO mice were significantly enlarged. Under the pressure of high-fat diet, the livers of HFD-WT and HFD-KO mice showed varying degrees of vacuolar degeneration, and the cytoplasm of some hepatocytes of HFD-KO mice was completely squeezed to disappear by lipid droplets, and their nuclei were also squeezed. Masson and Sirus red staining can evaluate the degree of liver fibrosis in mice. Figure 4The staining results showed that the collagen fiber area of ​​KO mice under normal dietary conditions was significantly increased compared with WT mice. The two groups of mice induced by HFD also showed a high degree of fibrosis, and there were certain differences compared with the same WT or KO type mice, especially the Sirus red staining collagen score statistics showed a significant difference between the two groups of KO mice, indicating that the induction of a high-fat diet would aggravate the degree of liver fibrosis caused by Ndufa7 gene knockout. Based on the results of six liver function tests, the mouse liver was stained with Oil Red O to observe the lipid accumulation in the mouse liver. Judging from the pathological staining results and the statistical analysis results of the proportion of liver fat droplets, Ndufa7 gene knockout causes slight lipid accumulation in the liver. Figure 5 The statistics of relative lipid droplet area (P<0.05) showed that high-fat diet induced a significant increase in lipid accumulation in the livers of WT and KO mice, especially large areas of lipid droplet accumulation in the livers of HFD-KO mice.

[0086] Transmission electron microscopy (TEM) can observe the morphological structure and changes of organelles in tissues at different magnifications, and can observe the effects of Ndufa7 gene deletion and HFD induction on the liver. Analysis of the proportion of liver fat droplet area in four mouse models found that Ndufa7 gene deletion causes fat droplet generation, which may be caused by abnormal energy metabolism caused by mitochondrial gene deletion. In addition, HFD induction significantly increased the area of ​​liver fat droplets. Under the dual pressure of Ndufa7 gene deletion and HFD induction, the area proportion of liver fat droplets increased further (P<0.001).

[0087] In summary, Ndufa7 gene knockout can lead to liver fibrosis and hepatic lipid droplet accumulation in mice, and a high-fat diet will aggravate this result.

[0088] 2. Analysis of liver mitochondrial morphology

[0089] Mitochondria are the energy supply site in cells. Their morphology is constantly changing. Most of them are round or oval, and sometimes they are long and thin. Their transverse diameter is relatively consistent, but their long diameter varies greatly. Mitochondria are closed sac-like organelles surrounded by a double membrane, consisting of an outer membrane, an inner membrane, an outer cavity, and an inner cavity. The outer chamber is between the inner and outer membranes of mitochondria, and the inner membrane folds inward to form mitochondrial cristae. The inner chamber is between the cristae, which is filled with matrix.

[0090] The liver of one mouse was randomly selected from the four groups of model mice, and the morphological changes of mitochondria were observed under a transmission electron microscope. The electron microscope image at 7.5K magnification is shown in the figure below. Figure 6 As shown. Figure 6It can be seen that under normal dietary conditions, compared with WT mice, the outer membrane of some mitochondria in KO mice was damaged, the transverse diameter of mitochondria was inconsistent, and the inner chamber was swollen to a certain extent; compared with WT mice, the mitochondrial structure of the liver of HFD-WT mice was discontinuous and blurred, and the endoplasmic reticulum was dilated to a certain extent; the mitochondria in the liver of HFD-KO mice had swelling of the inner chamber, which led to an increase in the volume of mitochondria and membrane coating. In addition, the mitochondrial cristae were significantly reduced or even disappeared.

[0091] In summary, Ndufa7 gene knockout affects the liver mitochondrial morphology of mice to a certain extent, thereby causing impaired mitochondrial function. In addition, HFD induction also has a certain degree of impact on liver mitochondria. Example 3 Protective effect of overexpressing Ndufa7 gene on cells

[0092] Oleic acid (OA) can produce a series of toxic effects on cells. OA can be used to treat cells to induce cell lipid deposition and establish various cell lipotoxicity models, such as using OA to treat HepG2 cells (liver) to establish a non-alcoholic fatty liver disease (NAFLD) cell model. Based on the constructed HepG2 cells overexpressing the Ndufa7 gene, this example tested the survival rate of cells overexpressing the Ndufa7 gene under oleic acid treatment conditions.

[0093] The specific process is as follows:

[0094] 1. Construction of recombinant overexpression vector

[0095] Based on the commercially available vector pEGFP-C1, the Ndufa7 gene (ID: 66416) was inserted between the multiple cloning sites Xho I and BamH I to construct the recombinant overexpression vector pEGFP-C1-Ndufa7.

[0096] 2. Cell culture

[0097] HepG2 cells were cultured in a 37°C, 5% CO2 incubator using DMEM medium containing 10% fetal bovine serum. When the cell confluence reached 70% to 80%, the cells were digested with 0.25% trypsin-EDTA and passaged at a ratio of 1:3. Cells in the logarithmic growth phase were used for experiments.

[0098] 3. Oleic acid treatment

[0099] 18 hours after cell plating, the culture medium was replaced with DMEM medium containing 5% fetal bovine serum and 0.5% fatty acid-free bovine serum albumin, and the cells were transfected with pEGFP-C1 empty vector and pEGFP-C1-Ndufa7, respectively; the cell lines were exposed to 500 μM oleic acid (OA) or BSA (as control) for 24 hours, and the cell viability was determined by CCK8. The experiment was repeated 3 times.

[0100] 4. CCK8 detection of cell viability

[0101] 10 μL of CCK8 working solution (the volume ratio of CCK8 reagent stock solution to complete culture medium was 1:9) was added to each well of the 96-well plate, incubated in a 37°C incubator for 45 min, and the absorbance at 450 nm was detected with an enzyme-labeled instrument to calculate the cell survival rate.

[0102] Cell survival rate / %=[(A experimental group-A blank group) / (A control group-A blank group)]×100%.

[0103] Effect of overexpression of Ndufa7 on the survival rate of cells stimulated by oleic acid Figure 7 As shown. Figure 7 It can be seen that in the experimental group where Ndufa7 was not overexpressed in the cells, the survival rate of HepG2 cells in the OA stimulation group decreased significantly after OA stimulation compared with the control group, indicating that OA stimulation caused toxicity to the cells. After Ndufa7 was overexpressed in the cells, the decrease in cell survival rate was significantly improved under the same OA stimulation. Under the same OA stimulation, the survival rate of cells overexpressing Ndufa7 was significantly higher than that of cells not overexpressing Ndufa7, indicating that overexpressing the Ndufa7 gene has a protective effect on cells and can reduce OA-induced cytotoxicity.

[0104] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention shall be equivalent replacement methods and shall be included in the protection scope of the present invention.

Claims

1. Application of Ndufa7 gene as a target in the preparation of drugs for preventing, improving and / or treating liver diseases.

2. Application of Ndufa7 gene in the preparation of drugs for preventing, improving and / or treating liver diseases.

3. Use of an expression promoter of the Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating liver disease.

4. The use according to claim 3, characterized in that: The Ndufa7 gene expression promoter includes an expression cassette of the Ndufa7 gene or an expression vector containing the Ndufa7 gene.

5. The use according to any one of claims 1 to 3, characterized in that: The liver disease includes at least one of fatty liver, cirrhosis, liver failure and liver cancer.

6. The use according to claim 5, characterized in that: The liver disease is a liver disease caused by mitochondrial dysfunction.

7. The use according to claim 6, characterized in that: The fatty liver is non-alcoholic fatty liver or alcoholic fatty liver.

8. Application of Ndufa7 knockout animal models in screening or evaluating drugs for the treatment of liver diseases.

9. A drug containing an expression promoter of the Ndufa7 gene.

10. A method for constructing an animal model of liver disease, characterized in that: The Ndufa7 gene of the animal used to construct the model is knocked out, or the expression of the Ndufa7 gene is inhibited, so as to construct an animal model of liver disease.

Images